Pear MYB transcription factor PbrMYB4-like and application thereof
By providing the amino acid and nucleotide sequence of the pear PbrMYB4-like transcription factor and overexpressing the gene through a recombinant vector, the problem of insufficient tolerance to low-temperature stress in pears was solved, thereby improving the low-temperature stress tolerance and cold resistance of pears.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ANHUI AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-03-11
- Publication Date
- 2026-04-21
AI Technical Summary
The function of the MYB transcription factor PbrMYB4-like in pear is still unclear, and current technology lacks effective means to regulate the low temperature stress tolerance of pear.
We provided the amino acid and nucleotide sequences of the pear PbrMYB4-like transcription factor and overexpressed the gene via a recombinant vector to enhance the superoxide dismutase activity and reduce malondialdehyde content in pears under low-temperature stress, thereby improving the pear's tolerance to low-temperature stress.
By enhancing the activity of superoxide dismutase and reducing malondialdehyde content, the low-temperature stress tolerance of pears was significantly improved, cold resistance was enhanced, survival rate was increased, and cell damage was reduced.
Smart Images

Figure CN121895430A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and in particular relates to a pear MYB transcription factor PbrMYB4-like and its applications. Technical Background
[0002] MYB transcription factors are one of the largest families of transcription factors in plants, widely involved in secondary metabolism regulation, growth and development, and stress response processes. These proteins contain a highly conserved DNA-binding domain composed of approximately 52 amino acids, forming a helix-turn-helix conformation. This domain can recognize and bind to specific cis-acting elements in gene promoter regions, such as the AC element (ACCAAAC) and the MBS element (TAACTG).
[0003] MYB transcription factors are one of the largest transcription factor families in plants, widely involved in secondary metabolism, cell morphogenesis, and abiotic stress responses. In recent years, studies have reported that some MYB transcription factors play key roles in the low-temperature stress response of various plants. For example, grapes… VaMyb14 (Unique to cold-resistant varieties) Through activation COR78 Isothermal response gene expression enhances the reactive oxygen species scavenging system and regulates the ABA metabolic pathway, significantly improving the low-temperature adaptability of plants and grape callus (Fang et al., 2023). Pepper CaMYB80 Through with CaPOA1 Interaction enhances peroxidase activity and activates genes in the ICE-CBF-COR pathway, thereby increasing the low-temperature tolerance of peppers and heterologous expression plants (Xiao et al., 2024).
[0004] However, the functions of MYB transcription factors exhibit strong species-specificity and family subtype-specificity. Not only do the functions of the same MYB subfamily differentiate in different species, but there is even a functional duality of positive and negative regulation. For example, in Arabidopsis thaliana... MYB43 Transcription factors are upregulated under cold stress conditions, negatively regulating plant low-temperature adaptation by regulating CBF expression and inhibiting ICE1 activity.
[0005] There are few studies on the molecular mechanisms by which MYB transcription factors in pears participate in the regulation of low-temperature stress. Some literature reports on the role of MYB transcription factors in the regulation of low-temperature stress in pears. PbMYB1L By increasing the AtCBF family and AtKIN1 The expression of isothermal response genes reduces the accumulation of reactive oxygen species to strengthen the antioxidant system, thereby enhancing the plant's low-temperature tolerance (Zhou et al., 2024).
[0006] However, the function of PbrMYB4-like transcription factors in pear remains unclear. Summary of the Invention
[0007] To address the problems in the prior art, one of the objectives of this invention is to provide a transcription factor that regulates the tolerance of pear to low-temperature stress. The transcription factor is a pear PbrMYB4-like transcription factor, and its amino acid sequence is shown in SEQ ID NO.1.
[0008] Furthermore, the nucleotide sequence of the gene encoding the pear PbrMYB4-like transcription factor is shown in SEQ ID NO.2.
[0009] The second objective of this invention is to provide an application of the pear PbrMYB4-like transcription factor as described above in regulating pear's tolerance to low-temperature stress.
[0010] Furthermore, the pear PbrMYB4-like transcription factor enhances the pear's tolerance to low-temperature stress by increasing the activity of superoxide dismutase under low-temperature stress.
[0011] Furthermore, the pear PbrMYB4-like transcription factor improves the pear's tolerance to low-temperature stress by reducing the malondialdehyde content under low-temperature stress.
[0012] A third objective of this invention is to provide an application of the pear PbrMYB4-like transcription factor as described above in the cultivation of pear varieties or pear plants resistant to low-temperature stress.
[0013] The fourth objective of this invention is to provide a method for improving the tolerance of pears to low-temperature stress, specifically by increasing the expression level of genes encoding the pear PbrMYB4-like transcription factor as described above in pears.
