Method for extracting hypoglycemic active components of origanum vulgare through combination of enzymolysis, ultrasound and salting-out

The hypoglycemic active ingredients in oregano were extracted using a combined enzymatic hydrolysis-ultrasound-salting precipitation method, which solved the problem of side effects of existing drugs and achieved efficient improvement of glucose metabolism and insulin secretion in diabetic mice. High-purity oregano extract was prepared for the treatment of type 2 diabetes.

CN121910779APending Publication Date: 2026-04-24GUANGDONG PHARMA UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGDONG PHARMA UNIV
Filing Date
2026-03-24
Publication Date
2026-04-24

Smart Images

  • Figure CN121910779A_ABST
    Figure CN121910779A_ABST
Patent Text Reader

Abstract

The invention discloses a method for extracting hypoglycemic active components of origanum vulgare through combination of enzymolysis, ultrasonic treatment and salting-out. According to the method, origanum vulgare raw materials are used as substrates, cell walls are destroyed through enzymolysis pretreatment, and the release efficiency of active ingredients is improved; extracting hypoglycemic active substances such as luteolin and the like by utilizing ultrasonic strengthening; primary purification is realized by adopting a salting-out mode; the content of aglycone is increased through acidic hydrolysis, and then multi-stage separation and purification are carried out to obtain high-purity active ingredients; and finally, the stability of the extract is improved by using a beta-cyclodextrin inclusion technology. The method is short in technological process, high in efficiency, capable of obtaining the high-activity extract with the luteolin content larger than or equal to 30%, and suitable for research and development of functional food, health care products and drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention discloses a method for extracting the hypoglycemic active ingredients of oregano using a combination of enzymatic hydrolysis, ultrasound, and salting out, as well as the application of the obtained oregano extract in the preparation of drugs for treating diabetes.

[0002] Materials Research Background

[0003] Diabetes has become a growing health problem worldwide. According to data from the International Diabetes Federation (IDF) in 2025, there are approximately 589 million adults with diabetes globally. This number is projected to reach 853 million by 2050. More than 90% of these cases are type 2 diabetes. The main characteristics of type 2 diabetes are insulin resistance and progressive decline in pancreatic beta cell function, leading to a relative lack of insulin. Current treatments for type 2 diabetes include sulfonylureas, metformin, and glibenclamides. However, these medications may have side effects such as hypoglycemia, gastrointestinal damage, liver and kidney dysfunction, skin and subcutaneous tissue abnormalities, and metabolic and nutritional disorders. Therefore, there is an urgent need for a new type of drug that can treat type 2 diabetes.

[0004] Oregano is a general term for a type of aromatic herb used in traditional medicine to alleviate symptoms such as asthma, diarrhea, menstrual disorders, inflammation, and diabetes. Modern pharmacological research suggests that oregano may serve as a potential anti-diabetic drug through various mechanisms, including inhibiting carbohydrate-metabolizing enzymes and reducing insulin resistance. Luteolin, a natural flavonoid found in various plants, contains oregano and possesses anti-inflammatory, anti-allergic, and uric acid-lowering pharmacological activities. Summary of the Invention

[0005] The purpose of this invention is to provide a new natural drug option for the treatment of diabetes by taking the herb oregano and its active ingredients as the research object and based on a diabetic animal model.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] This invention utilizes a method combining enzymatic hydrolysis, ultrasound, and salting-out to extract the hypoglycemic active ingredients of oregano. A diabetic mouse model was constructed to investigate the hypoglycemic effects of oregano and its extracts on diabetes from two perspectives: improving glucose metabolism and promoting insulin secretion. The efficacy of oregano and its extracts was evaluated by assessing serum total cholesterol and triglycerides in diabetic mice. The effect of oregano and its extracts on improving glucose metabolism in diabetic mice was evaluated by assessing liver weight and organ coefficients, liver glycogen content, and the expression of GYS2 and GBE1 by real-time quantitative PCR. The effect of oregano on promoting insulin secretion was evaluated by detecting HOMA-IR, HOMA-IS, and HOMA-β indices, as well as pancreatic tissue glucose, ROS, and ATP levels in diabetic mice. These results indicate that oregano and its extracts can treat diabetes by improving glucose metabolism and promoting insulin secretion in diabetic mice. A second aspect of this invention provides a method for extracting the hypoglycemic active ingredients of oregano using a combined enzymatic hydrolysis, ultrasound, and salting-out process, comprising the following steps:

