Primer, probe, method and kit for detecting methylation of MGMT gene CpG island

Abstract

The invention discloses a primer, a probe, a method and a kit for detecting CG methylation of a CpG island of an MGMT gene. The primer comprises a specific primer for amplifying DNA fragments of five CG sites on the CpG island of the MGMT gene from sample nucleic acid and a fluorescent probe for presenting the obtained nucleic acid fragments. According to the primer, the probe, the method and the kit, the Taqman probe technology is adopted, the methylation frequency of the MGMT gene related to treatment medication can be detected, so that a basis is provided for clinical medication, and the method is good in specificity, high in accuracy and high in flux.

Description

Technical Field

[0001] This invention belongs to the fields of life sciences and biotechnology, and specifically relates to methods, primers and kits for detecting MGMT gene methylation. Using TaqMan technology, it can detect the methylation frequency of the MGMT gene with good specificity, high accuracy and high throughput. Background Technology

[0002] Gliomas are tumors originating from glial cells in the brain. They are the most common primary intracranial tumors, mostly occurring in the embryonic neuroectoderm, and are widespread with complex histological types. Gliomas are classified into grades 1-4, with grades 1 and 2 being low-grade gliomas, grades 3 and 4 being high-grade gliomas, and grade 4 gliomas, namely glioblastoma (GBM), being the most malignant. A small percentage of gliomas can be radically surgically removed with a good prognosis, while most gliomas are difficult to completely remove surgically, affecting patient prognosis and having a high recurrence rate. In my country, the annual incidence of gliomas is 5-8 per 100,000, and the 5-year mortality rate is second only to pancreatic cancer and lung cancer among all cancers. Temozolomide (TMZ) is a chemotherapy drug, an alkylating agent with antitumor activity. Postoperative chemotherapy regimens for adult gliomas mostly use temozolomide as the mainstay, but not every patient's tumor is sensitive to temozolomide.

[0003] O6-methylguanine-DNA methyltransferase (MGMT), located on chromosome 10 (10q26), is a DNA repair enzyme that plays a crucial role in chemoresistant resistance to alkylating agents, leading to better therapeutic outcomes from chemotherapy with beneficial alkylating agents such as TMZ. The mechanism involves TMZ inducing methylation of O6-MG on DNA, transferring the O6-MG adduct to the cysteine ​​residue of MGMT, preventing DNA cross-linking and breakage, and allowing DNA repair. This results in tumor resistance to alkylating agents, while the MGMT itself is irreversibly inactivated. Therefore, the MGMT gene is both an anti-cancer gene and a drug resistance gene. CpG islands are mainly located in the promoter and first exon regions of structural genes. DNA methylation is the process by which DNA methyltransferases transfer methyl groups to the 5' carbon position of cytosine in the DNA CpG sequence, forming 5-methylcytosine. In normal tissues, CpG sites are generally in an unmethylated state. Methylation of the CpG sites in MGMT alters chromatin structure, preventing transcription factor binding, leading to gene silencing and reduced protein expression. In other words, CpG island methylation in the MGMT gene promoter region is a crucial mechanism for reduced MGMT protein expression. Therefore, higher levels of MGMT promoter methylation result in greater sensitivity to chemotherapy. Consequently, the methylation status of the MGMT gene promoter is considered a prognostic biomarker for glioma patients.

[0004] In practical applications, the main method for detecting MGMT methylation is pyrosequencing. Pyrosequencing is an enzyme cascade chemiluminescent reaction catalyzed by four enzymes in the same reaction system. Pyrosequencing can quickly detect the frequency of methylation and perform qualitative and quantitative detection of methylation sites in samples, but the experiment is complex and time-consuming.

[0005] Therefore, this application develops a method for detecting MGMT methylation, which uses real-time fluorescence PCR technology combined with the Taqman probe method to detect MGMT methylation. This method is time-saving, simple to operate, and has high sensitivity and specificity.

[0006] To address the shortcomings of existing technologies, this invention utilizes specific primers and probes to amplify the CpG island DNA fragment of the MGMT gene using qPCR, and uses the fluorescence signal of the probe to determine the methylation status, making the detection results more specific.

[0007] Based on this technology, the present invention provides primers and probes for detecting CpG island methylation in the MGMT gene, including: The primer pair has the following base sequence: MGMT-F : GYGTTTYGGATATGTTGG MGMT-R:ACCCAAACACTCACCAAATC; Fluorescent probes are used to present the obtained nucleic acid amplification products, and their base sequences are as follows: MGMT-P: FAM-AACGATACGCACCGCGAAAACCTACG-BHQ1.