[0014] Furthermore, pear cells or pear tissues were transformed using an overexpression vector containing the nucleotide sequence shown in SEQ ID NO.2 to regenerate pear plants resistant to low-temperature stress.
[0015] The fifth objective of this invention is to provide a recombinant vector or host cell for increasing the expression level of the gene of the pear PbrMYB4-like transcription factor in pear, wherein the recombinant vector or host cell contains the nucleotide sequence shown in SEQ ID NO.2.
[0016] The sixth objective of this invention is to provide the application of the recombinant vector or host cell described above in improving the low-temperature stress tolerance of pears.
[0017] The beneficial effects of this invention are as follows: This application discloses the pear MYB transcription factor PbrMYB4-like and the gene encoding it. Furthermore, through biological experiments, it demonstrates for the first time the function of the pear PbrMYB4-like transcription factor in enhancing plant cold resistance under low-temperature stress. This application transformed Arabidopsis thaliana and pear callus tissue with the PbrMYB4-like gene and found that plants stably overexpressing this gene exhibited significantly enhanced cold resistance under low-temperature conditions. Specifically, the transgenic plants showed significantly increased SOD activity and significantly decreased MDA content; simultaneously, the relative electrical conductivity of the transgenic plants was significantly reduced and the survival rate was significantly increased under low-temperature conditions, effectively activating the plant's low-temperature defense mechanism.
[0018] This invention provides key gene resources and technical support for improving the cold resistance of pears, and lays a theoretical foundation for creating new pear varieties that are highly cold-resistant, have stable yields, and are of high quality. Attached Figure Description
[0019] Figure 1 In Example 2 PbrMYB4-like The relative expression level of the gene under low temperature stress was observed. Pear seedlings were subjected to 4℃ low-temperature treatment for 0 h, 1 h, 3 h, 6 h, and 12 h, respectively. The expression differences of the gene at different treatment time points were detected by real-time quantitative PCR.
[0020] Figure 2 In Example 4 PbrMYB4-like Phenotypic images of overexpressing transgenic Arabidopsis thaliana lines (PbrMYB4-like-OE3, PbrMYB4-like-OE5) and wild-type Arabidopsis thaliana plants (WT) after recovery culture under ambient temperature of 25℃ and low temperature stress of -10℃ for 1 h 30 min, respectively.
[0021] Figure 3 In Example 4 PbrMYB4-like Survival of overexpressing transgenic Arabidopsis thaliana lines (PbrMYB4-like-OE3, PbrMYB4-like-OE5) and wild-type Arabidopsis thaliana plants (WT) after 6 days of recovery culture following treatment with -10℃ low temperature stress.
[0022] Figure 4 Phenotypic images of transgenic pear callus tissue (PbrMYB4-like-OE, PbrMYB4-like-KO, where the former is overexpressed callus and the latter is knockout callus) and wild-type (WT) in Example 5 under culture conditions of 25°C and 4°C.
[0023] Figure 5The fresh weight of transgenic pear callus (PbrMYB4-like-OE, PbrMYB4-like-KO, where the former is overexpressed callus and the latter is knockout callus) and wild-type (WT) in Example 5 was measured at 25°C and 4°C.
[0024] Figure 6 The relative electrical conductivity of transgenic pear callus tissue (PbrMYB4-like-OE1, PbrMYB4-like-OE2) and wild-type (WT) in Example 5 under culture conditions of 25°C and 4°C.
[0025] Figure 7 The MDA content of transgenic pear callus tissue (PbrMYB4-like-OE1, PbrMYB4-like-OE2) and wild-type (WT) in Example 5 was measured at 25°C and 4°C.
[0026] Figure 8 The data on SOD activity of transgenic pear callus and wild-type tissue in Example 5 are as follows: The test subjects include PbrMYB4-like-OE transgenic lines and WT wild-type materials. The test conditions cover culture at room temperature (25°C) and low temperature (4°C) for 10 days. Detailed Implementation
[0027] To facilitate understanding, the technical solution of the present invention will be described in more detail below with reference to the embodiments.
[0028] Example 1
[0029] PbrMYB4-like Acquisition of genes
[0030] Young pear leaves were placed in a mortar and pestle, liquid nitrogen was added, and the mixture was ground into powder. The RNA extraction kit was then prepared according to the instructions. After obtaining RNA, cDNA was synthesized using a cDNA reverse transcription kit and stored at -20°C.