[0008] (1) Crush the oregano and mix it with water;

[0009] (2) Add cellulase, pectinase or a combination of these enzymes for enzymatic hydrolysis and cell wall breaking;

[0010] (3) Flavonoid active ingredients were extracted using a combination of ethanol and ultrasound;

[0011] (4) Preliminary purification is achieved by obtaining a precipitate through salting out;

[0012] (5) Acid hydrolysis of the precipitate to increase the content of luteolin aglycone;

[0013] (6) High-purity active components are obtained through multi-stage separation and purification;

[0014] (7) The stability of the extract was improved by using β-cyclodextrin inclusion technology.

[0015] Further in step (1), the enzymatic hydrolysis temperature is 45–55°C, the pH is 4.0–5.5, and the enzymatic hydrolysis time is 1–3 hours.

[0016] Further in step (3), the ultrasonic power is 200–600 W and the ultrasonic time is 20–60 minutes.

[0017] Further in step (4), the salting-out agent is ammonium sulfate or sodium chloride, and the salting-out saturation is 40–80%.

[0018] Further in step (5), the acidic hydrolysis conditions are pH 2–3, temperature 60–80°C, and time 0.5–2 hours.

[0019] Further in step (6), the multi-stage separation and purification uses one or a combination of resin adsorption, solvent elution or membrane separation methods. Attached Figure Description

[0020] Figure 1 This is a comparison chart of serum total cholesterol and triglyceride levels in diabetic mice.

[0021] Figure 2 This is a comparison of liver weight and liver organs in mice under different influences;

[0022] Figure 3 This is a graph showing the glycogen content of mice under different influences;

[0023] Figure 4 This diagram illustrates the effects of different influences on the expression of GYS2 and GBE1 genes, key enzymes in glycogen synthesis, in mice.

[0024] Figure 5 This is a graph showing the calculation of HOMA-IR and HOMA-IS indices in mice under different influences;

[0025] Figure 6 This is a graph showing the calculated HOMA-β index of mice under different influences;

[0026] Figure 7 This is a graph showing the effects of different influences on glucose levels in the pancreas of mice.

[0027] Figure 8 This is a graph showing the effects of different influences on reactive oxygen species (ROS) and ATP in the pancreas of mice. Detailed Implementation

[0028] The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operation processes. However, the scope of protection of the present invention is not limited to the following embodiments.

[0029] In the following embodiments, unless otherwise specified, the raw materials or processing techniques are conventional commercially available raw materials or conventional processing techniques in the art.

[0030] Example 1: A method for extracting the hypoglycemic active ingredient of oregano using a combination of enzymatic hydrolysis-ultrasound-salting precipitation, comprising the following steps:

[0031] (1) Crush the oregano and mix it with water;

[0032] (2) Add cellulase, pectinase or a combination of these enzymes for enzymatic hydrolysis and cell wall breaking;

[0033] (3) Flavonoid active ingredients were extracted using a combination of ethanol and ultrasound;

[0034] (4) Preliminary purification is achieved by obtaining a precipitate through salting out;

[0035] (5) Acid hydrolysis of the precipitate to increase the content of luteolin aglycone;

[0036] (6) High-purity active components are obtained through multi-stage separation and purification;

[0037] (7) The stability of the extract was improved by using β-cyclodextrin inclusion technology.

[0038] In step (1), the enzymatic hydrolysis temperature is 50°C, the pH is 5, and the enzymatic hydrolysis time is 2 hours.

[0039] Further in step (3), the ultrasonic power is 400 W and the ultrasonic time is 30 minutes.

[0040] In step (4), the salting-out agent is ammonium sulfate or sodium chloride, and the salting-out saturation is 50%.

[0041] Further in step (5), the acidic hydrolysis conditions are pH-3, temperature 70°C, and time 1 hour.

