Lysate for mycoplasma detection, sample pretreatment method and application

By using a lysis buffer with a specific composition and processing method, the problems of insufficient lysis efficiency and anti-interference ability in mycoplasma detection have been solved, and mycoplasma detection with high sensitivity and high specificity has been achieved.

CN121896320AActive Publication Date: 2026-04-21SHANGHAI CHILDRENS MEDICAL CENT AFFILIATED TO SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI CHILDRENS MEDICAL CENT AFFILIATED TO SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
Filing Date
2026-03-25
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Existing pretreatment methods for mycoplasma detection struggle to balance lysis efficiency and interference resistance, resulting in insufficient detection sensitivity and specificity, especially in complex samples where false negatives are common.

Method used

A lysis buffer consisting of Tris-HCl, guanidinoacetic acid, guanidine hydrochloride, potassium lauroyl sarcosinate, KCl, CHAPS, EDTA, EGTA, and tris(2-carboxyethyl)phosphonate was used. The sample was treated with chloroform and isoamyl alcohol, followed by RPA amplification and CRISPR reaction.

Benefits of technology

It achieves efficient release and purification of mycoplasma nucleic acid, improves the sensitivity and specificity of detection, and can accurately identify low-abundance mycoplasma in complex samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121896320A_ABST
    Figure CN121896320A_ABST
Patent Text Reader

Abstract

The invention provides lysate for mycoplasma detection, a sample pretreatment method and application, and relates to the technical field of biological detection. The invention provides a lysis solution for mycoplasma detection. The lysis solution is prepared from 70 to 120 mM of Tris-HCl, 0.8 to 2.0 M of guanidinoacetic acid, 1.5 to 4 M of guanidine hydrochloride, 0.08 to 0.2% (w / v) of potassium lauroyl sarcosinate, 40 to 80 mM of KCl, 0.2 to 0.6% (w / v) of CHAPS, 8 to 20 mM of EDTA, 2 to 5 mM of EGTA and 8 to 20 mM of tris (2-carboxyethyl) phosphine hydrochloride. The invention also provides a kit containing the lysate. The kit has relatively high sensitivity (the detection sensitivity can reach 1 * 100 copies / [mu] L) and specificity when being used for detecting mycoplasma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection, specifically relating to a lysis buffer, sample pretreatment method, and application for mycoplasma detection. Background Technology

[0002] Mycoplasma are a class of cell-wall-less, morphologically diverse prokaryotic microorganisms widely distributed in the natural environment. They readily contaminate cell culture systems, biopharmaceutical manufacturing processes, and clinical samples (such as respiratory secretions and body fluids). As typical intracellular parasites, mycoplasma can damage host cell function by robbing nutrients and producing toxic metabolic byproducts. This can lead not only to cell culture failure and substandard biopharmaceutical quality but also to diseases such as respiratory infections and genitourinary tract infections in humans. Therefore, establishing rapid, sensitive, and specific mycoplasma detection methods is of great significance for ensuring the quality of biopharmaceuticals and guiding clinical treatment.

[0003] Sample pretreatment is a crucial step in mycoplasma detection. Its core purpose is to efficiently lyse mycoplasma cell membranes, releasing nucleic acids (DNA / RNA), while simultaneously inhibiting nuclease activity and removing interfering substances from the sample matrix, providing a high-quality template for subsequent nucleic acid amplification (such as PCR, qPCR), sequencing, and other detection steps. Currently, pretreatment methods for mycoplasma detection mainly rely on commercially available lysis buffers or routine nucleic acid extraction kits, but these methods have several limitations in practical applications:

[0004] On the one hand, existing lysis buffers struggle to balance the structural characteristics of mycoplasma with detection requirements. Mycoplasma cell membranes are composed of a lipid bilayer core and lack cell wall protection, but their membrane proteins are rich in disulfide bonds, and nucleic acids are easily degraded by nucleases in the sample. Traditional lysis buffers often use a single denaturing agent (such as guanidine hydrochloride) or detergent (such as SDS), resulting in insufficient lysis efficiency and incomplete nucleic acid release. While some lysis buffers add reducing agents or chelating agents, the component concentration ratios are often unreasonable, failing to effectively disrupt membrane protein disulfide bonds or inhibit nuclease activity. This leads to the degradation of mycoplasma nucleic acids during extraction, thus affecting detection sensitivity.