[0031] The inventor identified from pears PbrMYB4-like The coding sequence of the gene was located. Specific primers were designed using PrimerPremier 5 software. PbrMYB4-like-F:ATGAGGAAACCTTGCTGTGAGA PbrMYB4-like-R:TCAGTATCCGAATGAACTTGGAG Using pear cDNA as a template, PCR amplification was performed using DNA polymerase. The amplification conditions were: 95℃ pre-denaturation for 1 min, followed by 35 cycles, including 95℃ denaturation for 15 s, 59℃ annealing for 15 s, 72℃ extension for 40 s, and a final extension at 72℃ for 1 min. The amplified products were detected by agarose gel electrophoresis. After detection, the gel was excised and recovered. The recovered products were sequenced by a sequencing company to obtain the complete sequence, and the gene was named... PbrMYB4-like Its nucleotide sequence is shown in SEQ ID NO:2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO:1.
[0032] Example 2
[0033] PbrMYB4-like Gene expression analysis
[0034] Rooted *Pyrus pyrifolia* tissue culture seedlings were selected and subjected to cold stress treatment after their growth stabilized. Samples were collected at 0 h, 1 h, 3 h, 6 h, and 12 h after treatment. The collected samples were rapidly frozen in liquid nitrogen for fixation and then transferred to an ultra-low temperature freezer at -80℃ for storage. Total RNA from the samples at each time point was then isolated and purified using an RNA extraction kit and converted into cDNA template via reverse transcription.
[0035] in accordance with PbrMYB4-like Specific quantitative primers P3 and P4 were designed based on the gene sequence characteristics. The specific sequences are as follows: P3(F): CCCAATAACCATCGCATAGG; P4(R):TTGAGGTCAGGCAAACCACA.
[0036] The Actin gene from *Pyrus pyrifolia* was used as an internal reference to correct for errors. The reaction system was prepared according to the instructions of the quantitative real-time PCR kit, with each reaction performed in triplicate to ensure reliable results. Amplification was performed using a StepOne Real-time PCR System, with the following program: 95℃ pre-denaturation for 2 min; followed by 40 cycles, each consisting of 95℃ denaturation for 15 s, 60℃ annealing for 30 s, and 72℃ extension for 20 s. Two... -ΔΔCt Relative quantification methods were used to analyze and calculate the fluorescence quantitative data. See [link / reference]. Figure 1 The experimental results show that PbrMYB4-like Gene expression levels peaked after 6 hours of cold treatment.
[0037] Example 3
[0038] PbrMYB4-like Construction of gene overexpression vectors
[0039] The pCAMBIA-1300 vector was selected as the backbone vector, and the restriction enzyme sites corresponding to Xba I and BamH I were chosen for vector construction. Subsequent steps will focus on... PbrMYB4-like Gene-specific amplification primers were designed, and vector homologous sequences matching the selected restriction enzyme sites were introduced before and after the primers to ensure efficient recombination of the target gene and the vector. The specific primer sequences are as follows: P5(F):gagaacacgggggactctagaATGAGGAAACCTTGCTGTGAGA; P6(R): gcccttgctcaccatggatccTCAGTATCCGAATGAACTTGGAG.
[0040] The pCAMBIA-1300 vector was double-digested with Xba I and BamH I to obtain a linearized vector fragment. Using pear leaf cDNA as a template, amplification was performed using primers P5 and P6. PbrMYB4-like The complete coding region sequence of the gene was obtained, and the amplified product was purified using a commercially available recovery kit. Then, it was ligated with the linearized pCAMBIA-1300 vector to finally obtain the recombinant overexpression vector pCAMBIA1300-PbrMYB4-like.
[0041] The recombinant vector was transformed into Escherichia coli DH5α competent cells. The transformation procedure was as follows: the recombinant vector and competent cells were thoroughly mixed and incubated in an ice bath for 30 min; then transferred to a 42℃ metal bath for 50 s heat shock treatment, and immediately returned to ice for another 3 min after the heat shock; LB liquid medium without antibiotics was added to the centrifuge tube, and the centrifuge tube was placed in a shaker at 37℃ for 1 h to achieve bacterial recovery and expression of the resistance gene.
[0042] After cultivation, the bacterial pellet was collected and evenly spread onto LB agar plates containing the corresponding screening antibiotic, and incubated upside down for 12 h. Single colonies growing on the plates were picked and inoculated into LB liquid medium containing the same concentration of kanamycin sulfate for expansion. Positive clones containing the target band were screened by PCR amplification combined with agarose gel electrophoresis and sent for sequencing verification. After confirming the sequencing results, 50% glycerol was added to the bacterial culture at the appropriate ratio to prepare glycerol-preserved bacteria, which were then stored at -80℃ for long-term use.