[0042] Further in step (6), the multi-stage separation purification uses 11 kDa ultrafiltration and 300 Da nanofiltration, followed by gradient elution with 50% ethanol using macroporous resin, and then purification with polyamide resin.

[0043] Experimental Example

[0044] 1. Establishment of animal models

[0045] Seventy-two 6-week-old male SPF-grade C57BL / 6 mice, weighing 17-19g, were purchased from the Guangdong Provincial Medical Experimental Animal Center (Guangzhou, Guangdong). After one week of acclimatization, the 72 male C57BL / 6 mice were randomly divided into two groups: a control group (n=8) and a model group (n=64). The control group and the model group were fed the following two diets: (1) ND (normal diet, wheat flour, soybean meal, corn flour, fish meal, bran, yeast powder, bone meal, salt, cod liver oil, mineral additives, n=8); (2) HFD (high-fat diet, 60% of the energy comes from fat; HF60, n=64). Each experimental group was fed the normal diet (ND) or the high-fat diet (HFD) for 6 weeks. After that, they were allowed free access to food for one night, followed by a 10-hour fast (starting at 8:00 and ending at 18:00). Prepare an STZ solution by mixing pre-prepared, light-protected, weighed and stored STZ powder with citrate-sodium citrate buffer (0.1M, pH=4.5). Inject 50 mg / kg of STZ solution intraperitoneally into mice, while the control group received an equal volume of physiological saline. The injection volume was 0.1 mL (drug solution) / 10 g (mouse body weight). Mice were then allowed to resume their normal diet. STZ injections were repeated for 4 days after fasting. Fasting blood glucose levels were measured on days 3 and 4 after the completion of the 4 STZ injections. Mice with a fasting blood glucose level ≥11.1 mmol / L for two consecutive days were considered successfully modeled. The subsequent drug administration phase then began.

[0046] 2. Administration

[0047] Mice were randomly divided into 8 groups: model group, gliclazide group, low-dose oregano extract group, medium-dose oregano extract group, high-dose oregano extract group, low-dose luteolin group, medium-dose luteolin group, and high-dose luteolin group. Based on animal welfare and subsequent mouse weight considerations, each group was randomly divided into 2 cages with 4 mice per cage. After grouping, each group of mice was administered saline, gliclazide (7.8 mg / kg / day), oregano extract (low-dose group: 600 mg / kg / day; medium-dose group: 1200 mg / kg / day; high-dose group: 2400 mg / kg / day), or luteolin (low-dose group: 50 mg / kg / day; medium-dose group: 100 mg / kg / day; high-dose group: 200 mg / kg / day) via gavage. Administration continued for 4 weeks, during which time mice were fed a normal / high-fat diet.

[0048] At the end of the experiment, mice were euthanized under anesthesia after fasting for 12 hours but not water. Blood was collected from the eyes, left at room temperature for one hour, and then centrifuged at 3500 rpm for 10 minutes to separate the serum. After cardiac perfusion, the liver, pancreas, and colon of the mice were dissected and immediately frozen in liquid nitrogen or preserved in paraformaldehyde.

[0049] 3. Example of drug efficacy evaluation experiment

[0050] 3.1 Serum total cholesterol and triglyceride levels in diabetic mice were measured.

[0051] After the experiment, the serum total cholesterol (TC) and triglyceride (TG) levels in mouse serum samples were measured. The mouse triglyceride (TG) and total cholesterol (T-CHO) test kits were used, and the measurements were performed according to the kit instructions. The specific steps are as follows:

[0052] 1. Sample preparation

[0053] After blood was collected from the eyeball, it was allowed to stand for 1 hour, then centrifuged to separate the serum, which was then used for direct testing.

[0054] 2. Sample addition

[0055] The blank wells, standard wells, and sample wells are set up separately. Distilled water, standards, or samples are added as needed, and then the working solution is added together.

[0056] 3. Measurement

[0057] Shake the plate to mix well, incubate at 37°C for 10 minutes, and measure the absorbance of each well using a microplate reader at a wavelength of 500 nm.