[0005] On the other hand, existing pretreatment methods are susceptible to interference from sample matrix, resulting in poor specificity and compatibility. Clinical samples (such as sputum and serum) and cell culture supernatants contain a large number of impurities such as proteins, polysaccharides, and lipids. These impurities can bind to nucleic acids or inhibit subsequent enzymatic reactions, leading to false negative results. At the same time, high concentrations of irritating components in some lysis buffers (such as high concentrations of guanidine salts and special detergents) can inhibit enzymes such as PCR polymerases, requiring additional nucleic acid purification steps. This not only prolongs the detection cycle but may also cause nucleic acid loss, further reducing detection sensitivity.

[0006] Therefore, developing a pretreatment method for mycoplasma detection with optimized components, high lysis efficiency, and strong anti-interference ability to achieve high sensitivity and high specificity detection of low-abundance mycoplasma has become an urgent technical problem to be solved in this field. Summary of the Invention

[0007] To address the aforementioned problems, this invention provides a lysis buffer, sample pretreatment method, and application for mycoplasma detection.

[0008] On one hand, the present invention provides a lysis buffer for mycoplasma detection, wherein the lysis buffer is composed of 70-120 mM Tris-HCl, 0.8-2.0 M guanidinoacetic acid, 1.5-4 M guanidine hydrochloride, 0.08-0.2% (w / v) potassium lauroyl sarcosinate, 40-80 mM KCl, 0.2-0.6% (w / v) CHAPS, 8-20 mM EDTA, 2-5 mM EGTA and 8-20 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

[0009] Preferably, the lysis buffer consists of 80-110 mM Tris-HCl, 1.0-1.5 M guanidinoacetic acid, 1.5-3 M guanidine hydrochloride, 0.08-0.15% (w / v) potassium lauroyl sarcosinate, 50-70 mM KCl, 0.2-0.5% (w / v) CHAPS, 8-15 mM EDTA, 2-4 mM EGTA and 15-20 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

[0010] More preferably, the lysis buffer consists of 100 mM Tris-HCl, 1.0 M guanidinoacetic acid, 2 M guanidine hydrochloride, 0.15% (w / v) potassium lauroyl sarcosinate, 60 mM KCl, 0.4% (w / v) CHAPS, 15 mM EDTA, 3 mM EGTA and 18 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

[0011] In another aspect, the present invention provides a sample pretreatment method for mycoplasma detection, comprising the steps of: lysing the sample to be tested using a lysis buffer, wherein the lysis buffer is composed of 70-120mM Tris-HCl, 0.8-2.0M guanidinoacetic acid, 1.5-4M guanidine hydrochloride, 0.08-0.2% (w / v) potassium lauroyl sarcosinate, 40-80mM KCl, 0.2-0.6% (w / v) CHAPS, 8-20mM EDTA, 2-5mM EGTA and 8-20mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

[0012] The concentration of Tris-HCl in the lysis buffer can be selected from 70mM, 75mM, 80mM, 85mM, 90mM, 95mM, 100mM, 105mM, 110mM, 115mM, 120mM, or any intermediate value or a range between any two values.

[0013] The concentration of guanidinoacetic acid in the lysis solution can be selected from 0.8M, 0.9M, 1.0M, 1.1M, 1.2M, 1.3M, 1.4M, 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, 2.0M, or any intermediate value or a range between any two values.

[0014] The concentration of guanidine hydrochloride in the lysis solution can be selected from 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, 2.0M, 2.1M, 2.2M, 2.3M, 2.4M, 2.5M, 2.6M, 2.7M, 2.8M, 2.9M, 3.0M, 3.1M, 3.2M, 3.3M, 3.4M, 3.5M, 3.6M, 3.7M, 3.8M, 3.9M, 4.0M, and any intermediate value or a range between any two values.

