Sphingobacterium sp. And application thereof in degradation of aromatic hydrocarbon organic pollutants
By screening Sphingomyelin-Bacillus as a degrading strain and utilizing aromatic hydrocarbon organic pollutants as a carbon and energy source, the problem of low degradation efficiency of aromatic hydrocarbon organic pollutants was solved, achieving efficient and safe biodegradation.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINA PETROLEUM & CHEMICAL CORP
- Filing Date
- 2024-10-12
- Publication Date
- 2026-04-24
AI Technical Summary
Existing technologies have low degradation efficiency for aromatic hydrocarbon organic pollutants such as p-xylene, and lack efficient and safe treatment methods.
A strain of Sphingobacterium sp. (accession number CCTCC NO:M2024175) was screened out, which uses aromatic hydrocarbon organic pollutants as carbon and energy sources and carries out degradation reactions by mixing with pollutants in an inorganic salt liquid culture medium.
It achieves a high degradation rate of over 98% for p-xylene and over 90% for ethylbenzene, and is adaptable to a wide range of temperatures and pH levels, providing an efficient and safe biodegradation solution.
Smart Images

Figure CN121914904A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of organic pollutant degradation technology, specifically relating to a sphingomyelin bacterium, a bacterial agent, and a method for degrading aromatic hydrocarbon organic pollutants. Background Technology
[0002] Aromatic hydrocarbons (VOCs) are a typical type of persistent volatile organic compounds (VOCs), widely sourced and commonly used as chemical raw materials and intermediates. These VOCs are physically and chemically stable, often exhibiting bioaccumulation and persistence, posing potential ecological hazards. For example, paraxylene has an irritating odor and can enter the human body through skin contact, inhalation, and ingestion. Short-term high-dose intake can suppress the central nervous system and cause irritation to the eyes and respiratory tract; accidental ingestion can cause acute poisoning symptoms such as abdominal pain and vomiting; long-term exposure to high concentrations of paraxylene can damage organs such as the liver and kidneys. Paraxylene has even been listed as a priority pollutant and toxic pollutant by the U.S. Environmental Protection Agency and is also included in my country's blacklist of priority environmental pollutants. Therefore, research on the degradation of aromatic hydrocarbons is of significant practical importance.
[0003] Currently, traditional treatment technologies, such as adsorption, catalytic oxidation, and plasma, often suffer from high costs, low efficiency, and poor safety when treating paraxylene. There is a lack of efficient and safe treatment technologies specifically for paraxylene. Biological methods are an economical, efficient, green, and safe VOCs treatment technology. Selecting and cultivating degrading strains capable of degrading paraxylene is key to achieving efficient biodegradation of paraxylene. Previous researchers have used *Sphingosphate Bacillus* to treat VOCs; for example, Yuan Jun of Xiamen University achieved a 90% removal rate of polycyclic aromatic hydrocarbons (PAHs) using *Sphingosphate Bacillus* in Erlenmeyer flasks, demonstrating the feasibility of using *Sphingosphate Bacillus* to treat aromatic hydrocarbon VOCs. However, to date, there are no research reports, domestically or internationally, on the efficient degradation of paraxylene and other aromatic hydrocarbon organic pollutants using *Sphingosphate Bacillus* as the sole carbon and energy source. If we can screen out Sphingosine monobacteria that use aromatic hydrocarbon organic pollutants such as p-xylene as their sole carbon and energy source and achieve efficient degradation of such pollutants, we can not only solve the problem of biodegradation of such pollutants, but also provide a new example of efficient VOCs treatment by Sphingosine monobacteria, and provide strong support for biological purification engineering to treat such pollutants. Summary of the Invention
[0004] The purpose of this invention is to overcome the problem of low degradation efficiency of aromatic hydrocarbon organic pollutants such as p-xylene in existing technologies, and to provide *Sphingomonas*, a bacterial agent, and a method for degrading aromatic hydrocarbon organic pollutants. The *Sphingomonas* provided by this invention can grow and reproduce using aromatic hydrocarbon organic pollutants such as p-xylene as a carbon source and energy source, achieving highly efficient degradation of these pollutants. This has significant implications for the engineering application of biological purification of aromatic hydrocarbon organic pollutants such as p-xylene.
