Construction method and application of stable virus infectious vector based on intramolecular micro homologous connection repair

By inserting I-SceI cleavage sites and microhomologous sequences into the viral genome, and utilizing I-SceI enzyme cleavage and MMEJ repair mechanisms, the instability of viral infectious vectors in prokaryotic engineered bacteria was solved, thereby improving the stability and infection efficiency of the vectors.

CN121896256APending Publication Date: 2026-04-21HUBEI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-05
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Viral infectious vectors are unstable in prokaryotic engineered bacteria, leading to inconsistent infection effects. Leakage expression of common virus-encoded proteins causes cytotoxicity and vector plasmid instability, making it difficult to solve the instability problem of DNA viruses by inserting intron sequences.

Method used

I-SceI cleavage sites and micro-homologous sequences are inserted into the viral genome. The genome is then cleaved using the I-SceI enzyme and formed through the micro-homologous end ligation repair mechanism (MMEJ). The stable vector exists in prokaryotic engineered bacteria and expresses the I-SceI enzyme in the host cells for repair.

Benefits of technology

The stability of viral infectious vectors in prokaryotic engineered bacteria was achieved, ensuring the consistency of infection efficiency and the effectiveness of the vectors. It is applicable to the construction of infectious vectors for DNA and RNA viruses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a construction method and application of a stable virus infectious vector based on intramolecular micro homologous connection repair, which is characterized in that the virus infectious vector with an unstable phenomenon in escherichia coli or agrobacterium is modified, so that the virus infectious vector is stably subcultured in engineering bacteria, and a host is effectively infected. An I-SceI site is inserted into a toxic gene sequence that causes the instabilization of an infectious vector to destroy a reading frame. And one side of the I-SceI site is provided with a homologous homologous base sequence of about 20 bp with the other side of the I-SceI site. A stable infectious vector with micro homologous sequences on two sides of the I-SceI site is formed. When host infection is carried out on the stable infectious vector with the I-SceI site, I-SceI enzyme is expressed at the same time, so that cutting of the stable infectious vector by the I-SceI enzyme can be completed, micro-homologous connection repair on two sides of the I-SceI site is induced, and a releasable virus vector is formed. By adopting the stable infectious vector disclosed by the invention, the phenomena of low infection efficiency and uncontrollable virus symptoms of an unstable virus infectious vector are solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to the construction method and application of stable viral infectious vectors. Background Technology

[0002] Viruses are non-independent life forms capable of infecting a host and multiplying using the cellular environment provided by the host. Viruses possess independent RNA or DNA genomes, encapsulated in a protein capsid encoded by the viral genome, forming viral particles. In natural viral transmission, whether through airborne, contact, wound, or insect-borne vectors, a process of recognition and invasion occurs between viral particle surface proteins and host cell receptors. While viral recognition receptors in plants are not yet clearly defined, directly injecting a viral genome stripped of its surface proteins into plant cells does not result in stable and effective viral infection.

[0003] In the field of genetic engineering, viruses are a common vector for delivering exogenous genes. Modified attenuated live vaccines or non-pathogenic viruses are used to carry exogenous genes into host cells for direct host immunization, or to express exogenous genes for the production of corresponding proteins and virus-mediated gene silencing effects.

[0004] The artificial propagation, extraction, and preservation of intact, live viral particles require demanding conditions, are complex, and are inefficient. These conditions include the need to cultivate specific viral hosts, low viral particle concentrations, the tendency for viral surface proteins to denature and become inactive during extraction, and the requirement for ultra-low temperature environments for preservation. Furthermore, the loss of viral activity during extraction and preservation also leads to unstable viral infection outcomes. Therefore, in genetic engineering, artificial viral infection is typically performed using infectious viral vectors to achieve consistent infection efficiency and controllable viral load.

[0005] Both RNA and DNA viral genomes can be made into infectious clones in the form of prokaryotic plasmid DNA. Infectious vectors in plasmid DNA form are easily constructed, modified, subcultured, replicated, expanded, extracted, purified, quantified, and preserved in engineered bacteria. For infection, the extracted infectious vector can be directly transformed and transfected into cultured animal or plant cells using electrostimulation or protoplast methods. For plant viruses, the infectious vector sequence can also be delivered into the plant cell nucleus using T-DNA mediated by Agrobacterium plasmids.