[0015] The concentration of potassium lauroyl sarcosinate in the lysis buffer can be selected from 0.08% (w / v), 0.09% (w / v), 0.1% (w / v), 0.11% (w / v), 0.12% (w / v), 0.13% (w / v), 0.14% (w / v), 0.15% (w / v), 0.16% (w / v), 0.17% (w / v), 0.18% (w / v), 0.19% (w / v), 0.2% (w / v), and any intermediate value or a range between any two values.

[0016] The concentration of KCl in the lysis solution can be selected from 40mM, 45mM, 50mM, 55mM, 60mM, 65mM, 70mM, 75mM, 80mM, or any intermediate value or a range between any two values.

[0017] The concentration of CHAPS in the lysis buffer can be selected as 0.2% (w / v), 0.25% (w / v), 0.3% (w / v), 0.35% (w / v), 0.4% (w / v), 0.45% (w / v), 0.5% (w / v), 0.55% (w / v), 0.6% (w / v), or any intermediate value or a range between any two values.

[0018] The concentration of EDTA in the lysis solution can be selected from 8mM, 9mM, 10mM, 11mM, 12mM, 13mM, 14mM, 15mM, 16mM, 17mM, 18mM, 19mM, 20mM, or any intermediate value or a range between any two values.

[0019] The concentration of EGTA in the lysis solution can be selected as 2mM, 2.5mM, 3mM, 3.5mM, 4.0mM, 4.5mM, 5mM, or any intermediate value or a range between any two values.

[0020] The concentration of tris(2-carboxyethyl)phosphonic acid hydrochloride in the lysis solution can be selected from 8mM, 9mM, 10mM, 11mM, 12mM, 13mM, 14mM, 15mM, 16mM, 17mM, 18mM, 19mM, 20mM, or any intermediate value or a range between any two values.

[0021] Preferably, the lysis buffer consists of 80-110 mM Tris-HCl, 1.0-1.5 M guanidinoacetic acid, 1.5-3 M guanidine hydrochloride, 0.08-0.15% (w / v) potassium lauroyl sarcosinate, 50-70 mM KCl, 0.2-0.5% (w / v) CHAPS, 8-15 mM EDTA, 2-4 mM EGTA and 15-20 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

[0022] More preferably, the lysis buffer consists of 100 mM Tris-HCl, 1.0 M guanidinoacetic acid, 2 M guanidine hydrochloride, 0.15% (w / v) potassium lauroyl sarcosinate, 60 mM KCl, 0.4% (w / v) CHAPS, 15 mM EDTA, 3 mM EGTA and 18 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

[0023] In another aspect, the present invention provides a mycoplasma detection kit, the kit comprising the lysis buffer described above.

[0024] Specifically, the steps for detecting mycoplasma using the above-mentioned kit are as follows: S1. The sample to be tested is lysed using lysis buffer. Chloroform and isoamyl alcohol are added, mixed, and centrifuged. The upper aqueous phase is taken, isopropanol is added, mixed, and centrifuged. S2, Perform RPA amplification reaction; S3. Perform a CRISPR reaction on the amplification product obtained in step S2.

[0025] Specifically, the sample to be tested in step S1 is selected from any one of saliva, whole blood, plasma, serum, bronchoalveolar lavage fluid, tongue swab, pharyngeal swab, and nasal swab.

[0026] Specifically, in step S1, the volume ratio of the test sample to the lysis buffer is 1:(1-3); preferably, the volume ratio of the test sample to the lysis buffer is 1:1.

[0027] According to some embodiments of the present invention, after adding the lysis buffer in step S1, the mixture is incubated at 65°C for 30 minutes.

[0028] Specifically, in step S1, the amount of chloroform and isoamyl alcohol mixed reagent added is one times the total volume of the test sample and lysis buffer.

[0029] Specifically, the centrifugation conditions in step S1 are 10,000-15,000 xg for 10-15 minutes; preferably, the centrifugation conditions are 12,000 xg for 10 minutes.

[0030] Specifically, in step S1, 0.5-1 times the volume of isopropanol is added; preferably, in step S1, 0.7 times the volume of isopropanol is added.