[0008] Furthermore, the primers are designed using sulfurized DNA as a template.

[0009] Furthermore, the upstream primer carrying two degenerate bases is indicated by the letter "Y", which means that either "C" or "T" bases in the template can be amplified. Furthermore, MGMT-F contains a degenerate base "Y" representing "C" and "T".

[0010] Furthermore, the fluorescent probe is labeled with the luminescent group FAM at its 5' end and the quencher group BHQ1 at its 3' end.

[0011] A method for detecting CpG island methylation in the MGMT gene includes: (1) Extract DNA from the sample; (2) The purified DNA was treated with bisulfite; (3) Using the sulfurized DNA from step (2) as a template, qPCR amplification was performed using MGMT primers and probes; The base sequences of the primers and probes for MGMT are as follows: MGMT-F : GYGTTTYGGATATGTTGG MGMT-R: ACCCAAACACTCACCAAATC MGMT-P: FAM-AACGATACGCACCGCGAAAACCTACG-BHQ1; (4) Determine the methylation status of MGMT based on the fluorescence signal intensity.

[0012] Furthermore, the reaction conditions for the qPCR amplification are 95°C for 2 minutes; 95°C for 10 seconds, 60°C for 30 seconds, for 40 cycles.

[0013] This invention provides a kit for detecting CpG island methylation in the MGMT gene, comprising nucleic acid extraction reagents, bisulfite treatment reagents, and a qPCR amplification system. The qPCR amplification system includes primers and probes, the sequences of which are as follows: MGMT-F : GYGTTTYGGATATGTTGG MGMT-R: ACCCAAACACTCACCAAATC MGMT-P: FAM-AACGATACGCACCGCGAAAACCTACG-BHQ1.

[0014] Furthermore, the nucleic acid extraction reagent includes a fresh brain tissue extraction reagent or a paraffin section extraction reagent.

[0015] Furthermore, the bisulfite treatment reagent comprises 10 mM hydroquinone solution and 3.6 mol / L NaHSO3.

[0016] Furthermore, the qPCR system also includes 2xT5 qPCR Mix, 50xROX, and pure water.

[0017] This invention applies quantitative real-time PCR (qPCR) technology to the detection of CpG island methylation in the MGMT gene, and designs amplification primers and probes containing the five CG sites of MGMT methylation. This technology provides precise guidance for the treatment of glioma, exhibiting high specificity, accuracy, and throughput, making it highly suitable for clinical applications.

[0018] The innovations of this patent are as follows: 1. Specific primer and probe design: Specific primers and TaqMan probes targeting five key CG sites in the CpG island of the MGMT gene were designed. The upstream primer incorporates a degenerate base "Y" (representing C / T) to adapt to the bisulfite-treated DNA template, ensuring that both methylated and unmethylated sequences can be effectively amplified. 2. Simultaneous detection of multiple sites: A single probe can simultaneously detect the methylation status of five CG sites, eliminating the need for designing multiple probes or performing multiple reactions, thus improving detection efficiency and consistency. 3. QPCR-based methylation detection method: Combining bisulfite treatment with quantitative real-time PCR (QPCR), the methylation level is directly determined by the fluorescence signal intensity, eliminating the need for subsequent sequencing or electrophoresis steps, simplifying the process. 4. Primer design strategy adapted to complex templates: The primer design is based on the bisulfite-converted DNA template, effectively distinguishing between methylated and unmethylated cytosine, improving detection specificity. 5. Kit-based and standardized operation: We provide complete kits, including nucleic acid extraction, bisulfite conversion, and qPCR amplification systems, supporting direct methylation detection from clinical samples such as paraffin sections.