[0006] The construction of infectious vectors for RNA viruses involves reverse transcription of the viral RNA genome into a cDNA sequence, adding a promoter to the 5' end and a terminator to the 3' end of the cDNA. After transfection or transformation of host cells, the viral cDNA sequence with the promoter and terminator is transcribed to release the viral RNA sequence between the promoter and terminator, thus releasing the RNA virus genome. The released RNA virus genome can transcribe viral coding genes like a natural viral genome, translating the RNA virus-specific nucleic acid polymerase, capsid proteins, and viral motility proteins required for viral replication, enabling viral genome replication and viral proliferation, and completing artificial infection. Alternatively, infectious RNA virus clones can be transcribed in vitro to produce viral RNA, which can then be directly transfected into host cells for artificial infection.

[0007] The method of constructing infectious vectors for DNA viruses is to directly link the viral DNA genome sequence to a plasmid, and then the plasmid carries the viral DNA genome to transform or transfect cells.

[0008] The difficulty of constructing viral infection plasmids is related to the size of the viral genome. However, with the development of DNA multi-segment ligation technology, the construction of large plasmids has become relatively easy. However, leakage expression of common virus-encoded proteins in engineered bacteria can cause cytotoxicity, preventing the engineered bacteria carrying the viral genome from growing normally; or the virus-encoded protein may cause instability of the infectious vector plasmid in engineered bacteria in other ways, leading to the loss of viral genome fragments in the infectious vector during culture or subculturing. This results in the failure of infectious vector construction, or even if construction is initially successful, the effective infectious vector content decreases during host infection after culture and subculturing, leading to unstable or even absent infection. Both cytotoxicity caused by leakage expression of viral-encoded genes and instability of vector plasmids can be classified as infectious clonal instability.

[0009] For RNA virus invasive clones that are unstable, a common approach is to insert an intron sequence into the unstable gene reading frame in the viral cDNA, thus disrupting the reading frame. This protein cannot be expressed in prokaryotic engineered bacteria, causing the disruption. However, when the infectious vector is introduced into a eukaryotic host, the eukaryotic transcription system automatically splices the viral RNA sequences flanking the introns during transcription of the viral RNA genome, forming a complete viral RNA genome, which is then released, replicated, and proliferated.

[0010] The instability of infectious DNA viral clones cannot be overcome by inserting introns and then re-transcriptionally splicing them. However, the insertion sequence can also stabilize the vector by suppressing the expression of proteins that cause instability. The key to solving this problem lies in how to suppress the leakage expression of proteins from infectious DNA viral vectors in prokaryotic engineered bacteria and efficiently and seamlessly remove them during host infection to form a complete viral genome.

[0011] Homing endonucleases are a class of rare restriction DNA endonucleases with long, specific recognition sequences. They promote the repair of breaks and recombination at specific locations in the genome by cleaving double-stranded DNA. I-, with an 18 bp asymmetric recognition site... Sce I is one of the most commonly used homing endonucleases. As a tool for studying DNA double-strand breaks, it is frequently used in research on DNA break repair mechanisms and gene editing applications. Its relatively long 18 bp specific recognition site means that, apart from its original source, *Saccharomyces cerevisiae*, this site is not present in the genomes of most common organisms and is therefore unaffected by I- Sce Destruction by I- endonuclease. Sce The coding sequence for the I- endonuclease has been cloned and modified with various codon adaptability techniques, making it widely applicable to DNA breakage operations at specific artificial sites in various organisms. Furthermore, I- Sce The cleavage efficiency of the I endonuclease is higher than that of the CRISPR / Cas9 gene editing system.

[0012] In cells, DNA double-strand breaks are a serious form of genomic damage. Organisms primarily repair DNA double-strand breaks using three mechanisms: homologous recombination, non-homologous end joining (MMEJ), and microhomologous end joining (MMEJ). Homologous recombination requires a sequence homologous to the broken fragment as a template and relies on several protein factors primarily expressed during cell cycle division. The efficiency of homologous recombination is related to the distance between the break site and the homologous repair template; repair efficiency decreases rapidly with increasing distance from homologous sequences. Non-homologous end joining is mainly expressed during interphase of the cell cycle. After a double-strand break, a loop structure composed of Ku70 / Ku80 dimers immediately binds to the break site, protecting it and allowing for rapid rejoining. Microhomologous end joining (MMEJ) is one of the alternative repair mechanisms. It does not require long homologous sequence templates, nor does it require intact ends after breakage, nor does it require the involvement of numerous specific protein factors in homologous recombination and non-homologous end joining pathways. Instead, it utilizes micro-homologous regions of approximately 1 to 20 bp on either side of the break point to join double-stranded genome breaks. Post-joining recombination of the micro-homologous regions reduces the overlapping portion of the homologous regions by one repeat unit. The MMEJ repair mechanism is widely present in prokaryotes and eukaryotes and can function at any stage of the cell cycle.