[0031] Specifically, in step S1, the centrifugation conditions after adding isopropanol are 10,000-15,000 x g for 10-15 minutes; preferably, the centrifugation conditions after adding isopropanol are 12,000 x g for 15 minutes.

[0032] Specifically, the sequences of the amplification primers used in the RPA amplification reaction in step S2 are shown in SEQ ID NO:1-2.

[0033] Specifically, the RPA amplification reaction system in step S2 includes 10x Reaction buffer, Basic E-mix, RPA forward primer, RPA reverse primer, dNTP Mix, H2O, template DNA, and MgOAc.

[0034] According to some embodiments of the present invention, the RPA amplification reaction system in step S2 includes 2µL 10x Reaction buffer, 1µL Basic E-mix, 0.8µL RPA forward primer, 0.8µL RPA reverse primer, 1µL dNTP Mix, 11.4µL H2O, 2µL template DNA and 1µL MgOAc.

[0035] Specifically, the amplification reaction in step S2 is carried out in a constant temperature reactor at 35-38℃ for 10-30 minutes. Preferably, the amplification reaction is carried out in a constant temperature reactor at 37℃ for 20 minutes.

[0036] Specifically, the CRISPR reaction system described in step S3 includes Cas12a protein, crRNA, probe, and PRA amplification product.

[0037] Specifically, the sequence of the crRNA is shown in SEQ ID NO:3.

[0038] According to some embodiments of the present invention, the CRISPR reaction system in step S3 includes 10x NEBuffer™ 2.1, EnGen Lba Cas12a, crRNA, ssDNA-FQ reporter probe, water, and RPA amplification product.

[0039] Further, the CRISPR reaction system in step S3 includes 2.5 µL 10x NEBuffer™ 2.1, 0.15 µL LEnGen Lba Cas12a, 0.15 µL crRNA, 0.5 µL ssDNA-FQ reporter probe, 19.7 µL water and 2 µL RPA amplification product.

[0040] On the other hand, the present invention provides the application of the above-mentioned mycoplasma detection kit in the preparation of products for detecting mycoplasma.

[0041] The beneficial effects of this invention are as follows: The present invention provides a lysis buffer composed of Tris-HCl, guanidinoacetic acid, guanidine hydrochloride, potassium lauroyl sarcosinate, KCl, CHAPS, EDTA, EGTA and tris(2-carboxyethyl)phosphonic acid hydrochloride. The present invention also provides a kit containing the above-mentioned lysis buffer, which has high sensitivity and specificity in detecting mycoplasma. Attached Figure Description

[0042] Figure 1 The graph shows the sensitivity detection results of Examples 1-5 in Experiment 1.

[0043] Figure 2 The graph shows the sensitivity detection results of comparative examples 1-6 in Experiment 1.

[0044] Figure 3 The image shows the specific detection results in Experiment Example 2. Detailed Implementation

[0045] The present invention will be further described in detail below with reference to specific embodiments. The following embodiments are not intended to limit the present invention, but only to illustrate the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are generally performed under conventional conditions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0046] Example 1 1. Extraction of the genome from the sample to be tested Take the sample to be tested and add the lysis buffer (the lysis buffer consists of 100 mM Tris-HCl, 1.0 M guanidinoacetic acid, 2 M guanidine hydrochloride, 0.15% (w / v) potassium lauroyl sarcosinate, 60 mM KCl, 0.4% (w / v) CHAPS, 15 mM EDTA, 3 mM EGTA and 18 mM tris(2-carboxyethyl)phosphonic acid hydrochloride).

[0047] Genomic DNA was extracted from the sample using a DNA extraction kit. (1) Add 200 µL of lysis buffer to 200 µL of sample, vortex vigorously, and incubate at 65°C for 30 minutes.

[0048] (2) Add 400 µL of chloroform:isoamyl alcohol (24:1), mix vigorously, and centrifuge at 12,000 xg for 10 minutes.

[0049] (3) Carefully aspirate the upper aqueous phase into a new tube, add 0.7 times the volume of isopropanol and mix well. Centrifuge at 12,000 xg at 4°C for 15 minutes.

[0050] (4) Wash the precipitate twice with 70% ethanol, air dry it, and then dissolve it with 20-50 µL of TE buffer or sterile water.