[0019] The advantages of this invention are: 1. High sensitivity and specificity: The probe is designed for 5 CG sites, accurately detecting low-abundance methylation signals and reducing false positives and false negatives. 2. Rapid and efficient: The entire detection process can be completed in about 1 hour, much faster than traditional methods such as pyrosequencing, making it suitable for rapid clinical testing. 3. Simple operation: No need for subsequent steps such as gel electrophoresis and sequencing, reducing operational steps and instrument dependence, and lowering the technical threshold. 4. Applicable to clinical samples: The kit supports various sample types such as paraffin sections and fresh tissues, especially suitable for common clinical FFPE samples. 5. Reliable results: Examples show 100% consistency with pyrosequencing results, verifying the accuracy and reliability of the method. 6. High-throughput potential: Based on the qPCR platform, it is suitable for batch sample testing, meeting the needs of large-scale clinical screening. (See attached figures.) Figure 1 It contains the sequence map and primers of CpG islands in DNA after sulfite treatment, the location of the probe, and the five CG sites that the probe can detect; Figure 2 This is a demonstration of the qPCR fluorescence signals from one negative and two positive samples after testing six clinical samples. Detailed Implementation

[0020] The invention will be further illustrated below with reference to specific embodiments. It should be noted that conventional conditions and methods not described in the embodiments are generally in accordance with the methods commonly used by laboratory personnel in the relevant field: for example, the fourth edition of "A Concise Guide to Laboratory Medicine in Molecular Biology" edited by Osber and Kingston, or the steps and conditions recommended by the manufacturer.

[0021] Example 1: Primers, probes, and kits for detecting methylation of 5 CG sites on the CpG island of the MGMT gene Primers and probes for detecting methylation at five CG sites on the CpG island of the MGMT gene include specific primers for amplifying the MGMT gene fragment from sample nucleic acids and probes for fluorescent quantitative analysis of the obtained nucleic acid fragments. The specific primers for amplifying the DNA fragment of the CpG island of the MGMT gene from the nucleic acid sample have the following base sequences: MGMT-F : GYGTTTYGGATATGTTGG MGMT-R: ACCCAAACACTCACCAAATC, MGMT-F contains degenerate bases "Y" representing "C" and "T". When the upstream primer carries two degenerate bases, the letters "Y" indicate that either "C" or "T" bases in the template can be amplified.

[0022] The probe for fluorescence quantitative analysis of the obtained nucleic acid amplification fragment has the following probe base sequence: MGMT-P: FAM-AACGATACGCACCGCGAAAACCTACG-BHQ1.

[0023] Using qPCR technology, specific amplification primers MGMT-F and MGMT-R, along with fluorescent probes, can detect the methylation status of five CG sites on CpG islands associated with tumor disease.

[0024] A kit for detecting methylation at five sites on the CpG islands of the MGMT gene includes nucleic acid extraction reagents, bisulfite treatment reagents, and a qPCR amplification system. The qPCR amplification system includes specific primers for amplifying the DNA fragment of the CpG islands of the MGMT gene, with the following base sequence: MGMT-F : GYGTTTYGGATATGTTGG MGMT-R: ACCCAAACACTCACCAAATC, The base sequence of the probe for quantitative fluorescence is as follows: MGMT-P: FAM-AACGATACGCACCGCGAAAACCTACG-BHQ1 MGMT-F contains degenerate bases "Y" representing "C" and "T".

[0025] The fluorescent probe is labeled with the luminescent group FAM at its 5' end and the quencher group BHQ1 at its 3' end.

[0026] The qPCR amplification system also includes 2xT5 qPCR Mix, 50xROX and pure water. Nucleic acid extraction reagents include reagents for extracting fresh brain tissue or reagents for extracting paraffin sections.

[0027] The bisulfite treatment reagents include 10 mM hydroquinone solution and 3.6 mol / L NaHSO3.

[0028] Example 2: DNA Extraction DNA extraction reagents: paraffin sections, QIAGEN DNA FFPE Kit.

[0029] Procedure: Place the paraffin section sample in a 1.5ml centrifuge tube (scrape the sample); add 1ml of tissue clearing solution, vortex to mix, and centrifuge at 13000rpm for 1min; remove the supernatant, add 500ml of tissue clearing solution, vortex to mix, and centrifuge at 13000rpm for 1min; remove the supernatant, add 1ml of anhydrous ethanol, vortex to mix, and centrifuge at 13000rpm for 1min; remove the supernatant and place in a 37°C metal bath for 10min (without the cap) until the liquid is dry; then, refer to the QIAGEN DNA FFPE Kit paraffin section DNA extraction kit instructions to extract the sample DNA. Specific steps are as follows: Add 20uL Proteinase K and incubate at 56℃ for 10 minutes, inverting and mixing several times during the process until the solution becomes clear (if the solution does not become completely clear, please extend the lysis time until the solution becomes clear).

[0030] Add 200 μL of anhydrous ethanol, vortex for 15 seconds, and mix thoroughly by inverting.