[0013] Utilizing the MMEJ micro-homogeneous repair mechanism and I- Sce I- Endonuclease, this patented design inserts I- into the viral gene sequence that causes clonal instability in viral infectivity. SceThe I-cleavage site disrupts the continuity of the gene's reading frame, preventing leakage expression of unstable protein factors. The MMEJ mechanism, a double-strand break repair mechanism, is then utilized at the I-cleavage site. Sce Introduce a sequence of approximately 20 bp, slightly homologous to the one on the other side, to facilitate the I- Sce After artificial enzyme cleavage at the I- site, MMEJ recombination occurs at adjacent sites within the original DNA molecule, removing the I- Sce The I-cutting site and the introduced micro-homologous sequence form a complete viral infectious vector sequence.

[0014] This patented design enables the originally unstable viral infectious vector to remain stable in prokaryotic engineered bacteria, making it easy to handle and ensuring the effective infectivity of the infectious vector. When the infectious vector is used for host cell transformation and transfection, commercially available I- is added simultaneously. Sce I enzyme or to perform I- Sce The transient expression of enzyme I, utilizing the high efficiency of intramolecular recombination, generates a large number of complete viral sequences for effective infection. This method is applicable to the construction of infectious vectors for both DNA and RNA viruses. Summary of the Invention

[0015] This invention aims to design I- with micro-homologous sequences flanking the viral sequence. Sce I-cutting points are used to construct stable viral infectious vectors. This invention designs and constructs I-cutting points with micro-homologous regions on both sides. Sce The I-cutting site sequence is inserted into the viral infection vector sequence into a protein-coding region that causes vector instability, thereby disrupting protein expression. This artificial cut site and the introduced microhomological region sequence can be expressed by the artificial DNA endonuclease I- during host infection. Sce I- removal leads to effective infection. Therefore, the first objective of this invention is to design I- with micro-homologous sequences on both sides. Sce I-cutting point. A second objective of this invention is to provide the aforementioned I-cutting point flanked by micro-homologous sequences. Sce A method for constructing a stable viral infectious vector based on intramolecular microhomology link repair at the I-cut point. A third objective of this invention is to provide a method for applying the aforementioned stable viral infectious vector based on intramolecular microhomology link repair.

[0016] To achieve the above objectives, the present invention adopts the following technical solution: As a first aspect of the present invention, I- with micro-homologous sequences on both sides SceThe I-cutting point is inserted into the infectious vector sequence of a virus exhibiting clonal instability. First, the viral coding sequence causing instability is identified in the unstable viral vector, typically the RdRP gene of RNA viruses and the Rep gene of DNA viruses responsible for viral genome replication. A short exogenous sequence is inserted into the RdRP, Rep, or other unstable gene sequences to disrupt gene expression in a region. A specific region of approximately 20 bp is selected and positively repeated to form tandem microhomological regions. Then, the I-cutting point is... Sce The I-cutting point sequence is placed between two micro-homological regions. Sce I-cutting sites and repetitive microhomological regions can disrupt viral coding sequences, thereby stabilizing the infectious vector. This stable vector requires I-cutting sites to infect the host. Sce I enzyme in I- Sce The I-cleavage site breaks the DNA double strand, and the host's own MMEJ repair mechanism seamlessly removes the I-cleavage site through DNA double-strand break repair. Sce I cut point and introduced micro-homologous repeat sequence.

[0017] According to the present invention, the I- Sce The cut-off sequence is shown in SEQ ID NO: 1. This sequence belongs to the known sequences in the prior art.

[0018] According to the present invention, the I- Sce The gene sequence of enzyme I is shown in SEQ ID NO: 8. This sequence is known in the prior art, and there are also modified sequences with similar functions. When applying it, the appropriate I-enzyme should be selected based on the host's codon preferences. Sce The modified gene sequence of enzyme I.

[0019] As a second aspect of the invention, I- with micro-homologous sequences on both sides Sce The method for constructing a stable viral infectious vector with intramolecular microhomological ligation repair at the I cleavage site includes the following steps: Step 1: Insert a short exogenous sequence into the unstable gene sequence within the infectious vector, targeting a region that disrupts gene expression. Select a single, commonly used restriction endonuclease site. Linearize the infectious vector using this restriction endonuclease.