[0051] 2. RPA amplification reaction (1) The reaction system is shown in Table 1: Table 1 Reaction System

[0052] NTP mix contains 10 mM each of ATP, CTP, GTP, and UTP, pH 7.0.

[0053] The sequence of the RPA forward primer is shown in SEQ ID NO:1, and the sequence of the reverse primer is shown in SEQ ID NO:2.

[0054] SEQ ID NO: 1: TCAGCTAGTTGGTGGGGTAACGGCCTACCAAG; SEQ ID NO:2: GACCTTCATCGTTCACGCGGCATTGCTCCATC.

[0055] (2) Amplification reaction The reaction system was gently mixed, briefly centrifuged, and then placed in a 37°C constant temperature reactor for 20 minutes.

[0056] 3. CRISPR reaction (1) The reaction system is shown in Table 2: Table 2 Reaction System

[0057] The sequence of crRNA is shown in SEQ ID NO:3; SEQ ID NO:3: ACGGCCCATACTCCTACGGG.

[0058] ssDNA-FQ reporter probe: 6-FAM-TTATT-BHQ1.

[0059] (2) Reaction conditions After mixing the reaction system, place it in a 37℃ real-time PCR instrument for 15 min and monitor the fluorescence signal in real time.

[0060] Example 2 1. Extraction of the genome from the sample to be tested Take the sample to be tested and add the lysis buffer (the lysis buffer consists of 70 mM Tris-HCl, 0.8 M guanidinoacetic acid, 1.5 M guanidine hydrochloride, 0.08% (w / v) potassium lauroyl sarcosinate, 40 mM KCl, 0.2% (w / v) CHAPS, 8 mM EDTA, 2 mM EGTA and 8 mM tris(2-carboxyethyl)phosphonic acid hydrochloride).

[0061] Genomic DNA was extracted from the sample using a DNA extraction kit. (1) Add 200 µL of lysis buffer to 200 µL of sample, vortex vigorously, and incubate at 65°C for 30 minutes.

[0062] (2) Add 400 µL of chloroform:isoamyl alcohol (24:1), mix vigorously, and centrifuge at 12,000 xg for 10-15 minutes.

[0063] (3) Carefully aspirate the upper aqueous phase into a new tube, add 0.7 times the volume of isopropanol and mix well. Centrifuge at 12,000 xg at 4°C for 15 minutes.

[0064] (4) Wash the precipitate twice with 70% ethanol, air dry it, and then dissolve it with 20-50 µL of TE buffer or sterile water.

[0065] 2. RPA amplification reaction Same as Example 1.

[0066] 3. CRISPR reaction Same as Example 1.

[0067] Example 3 1. Extraction of the genome from the sample to be tested Take the sample to be tested and add the lysis buffer (the lysis buffer consists of 80 mM Tris-HCl, 1.0 M guanidinoacetic acid, 1.5 M guanidine hydrochloride, 0.08% (w / v) potassium lauroyl sarcosinate, 50 mM KCl, 0.2% (w / v) CHAPS, 8 mM EDTA, 2 mM EGTA and 15 mM tris(2-carboxyethyl)phosphonic acid hydrochloride).

[0068] Genomic DNA was extracted from the sample using a DNA extraction kit. (1) Add 200 µL of lysis buffer to 200 µL of sample, vortex vigorously, and incubate at 65°C for 30 minutes.

[0069] (2) Add 400 µL of chloroform:isoamyl alcohol (24:1), mix vigorously, and centrifuge at 12,000 xg for 10-15 minutes.

[0070] (3) Carefully aspirate the upper aqueous phase into a new tube, add 0.7 times the volume of isopropanol and mix well. Centrifuge at 12,000 xg at 4°C for 15 minutes.

[0071] (4) Wash the precipitate twice with 70% ethanol, air dry it, and then dissolve it with 20-50 µL of TE buffer or sterile water.

[0072] 2. RPA amplification reaction Same as Example 1.

[0073] 3. CRISPR reaction Same as Example 1.