[0058] 4. Calculation

[0059]

[0060] 4. Improves glucose metabolism in diabetic mice

[0061] 4.1 Liver weight and organ coefficient in diabetic mice

[0062] After dissecting and removing the mouse liver tissue, surrounding tissues such as the gallbladder, blood vessels, and intestines were removed. The liver was rinsed in PBS buffer, the surface moisture was blotted dry, and the liver was weighed and recorded. The organ coefficient (organ-to-body ratio) was calculated using the formula: Liver organ coefficient = Liver weight (g) / Body weight (g) × 100%

[0063] 4.2 Glycogen content in liver tissue of diabetic mice

[0064] After animal rearing, the glycogen content in mouse liver tissue samples was measured. A mouse liver glycogen enzyme-linked immunosorbent assay (ELISA) kit was used, and the assay was performed according to the kit's instructions. The concentration of mouse liver glycogen in the samples was calculated using a standard curve. The specific steps are as follows:

[0065] 1. Tissue sample extraction

[0066] Retrieve liver samples stored at -80℃. Using a pre-cooled tool, cut a portion of liver tissue on ice. Add tissue and lysis buffer (with protease and phosphatase inhibitors added before use) at a ratio of tissue weight (g): extraction liquid volume (mL) of 1:10. Add sterilized steel balls to EP tubes and homogenize on ice for 15 min. Discard the steel balls, allow to stand on ice for 30 min to allow for complete lysis, then centrifuge at high speed (4℃, 12000 rpm, 20 min). Collect the supernatant and store on ice.

[0067] 2. Sample protein quantification

[0068] Immediately after sample extraction, the absorbance of the samples was detected using the BCA protein quantification kit (working solution preparation - standard dilution - sample dilution - sample loading - microplate reader detection - standard curve generation - calculation of sample concentration). Subsequently, the samples were uniformly diluted with protein loading buffer according to the minimum concentration method for later use.

[0069] 3. Liver glycogen testing

[0070] Take the quantified sample extract and measure the glycogen in the sample according to the kit instructions.

[0071] 4. Real-time quantitative PCR detection

[0072] The target primer sequences were obtained from the Primer Premier 5.0 software design, and the specific sequences are shown in Table 1:

[0073] Table 1 shows the primer sequences used in the study. cDNA was reverse transcribed using the Maxima Reverse Transcriptase kit and then subjected to quantitative PCR (qRT-PCR) using 2×SG FastqPCR Master Mix (High Rox) on a 7500 qRT-PCR instrument. qRT-PCR amplification parameters were: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 60℃ annealing for 35 s, for a total of 45 cycles, with GAPDH used as an internal reference gene.

[0074] Gene direction sequence length GBE1 FORWARDREVERSE CAGGCATTGGTTGGTGACAAGACCGAGCCCGTGAGTGATGAGAC 148 GYS2 FORWARDREVERSE TTCCGCTCTCCAGACGATTCTTGTGCCCAGGTATCTCCAGTCCAG 139

[0075] 5. Promotes insulin secretion

[0076] 5.1 Calculation of HOMA-IR Index, HOMA-IS Index and HOMA-β Index

[0077] After the dosing regimen was completed, blood samples were collected from the mice after fasting to measure fasting blood glucose and insulin levels. The insulin resistance index HOMA-IR, insulin sensitivity index HOMA-IS, and pancreatic β-cell function index HOMA-β were calculated using formulas and statistically analyzed using GraphPad Prism 8.0.1 software to assess the insulin resistance and sensitivity levels in the mice.

[0078] The specific formula is as follows:

[0079] HOMA-IR = FPG × FINS / 22.5

[0080] HOMA-IS = 1 / (FPG×FINS)

[0081] HOMA-β = 20 × FINS / (FPG - 3.5)

[0082] Note: FPG, fasting blood glucose, unit is mmol / L; FINS, fasting insulin, unit is μU / mL; coefficients 22.5, 20, and 3.5 are correction factors.

[0083] 5.2 Detection of glucose levels in mouse pancreatic tissue

[0084] The glucose content in mouse pancreatic tissue samples was determined using a microplate method. A glucose content (GOPOD oxidase method) assay kit was used, and the glucose content was determined according to the instructions. The specific steps are as follows:

[0085] 1. Tissue sample extraction

[0086] Take out the pancreatic sample stored at -80℃, cut 20 mg of tissue sample on ice, add 200 μL of distilled water and grind, transfer all the crude extract to EP tube, centrifuge at 12000 rpm at room temperature for 10 min, and the supernatant is the sample to be tested.