[0043] Example 4
[0044] Arabidopsis genetic transformation and screening
[0045] Will carry PbrMYB4-likeAfter activation, Agrobacterium strains containing the overexpression vector were used to transform Arabidopsis thaliana using the flower immersion method. First, a special infection suspension for Arabidopsis thaliana was prepared. Agrobacterium colonies were resuspended in this suspension by pipetting. When the OD600 value of the bacterial suspension reached 0.6, wild-type Arabidopsis thaliana plants that had bolted for 7 days were selected for flower immersion infection.
[0046] Infected Arabidopsis plants should be cultured in darkness for 1-2 days, followed by a second infection treatment after a 7-day interval. Seeds should be collected after the plants mature. This process is to obtain genetically stable... PbrMYB4-like For overexpression of transgenic Arabidopsis thaliana lines, the collected seeds need to be continuously screened and identified from generation T0 to T2.
[0047] After being harvested, the seeds were washed, dried, and then evenly sown on the surface of a selection medium containing hygromycin. The seeds were then cultured in a light incubator for approximately 7 days. Seedlings with good growth were selected, and genomic DNA was extracted from their leaves for positive identification. Plants that tested positive were designated as T0 generation transgenic Arabidopsis. The T0 generation plants were then self-pollinated, and subsequent screening and identification of progeny were conducted to ultimately obtain homozygous T2 generation transgenic Arabidopsis lines.
[0048] Frozenness resistance assessment (MS medium method)
[0049] Select an appropriate number of plants from two homozygous Arabidopsis lines, PbrMYB4-like-OE3 and PbrMYB4-like-OE5. PbrMYB4-like Overexpressing Arabidopsis thaliana was used, and its seeds, along with wild-type Arabidopsis thaliana (WT), were washed, dried, and then sown separately on conventional MS medium. After culturing in a 25°C light incubator for 7 days, the plants were transplanted into sterile soil substrate and placed in a greenhouse environment for further growth for 20 days. Subsequently, the plants were subjected to -10°C low-temperature stress for 1 hour and 30 minutes, and after the treatment, they were transferred to a 25°C environment for recovery culture for 6 days. The plant phenotype and survival were then compared and analyzed.
[0050] The results are as follows Figure 2 and Figure 3 As shown, under normal growth conditions at 25℃, there were no significant differences in leaf morphology, growth vigor, and survival rate among the three plant types (PbrMYB4-like-OE3, PbrMYB4-like-OE5, and WT). During the recovery period after low-temperature stress, all three plant types exhibited varying degrees of leaf yellowing and wilting, and their survival rates decreased. PbrMYB4-like The leaves of Arabidopsis thaliana overexpressing the gene showed less leaf damage and a significantly higher survival rate than wild-type plants, further validating the gene. PbrMYB4-like The key role of genes in regulating the freeze resistance of Arabidopsis thaliana.
[0051] Example 5
[0052] Obtaining callus tissue from genetically modified pears
[0053] Will carry PbrMYB4-like Agrobacterium strains containing overexpression and knockout vectors were activated and then transformed into pear callus tissue via Agrobacterium-mediated transformation. First, a callus-specific infection suspension was prepared. Agrobacterium colonies were then resuspended in this suspension by pipetting until the bacterial culture reached its OD value. 600 When the callus count reached 0.6, callus tissue with excellent growth and uniform condition was selected for immersion infection. Subsequently, resistance screening was conducted to obtain stably growing callus tissue. PbrMYB4-like Overexpression (OE) callus and knockout (KO) callus.
[0054] Frost resistance test of pear callus tissue
[0055] The above wild type and PbrMYB4-like Related transgenic pear callus tissues were cultured at 25℃ and 4℃ for 10 days, respectively, for auxiliary identification of frost resistance. Results are as follows: Figure 4 and Figure 5 As shown in the figure, it can be seen that there is no difference in the growth state of various callus tissues under 25℃ conditions, but after treatment at 4℃, PbrMYB4-like Overexpression significantly enhanced callus growth compared to wild-type. PbrMYB4 The growth of knocked-out callus tissue was significantly inhibited, further supporting this finding. PbrMYB4-like The positive regulatory role of genes in plant low-temperature tolerance.
[0056] Finally, low-temperature physiological parameters of the experimental plants were measured. Specifically, under normal temperature conditions of 25℃ and low-temperature stress conditions (-10℃ and 4℃), the relative conductivity, MDA content, and SOD activity of wild-type pear callus (WT) and transgenic pear callus (overexpressing callus PbrMYB4-like-OE1 and PbrMYB4-like-OE2) were measured and analyzed to explore... PbrMYB4-like Physiological mechanisms by which genes regulate plant frost resistance.