[0020] Step 2: Based on the linearization site described in Step 1, using I- as shown in SEQ ID NO: 1 Sce The I-cutting point sequence and the sequence sequence approximately 20 bp upstream of the linearization site together form "I- Sce The DNA sequence is defined as "I-cutting site + repeat microhomological region". SceThe "I-cutting site + repeat microhomological region" DNA sequence has ends designed and added to both sides that are complementary to the linearization site described in step one, forming an "I- Sce The DNA sequence is defined as "I-cutting site + repeating microhomological region + linker end". This "I-" sequence was artificially synthesized using chemical methods. Sce The DNA sequence consists of two strands: the cleavage site, repeat micro-homologous regions, and the linker ends.

[0021] Step 3: Anneal the two strands above to form short double-stranded DNA.

[0022] Step 4: Ligate the short double-stranded DNA formed by annealing with the linearized infectious vector described in Step 1 to form a vector containing I- Sce Stable infectious vectors with I-cutting sites and repeating micro-homologous region sequences.

[0023] Steps one through four, which involve designing microhomological sequences based on a single commonly used restriction endonuclease site, synthesizing short artificial DNA sequences, and constructing ligations, can be replaced by chemical synthesis methods that directly synthesize the entire stable infectious vector DNA. Chemical synthesis is more convenient and saves labor costs when the viral genome is small. Furthermore, when a suitable single commonly used restriction endonuclease site cannot be found, "I-" can be inserted at any position on the infectious vector where the reading frame needs to be broken. Sce "I cut site + repeat micro-homologous region" DNA sequence.

[0024] As a third aspect of the invention, the application of a stable viral infectious vector constructed based on intramolecular microhomology repair involves inserting "I-" into the gene sequence that causes instability in infectious clones on the infectious vector. Sce A stable vector containing the "I-cutting site + repeat microhomologous region" DNA sequence was constructed, and the vector was transformed or transfected into host cells or host organisms. Simultaneously with the transformation and transfection of the stable infectious vector, I- was introduced into the host cells. Sce I enzyme, or simultaneously I- Sce Expression of enzyme I. I- Sce I enzyme cleaves I- in stable infection vectors within host cells. Sce The I-cleavage site causes a double-strand break in the infectious vector DNA, which in turn leads to I- Sce MMEJ repair is performed on the microhomological regions on both sides of the I cleavage site to form a complete and active infection clone.

[0025] As a fourth aspect of the present invention, in the host I- Sce Expression of enzyme I can be achieved by using an active promoter within the host cell to construct an enzyme based on I- Sce The I gene sequence is constructed using methods prior to its formation. For example, plant promoters are used for plant hosts, and animal promoters are used for animal hosts.Sce Expression vectors for enzyme I. When infectious vectors are used to infect animal cells, commercially available I- enzymes can also be used. Sce Methods for directly introducing enzyme preparations across the cell membrane into animal cells.

[0026] As a fifth aspect of the present invention, a method for constructing stable viral infectious vectors based on intramolecular micro-homogeneous linkage repair provides a reliable and stable artificial infectious vector basis for viral pathogenicity detection.

[0027] As a sixth aspect of the present invention, the method for constructing stable artificial infectious vectors described above provides a reliable basis for the development of antiviral drugs using stable artificial infectious vectors.

[0028] As a seventh aspect of the present invention, the method for constructing a stable artificial infectious vector described above provides a molecular basis for the development of attenuated live vaccines or viral expression vector delivery systems.

[0029] The present invention provides a method for constructing stable viral infectious vectors based on intramolecular microhomological link repair, which has the following advantages: it can achieve the following through I- Sce Insertion at the I-cutting point stabilizes the viral infectious vector, enabling the successful construction, stable passage, and preservation of viral infectious vectors that often exhibit instability, and facilitating their transmission within the host via I- Sce Enzyme I-specific cleavage induces seamless repair of microhomological regions on both sides of the breakpoint, forming a functional, active, infectious vector sequence. Attached Figure Description

[0030] Figure 1 A schematic diagram illustrating the design of a stable viral infectious vector based on intramolecular microhomological link repair. Figure 2 A map of stable infection vectors of Chinese tomato yellow leaf curl virus (TYLCCNV) based on intramolecular microhomological link repair. Figure 3 This study compares the stability of the stable carrier for TYLCCNV based on intramolecular microhomological link repair with the unstable carrier before modification. Bam After HI digestion, the unstable vector before modification lost some of its original 2.7 kbp band after passage. However, the modified vector was stable during passage, and all plasmids retained the original 2.7 kbp band. Detailed Implementation