[0087] 2. Preliminary Experiment

[0088] Before the formal testing, select two samples and find the appropriate dilution factor D for this test.

[0089] 3. On-machine testing

[0090] Prepare the microplate reader (preheat for 30 min at 25°C, wavelength 520 nm). Dilute the sample to the appropriate concentration, add the sample according to the kit instructions, mix well, and incubate at 37°C in the dark for 30 min. Read the absorbance at 520 nm.

[0091] 4. Results

[0092] The sample glucose concentration is calculated using the following formula: Glucose content (mg / g fresh weight) = (C standard × V1) × ΔA glucose ÷ (A standard - A blank) ÷ (W × V1 ÷ V) × D = ΔA glucose ÷ (A standard - A blank) ÷ W × D

[0093] Note: C standard --- concentration of glucose standard, 1 mg / mL; D --- dilution factor, undiluted is 1; V --- volume of extract added, 1 mL; V1 --- volume of sample added, 0.01 mL; W --- fresh weight of sample, g

[0094] 5.3 Detection of ROS and ATP levels in mouse pancreatic tissue

[0095] The ROS and ATP content in mouse pancreatic tissue samples was determined using the ELISA method. A mouse reactive oxygen species (ROS) and adenosine triphosphate (ATP) assay kit was used, and the measurements were performed according to the kit instructions. The concentrations of mouse ROS and ATP in the samples were calculated using a standard curve.

[0096] Experimental results

[0097] 1. Efficacy Evaluation

[0098] Serum total cholesterol and triglyceride levels in diabetic mice were measured.

[0099] Mice fed a high-fat diet exhibited abnormal blood lipid levels. Blood lipid levels in mice were evaluated by measuring serum total cholesterol (TC) and triglyceride (TG) levels, as detailed in [link to relevant documentation]. Figure 1 Compared with the control group, the blood lipid levels in all modeling groups were significantly increased (P<0.001), indicating that there are certain abnormalities in lipid metabolism in diabetic mice. Compared with the model group, TG and TC in all treatment groups decreased significantly after 4 weeks of treatment (P<0.01). This indicates that oregano can effectively block abnormal changes in blood lipids in diabetic mice.

[0100] 2. Improves glucose metabolism in diabetic mice

[0101] 2.1 Liver weight and organ coefficient in diabetic mice

[0102] The liver is another crucial organ for glucose regulation besides the pancreas. It plays a dual role in regulating diabetes; liver disease affects glucose metabolism, and long-term chronic hyperglycemia in diabetes can also cause liver damage. After drug administration to mice, liver weight and organ coefficients were collected and analyzed for each group of mice. (See details below.) Figure 2Figures A and B are shown. As shown, compared with the control group, the liver weight of mice in the model group was significantly increased (P<0.001), indicating that long-term high-fat diet combined with STZ-induced hyperglycemia damaged the liver of mice. Meanwhile, the pancreas weight in each treatment group showed a certain decreasing trend compared with the model group. Although the differences in the other groups, except for bovine M (P<0.01), bovine H (P<0.01), and wood M (P<0.05), were not statistically significant, it still indicates that each drug has a certain protective effect on the mouse liver. The organ coefficient showed the same trend as the liver weight. This suggests that oregano can improve liver lesions in diabetic mice.

[0103] 2.2 Glycogen content in liver tissue of diabetic mice

[0104] Liver glycogen is the main form of glucose storage in the body, and liver glycogen metabolism is an important process in the body's glucose metabolism. After the experiment, the liver glycogen content in mouse liver tissue samples was measured; details can be found in [link to details]. Figure 3 Compared with the control group, the liver glycogen content of mice in the model group was significantly reduced (P<0.001), indicating a decreased liver glycogen storage capacity in diabetic mice. However, compared with the liver glycogen content of the model group, all groups showed a significant upward trend after drug treatment (P<0.05). This suggests that oregano can effectively improve glycogen metabolism in diabetic mice.