[0031] Add the solution and flocculent precipitate obtained in the previous step to an adsorption column (place the adsorption column in the collection tube), centrifuge at 8,000 rpm for 1 minute, discard the waste liquid, and put the adsorption column back into the collection tube.

[0032] Add 500 μl of buffer A1 to the adsorption column, centrifuge at 8,000 rpm for 1 minute, discard the waste liquid, and place the adsorption column into a collection tube.

[0033] Add 500 μl of buffer A2 to the adsorption column, centrifuge at 14,000 rpm for 3 minutes, discard the waste liquid, and place the adsorption column into a collection tube.

[0034] Return the adsorption column to the collection tube, centrifuge at 14,000 rpm for 1 minute, and discard the waste liquid.

[0035] Transfer the adsorption column to a clean centrifuge tube, add 50 μl of elution buffer dropwise to the center of the adsorption membrane, incubate at room temperature for 3 minutes, centrifuge at 8,000 rpm for 1 minute, and collect the solution in the centrifuge tube. Determine the DNA concentration and purity, and store at -20°C for later use.

[0036] Example 3: DNA Sodium Bisulfite Treatment After DNA is treated with sodium sulfite, unmethylated cytosine in the CpG dinucleotide pair is converted to thymine (C→T), while methylated 5'-methylcytosine is unaffected by sodium sulfite treatment and remains 5'-methylcytosine.

[0037] Operating steps: Dilute the genomic DNA extracted in Example 2 with double-distilled water to 50ul in a 1.5ml EP tube, add 5.5ul of freshly prepared 3M NaOH solution, and incubate in a water bath at 42℃ for 30min; during the water bath, prepare the following solutions: (1) 10mM hydroquinone solution: dissolve 55mg of hydroquinone in 50ml of water; (2) 3.6mol / L NaHSO3: add 18.8g of NaHSO3 to 40ml of water, adjust the pH of the solution to 5.0 with 3M NaOH solution, and finally bring the volume to 50ml.

[0038] Add 30 μL of 10 mM hydroquinone solution and 520 μL of 3.6 mol / L NaHSO3 to the above solution after water bath. Wrap the EP tube with aluminum foil to protect it from light. Gently invert to mix the solution. Add 100 μL of paraffin oil to the tube and briefly centrifuge to cover the liquid surface with paraffin oil to prevent water evaporation during water bath and limit oxidation. Incubate at 50°C in the dark for 16 hours. After water bath, insert the pipette tip under the paraffin oil layer and gently press to expel a small section of paraffin oil. Then carefully aspirate approximately 580 μL of DNA solution into a clean 1.5 mL EP tube. Recover the DNA using a PCR product recovery kit. Dissolve the obtained DNA in 50 μL of deionized water, add 5.5 μL of freshly prepared 3 M NaOH, and incubate at room temperature for 15 min. Then add 33 μL of 10 M ammonium acetate to neutralize the NaOH, bringing the solution to pH 7. Also add 4 μL of... 10 mg / ml glucose was used as a precipitation position indicator. 270 μL of ice-cold anhydrous ethanol was added, and the mixture was incubated at -20°C overnight. After precipitation, the mixture was centrifuged at 12,000 rpm for 30 min at 4°C. The supernatant was discarded, and the precipitate was collected. 500 μL of 70% ethanol was added to wash the precipitate, and the mixture was centrifuged twice at 12,000 rpm for 5 min at 4°C. The supernatant was discarded, and the precipitate was dried at room temperature until it changed from opaque to translucent or clear. Depending on the amount of DNA precipitate, 30-50 μL of double-distilled water was added to dissolve the precipitate. The treated DNA was obtained. The DNA sequence after CpG island treatment for the SFRP2 gene is shown below. Figure 1 As shown.

[0039] In a standard template, the base C can be categorized into two types: methylated C (mC) and unmethylated C. After sulfidation, mC remains unchanged while C is present, but all unmethylated C is converted to T. Experiments have shown that, compared to conventional methods, the DNA sodium bisulfite treatment reagent and method described in this invention can achieve higher DNA recovery and conversion rates, while maintaining very low DNA degradation and fragmentation rates, thereby improving the sensitivity of PCR amplification and subsequent analytical techniques.

[0040] Example 4: qPCR amplification The DNA extracted in Example 3 was amplified using a qPCR amplification system to obtain fluorescence signals.