[0031] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0032] 1. The strains, plasmids, and plant material sources involved in this invention Commercially available plasmids and bacterial strains were used for gene cloning. Plasmid pCAMBIA1300 was purchased from Abcam, and the *E. coli* strain was also used. Escherichia coli DH5α competent cells, Agrobacterium strain Agrobacterium tumefaciens GV3101 competent cells were purchased from Sangon Biotech. The pSpc plasmid vector was modified by the applicant by replacing the sequence between HindIII and EcoRI on the pER8 vector with a multiple cloning site sequence. The model plant, Nicotiana benthamiana, was obtained from Boyuan Biotechnology Co., Ltd.

[0033] 2. Molecular biology reagents The 2×PCR Master Mix, DNA molecular weight standards, and DNA nucleic acid dyes used were purchased from Qingke Biotechnology Co., Ltd. High-fidelity DNA amplification enzymes, restriction endonucleases, and T4 ligases were purchased from NEB Corporation. Reagents for plasmid extraction and DNA recovery were purchased from Sinopharm Chemical Reagent Co., Ltd. DNA sequence synthesis, primer synthesis, and gene sequencing were all performed at Qingke Biotechnology Co., Ltd.

[0034] 3. Culture medium and culture conditions LB medium: 1% (w / v) tryptone, 0.5% yeast extract, 0.5% sodium chloride (NaCl), dissolved in deionized water. Add 1.5% agar powder to the solid medium. Autoclave at 121°C for 15 minutes. After cooling the liquid medium, add the appropriate antibiotics. After cooling the solid medium to 50°C, add the appropriate antibiotics before solidification and pour into plates. Antibiotic concentrations: *Escherichia coli*: Kanamycin 50 μg / mL, Spectinomycin 60 μg / mL (must be used in LB medium). *Agrobacterium*: Kanamycin 50 μg / mL + Rifamycin 10 μg / mL, or Spectinomycin 60 μg / mL + Rifamycin 10 μg / mL. Culture conditions: Escherichia coli was cultured at 37°C, and Agrobacterium was cultured at 28°C. Solid plates needed to be inverted for culture, while liquid culture was carried out using a shaker at 200 rpm.

[0035] 4. Tobacco Benedict culture: Mixed substrate of peat moss 2: vermiculite 1, cultured in a light culture room at 25°C for 16 hours of light and 8 hours of dark light cycle.

[0036] 5. Agrobacterium infection buffer: 10 mM MgCl2, 5 mM MES, 50 μM acetylsylgenone, pH 5.7. Example

[0037] Based on the genome sequence of the Chinese tomato yellow leaf curl virus (TYLCCNV) isolate Y10A from the NCBI database, the applicant synthesized the TYLCCNV genome sequence and constructed the traditional TYLCCNV infectious vector pSpc.TYLCCNV using existing techniques. However, the applicant's basic research has determined that the leakage expression of the TYLCCNV Rep gene in Agrobacterium causes instability of the traditional TYLCCNV infectious vector in Agrobacterium. Therefore, the applicant reconstructed the vector using the stable viral infectious vector construction method based on intramolecular microhomological link repair described in this patent.

[0038] Select a single restriction endonuclease from the identified Rep gene sequence that causes instability in infectious clones. Bgl Site II, designed with Bgl II. Adhesive end "I- Sce "I cut point + repeating micro-homological region" sequence. I- Sce The cutting point is shown in SEQ ID NO: 1.

[0039] ATTACCCTGTTATCCCTA, SEQ ID NO: 1.

[0040] With Bgl II. Adhesive end "I- Sce The "I cut point + repeating micro-homologous region" sequence is shown in SEQ ID NO: 2.

[0041] AGATCTATTACCCTGTTATCCCTAGGCCAACATAATTATTTGTGTGGTCATCTAGATCT, SEQ ID NO: 2.

[0042] The forward and reverse strands of the sequence shown in SEQ ID NO: 2 were synthesized. The forward strand sequence is shown in SEQ ID NO: 3; the reverse strand sequence is shown in SEQ ID NO: 4.

[0043] GATCTATTACCCTGTTATCCCTAGGCCAACATAATTTGTGTGGTCATCTA, SEQ ID NO: 3.