[0074] Example 4 1. Extraction of the genome from the sample to be tested Take the sample to be tested and add the lysis buffer (the lysis buffer consists of 110 mM Tris-HCl, 1.5 M guanidinoacetic acid, 3 M guanidine hydrochloride, 0.15% (w / v) potassium lauroyl sarcosinate, 70 mM KCl, 0.5% (w / v) CHAPS, 15 mM EDTA, 4 mM EGTA and 20 mM tris(2-carboxyethyl)phosphonic acid hydrochloride).

[0075] Genomic DNA was extracted from the sample using a DNA extraction kit. (1) Add 200 µL of lysis buffer to 200 µL of sample, vortex vigorously, and incubate at 65°C for 30 minutes.

[0076] (2) Add 400 µL of chloroform:isoamyl alcohol (24:1), mix vigorously, and centrifuge at 12,000 xg for 10-15 minutes.

[0077] (3) Carefully aspirate the upper aqueous phase into a new tube, add 0.7 times the volume of isopropanol and mix well. Centrifuge at 12,000 xg at 4°C for 15 minutes.

[0078] (4) Wash the precipitate twice with 70% ethanol, air dry it, and then dissolve it with 20-50 µL of TE buffer or sterile water.

[0079] 2. RPA amplification reaction Same as Example 1.

[0080] 3. CRISPR reaction Same as Example 1.

[0081] Example 5 1. Extraction of the genome from the sample to be tested Take the sample to be tested and add the lysis buffer (the lysis buffer consists of 120 mM Tris-HCl, 2 M guanidinoacetic acid, 4 M guanidine hydrochloride, 0.2% (w / v) potassium lauroyl sarcosinate, 80 mM KCl, 0.6% (w / v) CHAPS, 20 mM EDTA, 5 mM EGTA and 20 mM tris(2-carboxyethyl)phosphonic acid hydrochloride).

[0082] Genomic DNA was extracted from the sample using a DNA extraction kit. (1) Add 200 µL of lysis buffer to 200 µL of sample, vortex vigorously, and incubate at 65°C for 30 minutes.

[0083] (2) Add 400 µL of chloroform:isoamyl alcohol (24:1), mix vigorously, and centrifuge at 12,000 xg for 10-15 minutes.

[0084] (3) Carefully aspirate the upper aqueous phase into a new tube, add 0.7 times the volume of isopropanol and mix well. Centrifuge at 12,000 xg at 4°C for 15 minutes.

[0085] (4) Wash the precipitate twice with 70% ethanol, air dry it, and then dissolve it with 20-50 µL of TE buffer or sterile water.

[0086] 2. RPA amplification reaction Same as Example 1.

[0087] 3. CRISPR reaction Same as Example 1.

[0088] Comparative Example 1 The only difference from Example 1 is that the lysis buffer consists of 100 mM Tris-HCl, 3 M guanidine hydrochloride, 0.15% (w / v) potassium lauroyl sarcosinate, 60 mM KCl, 0.4% (w / v) CHAPS, 15 mM EDTA, 3 mM EGTA and 18 mM tris(2-carboxyethyl)phosphonic acid hydrochloride, and all other components are the same.

[0089] Comparative Example 2 The only difference from Example 1 is that the lysis buffer consists of 100 mM Tris-HCl, 1.0 M guanidinoacetic acid, 2 M guanidine hydrochloride, 0.15% (w / v) potassium lauroyl sarcosinate, 60 mM KCl, 0.4% (w / v) CHAPS, 15 mM EDTA, 3 mM EGTA and 18 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

[0090] Comparative Example 3 The only difference from Example 1 is that the lysis buffer consists of 100 mM Tris-HCl, 1.0 M guanidinoacetic acid, 2 M guanidine hydrochloride, 0.15% (w / v) SDS, 60 mM KCl, 0.4% (w / v) CHAPS, 15 mM EDTA, 3 mM EGTA and 18 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

[0091] Comparative Example 4 The only difference from Example 1 is that the lysis buffer consists of 100 mM Tris-HCl, 1.0 M guanidinoacetic acid, 2 M guanidine hydrochloride, 0.15% (w / v) potassium lauroyl sarcosinate, 60 mM KCl, 0.4% (w / v) CHAPS, 15 mM EDTA, 3 mM EGTA and 18 mM dithiothreitol.