[0005] To achieve the above objectives, the first aspect of the present invention provides a Sphingobacterium sp., wherein the preservation number of the Sphingobacterium sp. is CCTCC NO:M2024175.
[0006] A second aspect of the present invention provides a microbial agent, wherein the microbial agent contains *Sphingosine monocytogenes* provided by the present invention.
[0007] A third aspect of the present invention provides a method for degrading aromatic hydrocarbon organic pollutants, wherein the method comprises: mixing the *Sphingomonas* or the microbial agent provided by the present invention with a liquid containing aromatic hydrocarbon organic pollutants in an inorganic salt liquid culture medium, and then carrying out a degradation reaction.
[0008] The beneficial effects of the present invention through the above technical solution include at least the following:
[0009] The *Sphingomonas* strain with accession number CCTCC NO:M 2024175 provided by this invention can use aromatic hydrocarbon organic pollutants such as p-xylene and ethylbenzene as carbon and energy sources to achieve efficient degradation of these pollutants. In preferred cases, the degradation rate of p-xylene can reach over 98% in 14 hours and the degradation rate of ethylbenzene can reach over 90% in 48 hours.
[0010] The *Sphingomonas* EW-5 of the present invention can adapt to a wide range of temperatures and pH values. In preferred cases, it can grow and reproduce rapidly and degrade aromatic hydrocarbon organic pollutants such as p-xylene and ethylbenzene to a high extent under conditions of 20-40°C and pH 5-8.
[0011] Biological Preservation
[0012] The Sphingobacterium sp. of the present invention was deposited on January 22, 2024, at the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China, postcode: 430072), with accession number CCTCCNO:M 2024175. Attached Figure Description
[0013] Figure 1This is a scanning electron microscope image of Sphingosine monocytogenes EW-5 in this invention;
[0014] Figure 2 This is the phylogenetic tree of Sphingosporobacter EW-5 in this invention;
[0015] Figure 3 This is a graph showing the cell growth and xylene degradation curves of Sphingosine mononitrate EW-5 in Example 3 of this invention.
[0016] Figure 4 This is a bar graph showing the effects of different pH culture media on the xylene degradation performance, growth, and mineralization efficiency of Sphingosine mononitrate EW-5 in Example 4 of this invention.
[0017] Figure 5 This is a bar graph showing the effect of different temperatures on the xylene degradation efficiency, mineralization efficiency, and growth of *Sphingosine mononitrate* EW-5 in Example 5 of this invention.
[0018] Figure 6 This is a degradation curve of paraxylene by Sphingomyces cerevisiae EW-5 at different initial concentrations in Example 6 of the present invention;
[0019] Figure 7 This is a growth curve of Sphingomyelin-EW-5 under different initial para-xylene concentrations in Example 6 of the present invention. Detailed Implementation
[0020] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0021] The first aspect of the present invention provides a Sphingobacterium sp., wherein the preservation number of the Sphingobacterium sp. is CCTCC NO:M 2024175.
[0022] In this invention, *Sphingosporobacter* with accession number CCTCC NO:M 2024175 was isolated and screened from activated sludge of Zhenhai Refining & Chemical Co., Ltd., China Petroleum & Chemical Corporation. It is an aerobic, Gram-negative bacterium with short rod-shaped cells, measuring (0.61-0.68) μm × (0.93-1.19) μm, non-spore-forming, and surrounded by pili. Colonies are round, initially milky white, gradually turning pale yellow, opaque, plump, smooth, and moist, easily picked up, and grow along the streaks. After 16S rDNA sequencing, it was identified as belonging to the genus *Sphingosporobacter* and named *Sphingosporobacter* EW-5.
[0023] The *Sphingomonas* EW-5 strain of this invention can grow and reproduce using aromatic hydrocarbon organic pollutants such as p-xylene and ethylbenzene as carbon and energy sources, and can efficiently degrade these organic pollutants. Moreover, this strain can efficiently degrade aromatic hydrocarbon organic pollutants over a wide range of growth temperatures and pH.
[0024] A second aspect of the present invention provides a microbial agent, wherein the microbial agent contains *Sphingosine monocytogenes* provided by the present invention.
[0025] In this invention, the form of the microbial agent can be a conventional form of agent in the art, such as a solid, liquid or semi-solid form.