[0044] GATCTAGATGACCACACAAATAATTATGTTGGCCTAGGGATAACAGGGTAATA, SEQ ID NO: 4. Example

[0045] With Bgl II. Adhesive end "I- Sce The "I-cutting site + repeat microhomologous region" sequence undergoes annealing of both forward and reverse strands to form a double-stranded fragment. The forward and reverse strand DNA sequences exist as single-stranded DNA fragments. The synthesized single-stranded DNA fragment is diluted to a concentration of 10 μM with deionized water. 2 μL of each of the 10 μM forward and reverse strands are mixed and the volume is brought to 50 μL. The reaction mixture is heated at 95°C for 5 minutes. It is then allowed to cool naturally to room temperature. This annealing process forms the double-stranded DNA fragment. Example

[0046] The Rep gene coding region of the TYLCCNV infectious vector pSpc.TYLCCNV constructed using traditional methods was subjected to a single restriction endonuclease assay. Bgl The vector was linearized by enzyme II digestion.

[0047] will have Bgl II. Adhesive end "I- Sce An annealed double-stranded DNA fragment containing the "I-cut site + repeat microhomological region" sequence was ligated to linearized pSpc.TYLCCNV using T4 DNA ligase. Ligation conditions are described in the NEB product manual. This formed a stable viral infection vector pSpc.TYLCCNV.ISceI based on intramolecular microhomological ligation repair. The sequence of TYLCCNV.ISceI is shown in SEQ ID NO: 5.

[0048] Example

[0049] Construct the pCAMBIA.2×35S.ISceI plasmid. The applicant had previously ligated the 35S promoter, modified multiple cloning site, and Nos terminator sequence sequentially into the pCAMBIA1300 vector to construct the pCAMBIA.2×35S vector. The I- Sce The I enzyme coding sequence was inserted into the multiple cloning site of pCAMBIA.2×35S to construct the pCAMBIA.2×35S.ISceI plasmid.

[0050] Using primers SceF / SceR, with the applicant's existing I- Sce Using the sequence of enzyme I as a template, I- is amplified. Sce The gene sequence (765 bp) for enzyme I. The primer SceF sequence is shown in SEQ ID NO: 6. The primer SceR sequence is shown in SEQ ID NO: 7. I- Sce The gene sequence of enzyme I is shown in SEQ ID NO: 8.

[0051] ACGGATCCATGGCCCCCAAGAAGAAGC, SEQ ID NO: 6.

[0052] ACGGTACCTTACTTGAGGAAGGTCTCGGAG, SEQ ID NO:7.

[0053] ATGGCCCCCAAGAAGAAGCGCAAGGTCGGCGGCCCCAAGAAGAAGCGCAAGGTCGGCGGCGGCAAGAACATCAAGAAGAACCAGGTCATGAACCTCGGCCCCAACTCCAAGCTCCTCAAGGAGTACAAGTCCCAGCTCATCGAGCTCAACATCGAGCAGTTCGAGGCCGGCATCGGCCTCATCCTCGGCGACGCCTACATCCGCTCCCGCGACGAGGGCAAGACCTACTGCATGCAGTTCGAGTGGAAGAACAAGGCCTACATGGACCACGTCTGCCTCCTCTACGACCAGTGGGTCCTCTCCCCCCCCCACAAGAAGGAGCGCGTCAACCACCTCGGCAACCTCGTCATCACCTGGGGCGCCCAGACCTTCAAGCACCAGGCCTTCAACAAGCTCGCCAACCTCTTCATCGTCAACAACAAGAAGACCATCCCCAACAACCTCGTCGAGAACTACCTCACCCCCATGTCCCTCGCCTACTGGTTCATGGACGACGGCGGCAAGTGGGACTACAACAAGAACTCCACCAACAAGTCCATCGTCCTCAACACCCAGTCCTTCACCTTCGAGGAGGTCGAGTACCTCGTCAAGGGCCTCCGCAACAAGTTCCAGCTCAACTGCTACGTCAAGATCAACAAGAACAAGCCCATCATCTACATCGACTCCATGTCCTACCTCATCTTCTACAACCTCATCAAGCCCTACCTCATCCCCCAGATGATGTACAAGCTCCCCAACACCATCTCCTCCGAGACCTTCCTCAAGTAA, SEQ ID NO: 8.