[0105] 2.3 Real-time quantitative PCR detection

[0106] The expression of glycogen synthase GYS2 and glycogen branching enzyme GBE1, key enzymes in liver glycogen synthesis, was detected by real-time quantitative PCR to investigate the role of oregano in regulating glycogen synthesis. Figure 4 As shown in Figures A and B. The results showed that under the combined effects of a high-fat diet and STZ injection to induce hyperglycemia, the expression of the key glycogen synthesis enzymes GYS2 and GBE1 genes in the model group mice was significantly reduced (P < 0.05). However, after 4 weeks of intervention with gliclazide and oregano, the gene expression in each treatment group was significantly enhanced, thus improving liver glycogen metabolism in mice. These results suggest that oregano can regulate liver glycogen metabolism in diabetic mice by enhancing the expression of the key glycogen synthesis enzymes GYS2 and GBE1 genes.

[0107] 3. Promotes insulin secretion

[0108] 3.1 Calculation of HOMA-IR Index, HOMA-IS Index and HOMA-β Index

[0109] Homeostasis models, including HOMA-IR, HOMA-IS, and HOMA-β, are commonly used indicators for assessing insulin resistance and sensitivity. Therefore, HOMA-IR, HOMA-IS, and HOMA-β indices were calculated using fasting blood glucose and fasting insulin levels in mice after drug administration to evaluate the effect of oregano on insulin homeostasis in diabetic mice. The results of the insulin resistance index HOMA-IR are shown in Figure 5A. The index was significantly increased in the model group (P < 0.001), while it was decreased in the drug-treated group, especially at medium dose (P < 0.05) and high dose (P < 0.01) of luteolin, indicating a significant difference. This suggests that diabetic mice fed a high-fat diet and injected with STZ exhibited significant insulin resistance, and drug treatment alleviated the insulin resistance. The results of the insulin sensitivity index HOMA-IS are shown in Figure 5A. Figure 5 B. The model group index was significantly lower (P < 0.001), while the drug treatment group showed an increase. The high-dose luteolin group showed a statistically significant difference (P < 0.01). This indicates that insulin sensitivity in diabetic mice is decreased, while drug treatment improves insulin sensitivity in mice. Figure 6 The results of the HOMA-β index, which showed pancreatic β-cell function, were consistent with those of the HOMA-IS index, indicating that diabetes significantly reduced pancreatic β-cell function in mice (P < 0.001). Although the function was still far from normal, drug treatment did lead to some recovery in pancreatic β-cell function (P < 0.01 in the H group). Overall, oregano may play a positive role in regulating insulin homeostasis.

[0110] 3.2 Effects of oregano on glucose content in the pancreas of diabetic mice

[0111] The presence of a high-glucose environment within the pancreas is a major stimulator of insulin secretion. Therefore, this study used a kit to detect glucose levels in pancreatic tissue to first assess the regulatory effect of oregano on a high-glucose environment in mice. (See details below.) Figure 7 Consistent with the results of fasting insulin and serum glycated hemoglobin blood glucose levels, the glucose content in the mouse pancreas also showed a pattern of high in the model group (P < 0.001) and low in the treated group (the difference between each treated group and the model group was P < 0.001). This indicates that, based on the overall blood glucose level in mice, a consistent glucose environment is maintained in the pancreas to initiate subsequent regulatory responses.

[0112] 3.3 Effects of oregano on the content of reactive oxygen species (ROS) and ATP in the pancreas of diabetic mice

[0113] Reactive oxygen species (ROS) are byproducts of mitochondrial metabolism. Their accumulation can inhibit the electron transport chain in mitochondria, leading to reduced ATP production. ATP is the end product of glucose metabolism in pancreatic islet cells and is also a "key" to ion channels and cell membrane depolarization. Detecting the levels of ROS and ATP in pancreatic tissue aims to explore whether oregano can regulate mitochondrial metabolism. Figure 8 A and B). Figure 8 The results showed that diabetes increased ROS in the pancreatic tissue of mice (P < 0.001), while gliclazide, oregano extract, and luteolin could significantly reduce ROS accumulation (P < 0.001). Figure 8 The results showed that the ATP content in the pancreas of the model group mice was significantly lower than that of normal mice (P < 0.001). After treatment, the ATP content in all groups of mice increased significantly, and the differences were statistically significant (P < 0.01). Based on the experimental results, it can be inferred that oregano can regulate mitochondrial metabolism, reduce ROS accumulation, and promote ATP metabolism in mouse pancreatic mitochondria.