[0026] A third aspect of the present invention provides a method for degrading aromatic hydrocarbon organic compounds, wherein the method comprises: mixing the *Sphingomonas* or the microbial agent provided by the present invention with a liquid containing aromatic hydrocarbon organic pollutants in an inorganic salt liquid culture medium, and then carrying out a degradation reaction.
[0027] In a preferred embodiment of the present invention, the bacterial agent is a liquid bacterial solution. Preferably, the preparation method of the bacterial agent includes: inoculating *Sphingosine monocytogenes* with accession number CCTCC NO:M 2024175 into a solid culture medium for culture, and then inoculating the cultured bacterial cells into a liquid culture medium for expansion culture.
[0028] In a preferred embodiment of the present invention, the solid culture medium used during cultivation is a solid slant culture medium. After cultivation, slant cells are obtained, and then the slant cells are inoculated into an inorganic salt liquid culture medium for expansion cultivation.
[0029] Preferably, based on a volume of 1L, the solid culture medium comprises: 0.5-1g yeast extract, 0.5-1g water-soluble starch, 0.5-1g MgSO4, 0.5-1g tryptone, 0.5-1g glucose, 0.3-0.6g sodium pyruvate, 0.45-0.9g K2HPO4, and 18-20g agar, with water as the solvent;
[0030] And / or, based on a volume of 1L, the inorganic salt liquid culture medium comprises: 4-5g of Na2HPO4, 0.8-1.2g of KH2PO4, 2.3-2.8g of (NH4)2SO4, 0.18-0.23g of MgSO4, 0.022-0.24g of CaCl2, and 0.8-1.2mL of trace element stock solution, with water as the solvent;
[0031] The trace element mother liquor, with a volume of 1L, comprises: 0.8-1.2g / L FeSO4, 0.015-0.025g / L CuSO4, 0.013-0.015g / L H3BO3, 0.08-0.13g / L MnSO4, 0.08-0.13g / L ZnSO4, 0.015-0.025g / L Na2MoO4, and 0.015-0.025g / L CoCl2, with water as the solvent.
[0032] According to the present invention, preferably, the pH value of the inorganic salt liquid culture medium is 4-10.
[0033] In this invention, the inoculum size of *Sphingomonas EW-5* in the inorganic salt liquid culture medium can be selected within a wide range during expansion culture, as long as it meets the requirements of relevant standards. Preferably, the inoculum size of *Sphingomonas EW-5* in the inorganic salt liquid culture medium is such that the OD of the inoculated solution is... 600 The value is 0.01-0.02. In a preferred embodiment of the present invention, the inoculation and culture of Sphingosine monoclonal antibody EW-5 on slant solid medium is performed by streak plating.
[0034] According to the present invention, preferably, the culture temperature is 25-30°C and the time is 48-72 hours;
[0035] And / or, the expansion culture temperature is 25-30℃ and the time is 24-36h.
[0036] In this invention, the total viable count in the bacterial agent can be selected within a wide range, as long as it meets the requirements of relevant standards. Preferably, the OD (Organic Dioxide) is obtained after expansion culture. 600 The bacterial solution (liquid bacterial agent) is 0.1-0.2.
[0037] According to the present invention, preferably, during the mixing, the amount of *Sphingosine monocytogenes* or the bacterial agent is such that the total viable count is (3-10) × 10⁻¹¹ relative to 1 mg of aromatic hydrocarbon organic pollutants. 4 The number of elements is preferably (3.4-9.1)×10. 4 indivual.
[0038] In order to enable Sphingomyelin Bacillus EW-5 to multiply more rapidly and further improve the degradation rate of aromatic hydrocarbon organic pollutants, preferably, the temperature of the degradation reaction is 20-40℃, more preferably 25-35℃; and the initial pH value of the degradation reaction is 5-8, more preferably 6-8.
[0039] According to the present invention, the degradation reaction can be carried out in a shaker, preferably at a shaker speed of 130-170 r / min.
[0040] According to the present invention, the degradation reaction time is adjusted according to the concentration of aromatic hydrocarbon organic pollutants.
[0041] In a preferred embodiment of the present invention, the content of aromatic hydrocarbon organic pollutants in the feed liquid is 100-600 mg / L.