[0054] The I - obtained by PCR Sce The gene fragment of I enzyme was Bam digested with HI / Kpn I and ligated by T4 ligase to the Bam HI / Kpn I multiple cloning site of pCAMBIA.2×35S. The plant expression vector pCAMBIA.2×35S.ISceI plasmid was constructed. Example

[0055] Construction of Agrobacterium invasive clones pSpc.TYLCCNV.ISceI-GV3101 and Agrobacterium expression strain pCAMBIA.2×35S.ISceI-GV3101. The plasmids pSpc.TYLCCNV.ISceI and pCAMBIA.2×35S.ISceI were electrotransformed into Agrobacterium GV3101 competent cells, respectively. Single colonies of the Agrobacterium invasive clone pSpc.TYLCCNV.ISceI and the Agrobacterium expression strain pCAMBIA.2×35S.ISceI were obtained by screening with spectinomycin + rifamycin and kanamycin + rifamycin combinations, respectively. The constructed strains were cultured in liquid LB with the appropriate antibiotics. After culture, they were frozen at -80℃ with a final glycerol concentration of 15% for later use. Example

[0056] Stability detection of the stable infectious vector constructed by the method of the present invention.

[0057] Plasmids were extracted from Agrobacterium pSpc.TYLCCNV.ISceI-GV3101 and pSpc.TYLCCNV-GV3101. These Agrobacterium plasmids were transformed into Escherichia coli DH5α competent cells. DH5α-positive clones were screened using spectinomycin. Ten E. coli monoclonal plasmids were extracted and digested with restriction endonucleases. The digestion patterns were compared with those of the pSpc.TYLCCNV.ISceI vector constructed in Example 3 before transformation of Agrobacterium to analyze whether any changes had occurred. The stable state of the vector plasmids within the engineered bacteria on the first day of liquid culture is shown in the image. Figure 3 As shown, the vector plasmid pSpc.TYLCCNV.ISceI remains stable, while some plasmids of the vector pSpc.TYLCCNV are deleted.

[0058] The plasmids in the successively passaged Agrobacterium were subjected to the stability analysis as described above, and the results are shown in Table 1.

[0059] Proportion of intact plasmids The first day The second day The third day The fourth day The fifth day The tenth day pSpc.TYLCCNV-GV3101 4 / 10 1 / 10 1 / 10 0 / 10 0 / 10 pSpc.TYLCCNV.ISceI-GV3101 10 / 10 10 / 10 10 / 10 10 / 10 10 / 10 10 / 10

[0060] The pSpc.TYLCCNV.ISceI plasmid constructed by the present invention based on the method of constructing stable viral infectious vectors by intramolecular micro-homology ligation repair corrects the instability of pSpc.TYLCCNV plasmids constructed by traditional methods in Agrobacterium. Example

[0061] Infection of the host model plant. Infective clones of Agrobacterium, pSpc.TYLCCNV.ISceI-GV3101 and pSpc.TYLCCNV-GV3101, and the Agrobacterium expression strain pCAMBIA.2×35S.ISceI-GV3101, were cultured in LB liquid medium at 28°C to OD.600 = 0.5 to 0.6. Collect Agrobacterium by centrifugation, and resuspend the Agrobacterium in Agrobacterium infection buffer to OD values. 600 = 2.

[0062] Application of a stable TYLCCNV viral infectious vector based on intramolecular microhomological link repair. The combination of pSpc.TYLCCNV.ISceI-GV3101 and pCAMBIA.2×35S.ISceI-GV3101 (each with a final concentration of OD) was used. 600 =1) Infection of 3-week-old Nicotiana benthamiana. Using a needleless syringe, inject Agrobacterium suspension into the leaf from the underside through the stomatal opening. Gently press the upper side of the leaf with your finger during injection; the Agrobacterium suspension will spread along the gap between the palisade and spongy tissues of the mesophyll, covering the entire leaf. Inject 0.2-0.3 mL of Agrobacterium suspension into each of the three larger leaves per plant.

[0063] pSpc.TYLCCNV-GV3101, constructed using traditional viral infectious cloning methods, was used as a control and diluted to OD with Agrobacterium infection buffer. 600 = 1, for infection of 3-week-old Nicotiana benthamiana. The method of injecting Agrobacterium suspension is the same as described in the previous paragraph. Example

[0064] Infection efficacy of host model plants. In Example 7, the combination of pSpc.TYLCCNV.ISceI-GV3101 and pCAMBIA.2×35S.ISceI-GV3101 showed stable infection efficacy, with all inoculated plants exhibiting obvious leaf curl virus symptoms. After 10 days of daily subculturing of pSpc.TYLCCNV.ISceI-GV3101, its combination with pCAMBIA.2×35S.ISceI-GV3101 maintained stable infection activity, with each inoculated plant showing obvious virus symptoms. This is consistent with the stability of the infectious vectors in Table 1.