[0057] Low-temperature stress disrupts the structure of plant cell membranes, leading to increased membrane permeability and the leakage of intracellular electrolytes. Higher conductivity indicates more severe cell membrane damage. Detection results are as follows: Figure 6 As shown, at 25℃, there was no significant difference in electrolyte extravasation rate between wild-type pear callus and overexpressing callus; however, after low-temperature stress, the electrolyte extravasation rate of both types of plants increased significantly, but... PbrMYB4-like Electrolyte extravasation rate in pear callus overexpressing the gene was significantly lower than that in wild-type callus, indicating that... PbrMYB4-like Overexpression of genes can maintain the stability of cell membrane structure at low temperatures, reduce membrane permeability, reduce electrolyte loss, and thus enhance the plant's resistance to freezing.
[0058] MDA is a product of cell membrane lipid peroxidation, and its content can directly reflect the degree of damage to plants under low-temperature stress. MDA content detection results are as follows... Figure 7 As shown. At 25℃, there was no significant difference in MDA content in the callus tissue of the two types of plants; after being subjected to low-temperature stress at 4℃, the MDA content in the callus tissue of both types of plants increased with decreasing temperature, but... PbrMYB4-like The MDA content in overexpressed pear callus tissue was significantly lower than that in wild-type pear callus tissue, indicating that overexpression... PbrMYB4-like It can inhibit low-temperature-induced membrane lipid peroxidation, reduce cell membrane damage, and thus affect the plant's cold resistance.
[0059] Superoxide dismutase (SOD) is a key enzyme in the plant's antioxidant system, and its activity reflects the plant's ability to scavenge reactive oxygen species. SOD activity detection results are as follows: Figure 8 As shown. At 25℃, wild type (WT) and PbrMYB4-like There was no significant difference in SOD activity in callus tissue of PbrMYB4-like-OE overexpressing plants. After low-temperature stress at 4℃, the SOD activity in callus tissue of both types of plants increased with decreasing temperature. The SOD activity of PbrMYB4-like-OE callus tissue was significantly higher than that of wild-type callus tissue, indicating that overexpression... PbrMYB4-like It can enhance SOD activity at low temperatures and improve the ability to scavenge reactive oxygen species, thereby enhancing the plant's cold resistance.
[0060] In summary, both the antifreeze identification experiment and the physiological index test results indicate that... PbrMYB4-like The gene has a positive regulatory effect on the freeze resistance of Arabidopsis thaliana: overexpression PbrMYB4-like The ability of Arabidopsis thaliana to resist low-temperature stress can be enhanced by increasing SOD activity, reducing MDA content and electrolyte leakage rate.
[0061] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A transcription factor regulating the low-temperature stress tolerance of pears, characterized in that, The transcription factor is a pear PbrMYB4-like transcription factor, and its amino acid sequence is shown in SEQ ID NO.
1.
2. The transcription factor for regulating pear's tolerance to low-temperature stress as described in claim 1, characterized in that, The nucleotide sequence of the gene encoding the pear PbrMYB4-like transcription factor is shown in SEQ ID NO.
2.
3. The application of the pear PbrMYB4-like transcription factor as described in claim 1 in regulating pear's tolerance to low-temperature stress.
4. The application as described in claim 3, characterized in that, The pear PbrMYB4-like transcription factor enhances the pear's tolerance to low-temperature stress by increasing the activity of superoxide dismutase under low-temperature stress.
5. The application as described in claim 3, characterized in that, The pear PbrMYB4-like transcription factor improves pear's tolerance to low-temperature stress by reducing malondialdehyde content under low-temperature stress.
6. The application of the pear PbrMYB4-like transcription factor as described in claim 1 in the cultivation of pear varieties or pear plants resistant to low-temperature stress.
7. A method for improving the low-temperature stress tolerance of pears, characterized in that, Increase the expression level of the gene encoding the pear PbrMYB4-like transcription factor as described in claim 1 in pear.
8. The method as described in claim 7, characterized in that, Pear cells or pear tissues were transformed using an overexpression vector containing the nucleotide sequence shown in SEQ ID NO.2 to regenerate pear plants resistant to low-temperature stress.
9. A recombinant vector or host cell for increasing the expression level of the gene of the pear PbrMYB4-like transcription factor in pear, characterized in that, It contains the nucleotide sequence shown in SEQ ID NO.
2.
10. The application of the recombinant vector or host cell as described in claim 9 in improving the low-temperature stress tolerance of pears.