[0042] According to the present invention, preferably, the aromatic hydrocarbon organic pollutants in the feed liquid containing aromatic hydrocarbon organic pollutants are selected from at least one of C8 aromatic hydrocarbons, more preferably from p-xylene and / or ethylbenzene.
[0043] In a preferred embodiment of the present invention, the feed solution containing aromatic hydrocarbon organic pollutants is an inorganic salt liquid culture medium containing aromatic hydrocarbon organic pollutants. The formulation of the inorganic salt liquid culture medium containing aromatic hydrocarbon organic pollutants is based on the aforementioned inorganic salt liquid culture medium formulation, and further contains 100-600 mg / L of aromatic hydrocarbon organic pollutants.
[0044] In a preferred embodiment of the present invention, the method for degrading aromatic hydrocarbon organic compounds includes the following steps:
[0045] a. Inoculate Sphingosine monoclonal antibody EW-5 onto solid slant culture medium and incubate at 25-30℃ for 48-72h to obtain slant cells;
[0046] b. Inoculate the slant bacterial cells into an inorganic salt culture medium and incubate at 25-30℃ for 24-36 hours to obtain OD. 600 =0.1-0.2% bacterial solution;
[0047] c. Mix the bacterial solution with the liquid containing aromatic hydrocarbons to prepare a mixed solution;
[0048] d. Allow the mixture to undergo a degradation reaction at 20-40℃.
[0049] The present invention will be described in detail below through examples and comparative examples. Unless otherwise specified, the methods used in the following examples are conventional; the reagents and materials used are commercially available unless otherwise specified.
[0050] Example 1
[0051] This example illustrates the isolation, purification, and identification of Sphingosporobacter EW-5.
[0052] Inorganic salt culture medium formulation: Based on a volume of 1L of inorganic salt culture medium, the contents of each component in the inorganic salt culture medium are as follows: 4.5g Na2HPO4, 1g KH2PO4, 2.5g (NH4)2SO4, 0.2g MgSO4, 0.2g CaCl2, and 1mL of trace element stock solution, with water as the solvent; wherein, based on a volume of 1L of trace element stock solution, the contents of each component in the trace element stock solution are as follows: 1g FeSO4, 0.02g CuSO4, 0.014g H3BO3, 0.1g MnSO4, 0.1g ZnSO4, 0.02g Na2MoO4, and 0.02g CoCl2, with water as the solvent; pH=7.
[0053] (1) Isolation and purification of Sphingomyelin Bacillus EW-5
[0054] Activated sludge was collected from the wastewater treatment pond of Zhenhai Refining & Chemical Co., Ltd. in Ningbo City, Zhejiang Province. The lower layer of sludge after settling was mixed with inorganic salt culture medium at a ratio of 1:2 (v / v). 3L of the mixture was added to a 5L sludge acclimatization tank (see Jin Xiaojun. Isolation, Identification, Degradation Characteristics and Preparation of New Dioxane-Degrading Strains [D]. Zhejiang University of Technology, 2012.). 500mg / L of substrate p-xylene was added daily as the sole carbon and energy source. The acclimatization culture was carried out at room temperature. After 20 days, 5mL of sludge was taken from the acclimatization tank and added to a shake flask containing 50mL of inorganic salt. It was found that the acclimatized sludge could stably degrade 100mg / L p-xylene per day in the shake flask, with a degradation rate of 80-90% (shake flask experimental conditions: 30℃, 160r / min). Acclimatized samples were obtained.
[0055] 1 mL of sludge sample was transferred from one shake flask to another for further performance testing. The transferred sludge showed a stable daily degradation of 100 mg / L paraxylene in the shake flask. This sludge sample was then further transferred and enriched for 6 generations (1 mL each time). The enriched sludge was then processed at 10... -1 -10 -6 The culture was spread on R2A solid medium plates at multiple times, and single colonies were picked. Then, using p-xylene at a final concentration of 100 mg / L as a substrate, the degradation activity was determined, and the bacteria were isolated and purified to obtain a strain EW-5 with p-xylene degradation activity.