[0092] Comparative Example 5 The only difference from Example 1 is that the lysis buffer consists of 100 mM Tris-HCl, 1.0 M guanidinoacetic acid, 2 M guanidine hydrochloride, 0.15% (w / v) potassium lauroyl sarcosinate, 60 mM KCl, 0.4% (w / v) CHAPS, 18 mM EDTA and 18 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

[0093] Comparative Example 6 The only difference from Example 1 is that the lysis buffer consists of 150 mM Tris-HCl, 3.0 M guanidinoacetic acid, 5 M guanidine hydrochloride, 0.3% (w / v) potassium lauroyl sarcosinate, 30 mM KCl, 0.1% (w / v) CHAPS, 25 mM EDTA, 8 mM EGTA and 25 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

[0094] Experiment Example 1: Sensitivity Detection Standard: The Mycoplasma pneumoniae P1 gene was cloned into the pUC57 vector, and lysis buffer was added to extract the genome of the sample to be tested (the lysis buffers were those used in Examples 1-5 and Comparative Examples 1-6, respectively). The concentration of the standard was 1×10⁻⁶. 6 copies / μL.

[0095] Experimental methods: 1. Perform gradient dilution of the standard: dilute to a concentration of 1×10⁻⁶. 6 The standard was diluted with nuclease-free water to obtain a concentration of 1×10⁻⁶ copies / μL. 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1×10 0 Gradient samples were prepared in copies / μL, with three replicates for each concentration. Water was used as the negative control.

[0096] 2. RPA amplification reaction (1) The reaction system is shown in Table 3: Table 3 Reaction System

[0097] NTP mix contains 10 mM each of ATP, CTP, GTP, and UTP, pH 7.0.

[0098] The sequence of the RPA forward primer is shown in SEQ ID NO:1, and the sequence of the reverse primer is shown in SEQ ID NO:2.

[0099] SEQ ID NO: 1: TCAGCTAGTTGGTGGGGTAACGGCCTACCAAG; SEQ ID NO:2: GACCTTCATCGTTCACGCGGCATTGCTCCATC.

[0100] (2) Amplification reaction The reaction system was gently mixed, briefly centrifuged, and then placed in a 37°C constant temperature reactor for 20 minutes.

[0101] 3. CRISPR reaction (1) The reaction system is shown in Table 4: Table 4 Reaction System

[0102] The sequence of crRNA is shown in SEQ ID NO:3; SEQ ID NO:3: ACGGCCCATACTCCTACGGG.

[0103] ssDNA-FQ reporter probe: 6-FAM-TTATT-BHQ1.

[0104] (2) Reaction conditions After mixing the reaction system, place it in a 37℃ real-time PCR instrument for 15 min and monitor the fluorescence signal in real time.

[0105] Test results as follows Figures 1-2 As shown in the figure, the detection sensitivity of Examples 1-5 can reach 1×10⁻⁶. 0 copies / μL.

[0106] Experimental Example 2: Specificity Detection After culturing positive controls of Mycoplasma pneumoniae, influenza A virus, influenza B virus, respiratory syncytial virus, and parainfluenza virus, DNA templates were obtained using the lysis buffer from Example 1, followed by RPA reaction.

[0107] 2. RPA amplification reaction (1) The reaction system is shown in Table 5: Table 5 Reaction System

[0108] NTP mix contains 10 mM each of ATP, CTP, GTP, and UTP, pH 7.0.

[0109] The sequence of the RPA forward primer is shown in SEQ ID NO:1, and the sequence of the reverse primer is shown in SEQ ID NO:2.

[0110] SEQ ID NO: 1: TCAGCTAGTTGGTGGGGTAACGGCCTACCAAG; SEQ ID NO:2: GACCTTCATCGTTCACGCGGCATTGCTCCATC.

[0111] (2) Amplification reaction The reaction system was gently mixed, briefly centrifuged, and then placed in a 37°C constant temperature reactor for 20 minutes.