[0065] The infection effect of pSpc.TYLCCNV-GV3101 decreased with the extension of the preservation and subculturing time of the infectious clone, which is reflected in the fact that not all inoculated plants can show virus plants, or all inoculated plants do not show virus symptoms.

[0066] The application of a stable viral infectious vector construction method based on intramolecular microhomological link repair in the construction of TYLCCNV infectious clones solves the problem that traditional construction methods cannot prevent the leakage expression of viral proteins in engineered bacteria, leading to instability of infectious clones in engineered bacteria. The instability of traditional infectious clones can result in a decrease or even disappearance of the effective infectious vector concentration during artificial host infection, leading to unstable infection or even complete failure of viral infection. The method of this invention is effective for constructing stable TYLCCNV infectious vectors, maintaining their stability in engineered bacteria while ensuring infectious activity during host infection.

[0067] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for constructing and applying a stable viral infectious vector based on intramolecular microhomological link repair, which involves modifying a viral infectious vector that exhibits instability in *Escherichia coli* or *Agrobacterium*, enabling it to be stably subcultured in engineered bacteria and thus effectively infect the host. I- Sce The I-cutting site is inserted into a key gene sequence that causes instability in infectious vectors to disrupt the reading frame. And in I- Sce One side of the I cleavage site is designed with a homologous 20 bp base sequence that is identical to the other side. This forms the I- Sce Stable infectious vectors with micro-homological sequences flanking the I-cut site. Sce A stable infectious vector with an I- cleavage point requires I- Sce I enzyme cleavage is used to complete microhomological ligation repair and form an effective viral vector.

2. The I- as described in claim 1 Sce The I-cutting point is inserted into a key gene sequence that causes instability in infectious vectors to disrupt the reading frame, characterized in that the I- Sce The insertion of the I-cleavage site into the viral infectious vector results in an unstable coding sequence of the infectious vector in prokaryotic engineered bacteria, disrupting the expression of key proteins.

3. The I- as described in claim 1 Sce One side of the I-cutting site is designed with a homologous 20 bp unidirectional base sequence that is identical to the other side. The characteristic is that the I- Sce The tangent point on one side is I- Sce The original sequence is next to the insertion site, and the other side is a positive short repeat of the opposite sequence.

4. The one with I- as described in claim 1 Sce A stable infectious vector with an I- cleavage point requires I- Sce The enzyme I cleavage is used to complete microhomological ligation repair, characterized in that the enzyme containing I- Sce Stable infectious vectors with I- cleavage sites simultaneously supplement the host with I- cleavage during infection. Sce I enzyme or intrahost I- Sce Expression of enzyme I.

5. A method for constructing a stable viral infectious vector with intramolecular microhomological link repair as described in any one of claims 1-3, characterized in that, The procedure includes the following steps: Step 1: Within the key gene coding region of the viral infectious vector, select a single restriction enzyme site, perform vector linearization by restriction enzyme digestion, and form sticky ends. Step 2: Approximately 20 bp of the sequence before this linearization site is appended to an 18 bp I-terminal. Sce After the I-cutting point, a total of approximately 38 bp of I- is formed. Sce I cut point + micro-homologous short sequence. I- Sce Step 1: Add sticky ends matching the linearized cleavage site to both sides of the micro-homologous short sequence, and artificially synthesize forward and reverse DNA single strands according to this sequence. Step 2: Anneal the artificially synthesized forward and reverse DNA single strands to form short double strands with sticky ends. Step 3: Ligate the annealed short double-stranded DNA to the linearized vector from Step 1. This completes the construction of the stable infection vector.

6. The viral vector infection method as described in claim 4, characterized in that, via I- Sce The I-cutting sequence breaks the critical gene reading frame, and during infection of the vector, I- is supplemented. Sce I enzyme or intrahost I- Sce Expression of enzyme I.

7. The application of the method for constructing a stable viral infectious vector based on intramolecular microhomological linkage repair as described in any one of claims 1-4 in the construction of infectious vectors for DNA viruses and RNA viruses.

8. The application of the method for constructing a stable viral infectious vector based on intramolecular microhomological linkage repair as described in any one of claims 1-4 in the construction intermediates of infectious vectors for DNA viruses and RNA viruses.

9. The application of a method for constructing a stable viral infectious vector based on intramolecular microhomological linkage repair as described in any one of claims 1-4 in the construction of fungal, animal, and plant viral infectious vectors and their construction intermediates.