[0056] (2) Identification of strain EW-5
[0057] Morphological characteristics of strain EW-5 as follows Figure 1 As shown, by Figure 1It can be seen that strain EW-5 is an aerobic Gram-negative bacterium with short rod-shaped cells, measuring (0.61-0.68) μm × (0.93-1.19) μm. It has no spores and is surrounded by pili. The colonies are round, initially milky white, gradually turning light yellow, opaque, plump, smooth, and moist. They are easy to pick up, and the bacterial growth follows the streaks.
[0058] PCR amplification and sequencing were performed by Sangon Biotech (Shanghai) Co., Ltd. The Genebank accession number for the 16S rDNA of *Sphingomonas EW-5* is OR792772, and the 16S rDNA sequence of the strain is shown in SEQ ID NO: 1.
[0059] The 16S rDNA sequence of strain EW-5 was uploaded to the Ezbiocloud.net website and compared with standard strains on the website. A phylogenetic tree was constructed using MEGA7 software with Neighbor-Joining, and evaluated using the Bootstrap method (repeated 1000 times). The constructed phylogenetic tree is shown below. Figure 2 Thus, the strain EW-5 was identified as Sphingobacterium, named Sphingobacterium sp. EW-5, and deposited at the China Center for Type Culture Collection on January 22, 2024, with accession number CCTCC NO:M 2024175.
[0060] Example 2
[0061] This example illustrates the scale-up culture of Sphingosine mononitrate EW-5.
[0062] R2A solid slant culture medium formulation:
[0063] Based on a solid culture medium volume of 1L, the contents of each component in the solid culture medium are as follows: 1g yeast extract, 1g water-soluble starch, 1g MgSO4, 1g tryptone, 1g glucose, 0.6g sodium pyruvate, 0.9g K2HPO4 and 20g agar, with water as the solvent.
[0064] The inorganic salt culture medium formulation is the same as that in Example 1.
[0065] After expanding the culture of Sphingosine Bacillus EW-5, a bacterial suspension containing Sphingosine Bacillus EW-5 was obtained. The specific process is as follows:
[0066] 1) Slant culture: Sphingomyelin Bacillus EW-5 was inoculated into R2A solid slant medium and cultured at 30℃ for 72h to obtain slant cells;
[0067] 2) Expanded culture: Using an inoculation loop, pick up the slant cells obtained in step (1) and inoculate them into an inorganic salt medium. Incubate at 30°C for 24 hours to obtain OD. 600 =0.1 bacterial solution.
[0068] Example 3
[0069] This example illustrates the performance of Sphingosporobacter EW-5 in degrading p-xylene.
[0070] Using p-xylene as the sole carbon source for *Sphingomonas EW-5*, the OD prepared by the method in Example 2 was used. 600 =0.1 bacterial suspension, inoculated into 50 mL of fresh inorganic salt medium containing 100 mg / L p-xylene (pH = 7, the inorganic salt medium formula is the same as the inorganic salt medium formula in Example 1), so that the initial bacterial concentration is expressed as OD 600 The value was calculated to be 0.02. The cells were incubated in a shaker at 30℃ and 160 rpm. Samples were taken every 5 hours to determine the xylene degradation rate, and a portion of the bacterial culture was extracted using a 5 mL syringe to measure the bacterial OD. 600 Value. During the experiment, two parallel samples and a blank control group without inoculation were designed.
[0071] Figure 3 This is a graph showing the cell growth and xylene degradation of Sphingomyelin Bacillus EW-5. Figure 3 It can be seen that the bacterial concentration gradually increases with time, reaching its maximum at 14 hours of cultivation, approximately 0.11 (in OD500). 600 (Calculated), the degradation rate of p-xylene reached over 95%. This indicates that *Sphingomonas* EW-5 can utilize p-xylene as its sole carbon and energy source for growth and reproduction, and possesses a stable and efficient ability to degrade p-xylene.
[0072] Example 4
[0073] This example illustrates the effect of the initial pH of the inorganic salt culture medium on the degradation of xylene by Sphingosine mononitrate EW-5.