[0114] Beneficial effects

[0115] Compared with the prior art, the present invention has the following significant advantages:

[0116] High extraction efficiency: Pretreatment with cellulase disrupts the cell wall structure of oregano, and combined with ultrasonic cavitation, enhances the release of intracellular active ingredients, increasing the luteolin extraction rate by 40-60% compared to traditional water extraction.

[0117] High content of target ingredients: The acidic hydrolysis process converts luteolin glycosides into aglycones, increasing the content of free luteolin by 2-3 times. The final product contains more than 30% luteolin, which is significantly higher than existing products (usually <15%).

[0118] Excellent purification effect: The multi-stage purification system of salting out, ultrafiltration, nanofiltration, macroporous resin, and polyamide resin effectively removes impurities such as proteins, polysaccharides, tannins, and inorganic salts, resulting in high product purity.

[0119] High bioavailability: The water solubility and stability of luteolin are improved through β-cyclodextrin inclusion technology, with an inclusion rate of over 85%, and the in vitro dissolution rate is increased by 3-5 times, significantly improving bioavailability;

[0120] Good stability: The entire process is carried out in the dark, with nitrogen protection during concentration, cyclodextrin inclusion, and freeze-drying, which effectively prevents the oxidative degradation of active ingredients. The product maintains stability for more than 24 months at room temperature.

[0121] It is environmentally friendly: water is mainly used as the extraction solvent, and organic solvent (ethanol) is only used in the resin elution process and can be recycled, reducing environmental pollution;

[0122] The process is highly controllable: the parameters for each step are clearly defined, making it easy to scale up industrial production and ensuring good reproducibility;

[0123] Significant hypoglycemic activity: In vitro α-glucosidase inhibition experiments showed IC50... 50 Values ​​as low as 12-18 μg / mL, superior to the positive control acarbose (IC50). 50 (≈25μg / mL); Animal experiments have shown that it can reduce fasting blood glucose in diabetic mice by 25-35% and improve glucose tolerance and insulin sensitivity.

Claims

1. A method for extracting the hypoglycemic active ingredient of oregano using a combination of enzymatic hydrolysis-ultrasound-salting precipitation, characterized in that, Includes the following steps: (1) Crush the oregano and mix it with water; (2) Add cellulase, pectinase or a combination of these enzymes for enzymatic hydrolysis and cell wall breaking; (3) Flavonoid active ingredients were extracted using a combination of ethanol and ultrasound; (4) Preliminary purification is achieved by obtaining a precipitate through salting out; (5) Acid hydrolysis of the precipitate to increase the content of luteolin aglycone; (6) High-purity active components are obtained through multi-stage separation and purification; (7) The stability of the extract was improved by using β-cyclodextrin inclusion technology.

2. The method according to claim 1, characterized in that, The enzymatic hydrolysis temperature is 45–55℃, the pH is 4.0–5.5, and the hydrolysis time is 1–3 hours.

3. The method according to claim 1, characterized in that, The ultrasonic power is 200–600 W, and the ultrasonic time is 20–60 minutes.

4. The method according to claim 1, characterized in that, The salting-out agent is ammonium sulfate or sodium chloride, and the salting-out saturation is 40–80%.

5. The method according to claim 1, characterized in that, The acidic hydrolysis conditions are pH 2–3, temperature 60–80℃, and time 0.5–2 hours.

6. The method according to claim 1, characterized in that, Multi-stage separation and purification uses one or a combination of resin adsorption, solvent elution, or membrane separation methods.

7. The method according to claim 1, characterized in that, The final product contains ≥30% luteolin.

8. A product obtained by the method described in any one of claims 1 to 7, characterized in that: The active ingredient release rate is very high, with luteolin content ≥30%, and this product is used to improve glucose metabolism, enhance insulin sensitivity, reduce insulin resistance, increase liver glycogen levels, and improve pancreatic function.