[0112] 3. CRISPR reaction (1) The reaction system is shown in Table 6: Table 6 Reaction System

[0113] The sequence of crRNA is shown in SEQ ID NO:3; SEQ ID NO:3: ACGGCCCATACTCCTACGGG.

[0114] ssDNA-FQ reporter probe: 6-FAM-TTATT-BHQ1.

[0115] (2) Reaction conditions After mixing the reaction system, place it in a 37℃ real-time PCR instrument for 15 min and monitor the fluorescence signal in real time.

[0116] The results are as follows Figure 3 As shown, from Figure 3 As can be seen, only the Mycoplasma pneumoniae test was positive, while all other test results were negative, indicating that the detection method of the present invention has good specificity.

[0117] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A lysis buffer, characterized in that, The lysis buffer consists of 70-120 mM Tris-HCl, 0.8-2.0 M guanidinoacetic acid, 1.5-4 M guanidine hydrochloride, 0.08-0.2% (w / v) potassium lauroyl sarcosinate, 40-80 mM KCl, 0.2-0.6% (w / v) CHAPS, 8-20 mM EDTA, 2-5 mM EGTA and 8-20 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

2. The pyrolysis solution according to claim 1, characterized in that, The lysis buffer consists of 80-110 mM Tris-HCl, 1.0-1.5 M guanidinoacetic acid, 1.5-3 M guanidine hydrochloride, 0.08-0.15% (w / v) potassium lauroyl sarcosinate, 50-70 mM KCl, 0.2-0.5% (w / v) CHAPS, 8-15 mM EDTA, 2-4 mM EGTA and 15-20 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

3. The pyrolysis solution according to claim 2, characterized in that, The lysis buffer consisted of 100 mM Tris-HCl, 1.0 M guanidinoacetic acid, 2 M guanidine hydrochloride, 0.15% (w / v) potassium lauroyl sarcosinate, 60 mM KCl, 0.4% (w / v) CHAPS, 15 mM EDTA, 3 mM EGTA and 18 mM tris(2-carboxyethyl)phosphonic acid hydrochloride.

4. A sample pretreatment method for mycoplasma detection, characterized in that, The procedure includes: lysing the sample to be tested using the lysis buffer described in any one of claims 1-3.

5. A mycoplasma detection kit, characterized in that, The kit includes the lysis buffer as described in any one of claims 1-3.

6. The mycoplasma detection kit according to claim 5, characterized in that, The steps involved in using a kit to detect mycoplasma are as follows: S1. The sample to be tested is lysed using lysis buffer. Chloroform and isoamyl alcohol are added, mixed, and centrifuged. The upper aqueous phase is taken, isopropanol is added, mixed, and centrifuged. S2, Perform RPA amplification reaction; S3. Perform a CRISPR reaction on the amplification product obtained in step S2.

7. The mycoplasma detection kit according to claim 6, characterized in that, The sample to be tested in step S1 is selected from any one of saliva, whole blood, plasma, serum, bronchoalveolar lavage fluid, tongue swab, pharyngeal swab, and nasal swab.

8. The mycoplasma detection kit according to claim 6, characterized in that, The sequences of the amplification primers used in step S2 for the RPA amplification reaction are shown in SEQ ID NO:1-2.

9. The mycoplasma detection kit according to claim 6, characterized in that, The CRISPR reaction system described in step S3 includes Cas12a protein, crRNA, probe, and PRA amplification product; the sequence of the crRNA is shown in SEQ ID NO:

3.

10. The use of the mycoplasma detection kit according to any one of claims 5-9 in the preparation of products for detecting mycoplasma.

Citation Information

Patent Citations

  • Kit for nucleic acid extraction with magnetic bead method, magnetic bead and preparation method of magnetic bead

    CN112980830A

  • Mycoplasma pneumoniae visual detection method based on RPA-CRISPR / Cas12a system

    CN118006737A

  • Universal sample nucleic acid release liquid, nucleic acid extraction kit and extraction method

    CN118406740A

  • Lysate, kit and method for extracting microbial nucleic acid

    CN119709727A

  • Kit for rapidly detecting mycoplasma synoviae based on ERA-CRISPR / Cas12a one-step method, application and method

    CN119710048A