[0074] The inorganic salt culture medium (the formulation of the inorganic salt culture medium is the same as that in Example 1) was adjusted to different pH values (4, 5, 6, 7, 8, 9, 10) using 1 mol / L NaOH aqueous solution or 1 mol / L H2SO4 aqueous solution. The bacterial suspension prepared according to the method in Example 2 was inoculated under the condition that the initial xylene concentration was 100 mg / L, so that the initial bacterial concentration in each parallel sample was expressed as OD... 600 The value was calculated as 0.02. The sample was cultured in a constant temperature shaker at 30℃ and 160 r / min for 30 h. Samples were taken after 30 h to measure the degradation rate of p-xylene in the reaction solution and the OD value of the bacterial culture (expressed as OD). 600To measure the CO2 value, during the experiment, 2-3 parallel samples and a blank control group without inoculation were designed.
[0075] Figure 4 The degradation performance of p-xylene by *Sphingomyelin-EW-5* in culture media with different pH values was studied. Figure 4 A) Growth status ( Figure 4 B) Mineralization efficiency ( Figure 4 The influence of C) on the bar chart; by Figure 4 As shown in Figure A, *Sphingomyelinatoria* EW-5 exhibits a high degradation rate of p-xylene within the pH range of 5-8; especially at pH 6-7, the degradation rate of p-xylene by *Sphingomyelinatoria* EW-5 reaches its optimal level (over 95%). Figure 4 B and Figure 4 As can be seen from C, the growth rate and CO2 production of Sphingosine monophosphate EW-5 also show a trend consistent with the degradation rate of p-xylene.
[0076] Example 5
[0077] This example illustrates the effect of temperature on the degradation of xylene by Sphingosine monocytogenes EW-5.
[0078] In an inorganic salt medium (pH = 7, the formulation of which is the same as that in Example 1) with an initial paraxylene concentration of 100 mg / L, the bacterial suspension prepared by the method in Example 2 was inoculated, so that the initial bacterial concentration in each parallel sample was expressed as OD0.05. 600 The value was calculated to be 0.02. Each sample was placed in a shaker at 20℃, 25℃, 30℃, 35℃, and 40℃ for constant temperature shaking incubation (shaking speed 160 r / min). After 30 h of incubation, samples were taken to measure the degradation rate of p-xylene and OD in the reaction solution. 600 To measure the values of the strain and CO2, two parallel samples and a blank control group without inoculation were designed during the experiment.
[0079] Figure 5 The degradation efficiency of p-xylene by *Sphingomyelin-EW-5* at different temperatures ( Figure 5 A) Mineralization efficiency ( Figure 5 B) and growth status ( Figure 5 The influence of C) on the bar chart. From Figure 5 As shown in Figure A, *Sphingomyelinatoria EW-5* exhibits a high degradation rate of p-xylene within a temperature range of 20-40℃; particularly within the 30-35℃ temperature range, the degradation rate of p-xylene by *Sphingomyelinatoria EW-5* reaches its optimal level (over 98%). Figure 5 B and Figure 5 As can be seen from C, the growth rate and CO2 production of Sphingosine monocytogenes EW-5 also show a trend consistent with the degradation rate of p-xylene.
[0080] Example 6
[0081] This example illustrates the effect of substrate concentration on the degradation of xylene by Sphingosine monocytogenes EW-5.
[0082] The degradation of p-xylene by *Sphingomonas* EW-5 strain was studied under suitable culture conditions (pH = 7, t = 30℃). Different concentrations of p-xylene substrate were added to fresh inorganic salt medium (the formulation of which was the same as in Example 1) to achieve initial substrate concentrations of 100 mg / L, 200 mg / L, 300 mg / L, 400 mg / L, 500 mg / L, and 600 mg / L. Bacterial suspensions prepared according to the method in Example 2 were inoculated, and the initial bacterial concentrations in each parallel sample were determined by OD0.05. 600 The value was calculated as 0.02, with no bacterial culture as a blank. The bacteria were cultured in a shaker at 30℃ and 160 rpm, and samples were taken periodically to determine the OD of *Sphingospora ebinuria* EW-5. 600 To determine the concentration of paraxylene, two parallel samples and a blank control group without inoculation were designed during the experiment.