[0041] The qPCR system used for amplification to detect methylation of the five CG sites on the CpG island of the MGMT gene consisted of 10 μl of 2xT5 qPCR Mix, 0.4 μl of 50xROX, and 6.4 μl of pure water, 0.4 μl of upstream primer MGMT-F, 0.4 μl of downstream primer MGMT-R, 0.4 μl of probe, and 2 μl of template DNA added to 18 μl of amplification system, for a total volume of 20 μl.

[0042] The standard qPCR reaction conditions are 95℃ for 2 minutes; 95℃ for 10 seconds, 60℃ for 30 seconds, for 40 cycles.

[0043] Example 5: Clinical Sample Testing Six paraffin-embedded tissue samples of gliomas were collected for testing. DNA was extracted according to the method described in Example 2, and the DNA was processed according to Example 3. The processed DNA was then amplified by qPCR, and fluorescence signals were obtained.

[0044] For each sample, positive, negative, and blank controls were performed simultaneously over a period of 60 minutes.

[0045] The experimental results were compared with those of pyrosequencing to determine the accuracy of sample detection. The results are shown in Table 1 below: Table 1:

[0046] Table 1 compares the results of the qPCR method and the pyrosequencing method. As can be seen from the table, the qPCR method and the pyrosequencing results are 100% consistent. Moreover, the qPCR method is simple to operate and produces results in 1 hour, which meets the clinical testing requirements. Pyrosequencing, on the other hand, is cumbersome and costly, and is not suitable for high-throughput rapid testing.

[0047] Example 6: Clinical detection of MGMT methylation and its guidance on medication In glioma patients, those with high MGMT expression are insensitive to alkylating agents such as temocalcium methylamine. MGMT methylation is closely related to MGMT expression: MGMT promoter methylation often occurs on CpG islands, leading to transcriptional arrest and reduced protein expression, thus facilitating the action of alkylating agents. The higher the degree of MGMT methylation, the better the therapeutic effect of alkylating agents.

Claims

1. Primers and probes for detecting CpG island methylation in the MGMT gene, characterized in that, include: The primer pair has the following base sequence: MGMT-F : GYGTTTYGGATATGTTGG MGMT-R:ACCCAAACACTCACCAAATC; Fluorescent probes are used to present the obtained nucleic acid amplification products, and their base sequences are as follows: MGMT-P: FAM-AACGATACGCACCGCGAAAACCTACG-BHQ1.

2. The primers and probes as described in claim 1, characterized in that, The primers were designed using sulfurized DNA as a template.

3. The primers and probes as described in claim 1, characterized in that, MGMT-F contains a degenerate base "Y" representing "C" and "T".

4. The primers and probes as described in claim 1, characterized in that, The fluorescent probe is labeled with the luminescent group FAM at its 5' end and the quencher group BHQ1 at its 3' end.

5. A method for detecting CpG island methylation in the MGMT gene, characterized in that, include: (1) Extract DNA from the sample; (2) The purified DNA was treated with bisulfite; (3) Using the sulfurized DNA from step (2) as a template, qPCR amplification was performed using MGMT primers and probes; The base sequences of the primers and probes for MGMT are as follows: MGMT-F : GYGTTTYGGATATGTTGG MGMT-R: ACCCAAACACTCACCAAATC MGMT-P: FAM-AACGATACGCACCGCGAAAACCTACG-BHQ1; (4) Determine the methylation status of MGMT based on the fluorescence signal intensity.

6. The method as described in claim 5, characterized in that, The reaction conditions for the qPCR amplification were 95℃ for 2 minutes; 95℃ for 10 seconds, 60℃ for 30 seconds, for 40 cycles.

7. A kit for detecting CpG island methylation of the MGMT gene, comprising nucleic acid extraction reagent, bisulfite treatment reagent, and qPCR amplification system, characterized in that, The qPCR amplification system includes primers and probes, the sequences of which are as follows: MGMT-F : GYGTTTYGGATATGTTGG MGMT-R: ACCCAAACACTCACCAAATC MGMT-P: FAM-AACGATACGCACCGCGAAAACCTACG-BHQ1.

8. The kit according to claim 7, characterized in that, The nucleic acid extraction reagent is a paraffin section extraction reagent.

9. The kit according to claim 7, characterized in that, The bisulfite treatment reagent includes 10 mM hydroquinone solution and 3.6 mol / L NaHSO3.

10. The kit according to claim 7, characterized in that, The qPCR system also includes 2xT5 qPCR Mix, 50xROX and pure water.

Images