[0083] Figure 6 The graph shows the degradation curves of para-xylene by *Sphingomyelin-EW-5* at different initial concentrations. Figure 6 It can be seen that *Sphingomyelinatoria eW-5* can almost completely convert p-xylene to CO2 and H2O after 28 hours at a p-xylene concentration of 300 mg / L. However, at a p-xylene concentration of 500 mg / L, *Sphingomyelinatoria eW-5* requires 48 hours to completely degrade p-xylene. The degradation rate of p-xylene by *Sphingomyelinatoria eW-5* decreases with increasing p-xylene concentration, and the degradation time also becomes longer. Figure 7 This is a growth curve of Sphingomyelin-EW-5 at different initial para-xylene concentrations, from... Figure 7 It can be seen that when the degradation rate of Sphingomyelin Bacillus EW-5 reaches its highest level at different xylene concentrations, the bacterial count also tends to stabilize.
[0084] Example 7
[0085] This example illustrates the degradation ability of Sphingosporobacter EW-5 on different carbon source substrates.
[0086] Add ethylbenzene at an initial concentration of 100 mg / L to fresh inorganic salt culture medium (the formulation of the inorganic salt culture medium is the same as that in Example 1), and inoculate with the *Sphingospora* EW-5 bacterial suspension prepared in Example 2, so that the initial bacterial concentration is expressed as OD0.05. 600 The value was calculated to be 0.02. The cells were cultured under isothermal shaking at 30℃ and 160 r / min for 48 h, and the OD was measured afterward. 600The degradation rate was measured, revealing that this strain possesses the ability to degrade ethylbenzene. After 48 hours of cultivation, the degradation rate of ethylbenzene reached 90.1%, with an OD value of [missing value]. 600 It is 0.114.
[0087] Example 8
[0088] This example illustrates the degradation ability of Sphingosporobacter EW-5 and Sphingosporobacter HY-100C on paraxylene.
[0089] Add 100 mg / L of p-xylene to fresh inorganic salt culture medium (the formula of the inorganic salt culture medium is the same as that in Example 1), and inoculate with *Sphingobacterium sphingolipidae* EW-5 and *Sphingobacterium sphingolipidae* HY-100C cultures prepared in Example 2 (*Sphingobacterium sphingolipidae* HY-100C is disclosed in CN115717116A, accession number CCTCC NO: M20221449, prepared according to the method in Example 2 of this invention), so that the initial cell concentration is 0.02 based on OD600. Culture in a shaker at 30°C and 160 r / min for 14 h, and then measure the OD600. 600 The degradation rate and the results are shown in Table 1.
[0090] Table 1
[0091]
[0092]
[0093] As can be seen from the results in Table 1, Sphingomyelin EW-5 has a stronger ability to degrade p-xylene than Sphingomyelin HY-100C.
[0094] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.
[0095] SEQ ID NO: 1
[0096] AGTTTGATCCCTGGCTCAGGATGAACGCTAGCGGCAGGCCTAATACATGCAAGTC
[0097] GGACGGGATCCATCGGAGAGCTTGCTCGAAGATGGTGAGAGTGGCGCACGGGTGC
[0098] GTAACGCGTGAGCAACCTACCTCTATCAGGGGGATAGCCTCTCGAAAGAGAGATT
[0099] AACACCGCATAACATCAACAGTTCGCATGTTCAGTTGATTAAATATTTATAGGATA
[0100] GAGATGGGCTCGCGTGACATTAGCTAGTTGGTAGGGTAACGGCTTACCAAGGCGA
[0101] CGATGTCTAGGGGCTCTGAGAGGAGAATCCCCCACACTGGTACTGAGACACGGAC
[0102] CAGACTCCTACGGGAGGCAGCAGTAAGGAATATTGGTCAATGGGCGGAAGCCTGA
[0103] ACCAGCCATGCCGCGTGCAGGATGACTGCCCTATGGGTTGTAAACTGCTTTTGTCC
[0104] AGGAATAAACCTAGATACGTGTATCTAGCTGAATGTACTGGAAGAATAAGGATCG
[0105] GCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGAT
[0106] TTATTGGGTTTAAAGGGTGCGTAGGCGGCCTATTAAGTCAGGGGTGAAATACGGT
[0107] GGCTCAACCATCGCAGTGCCTTTGATACTGATGGGCTTGAATCCATTTGAAGTGGG
[0108] CGGAATAAGACAAGTAGCGGTGAAATGCATAGATATGTCTTAGAACTCCGATTGC
[0109] GAAGGCAGCTCACTAAGCTGGTATTGACGCTGATGCACGAAAGCGTGGGGATCGA
[0110] ACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGATAACTCGATGTTGGC
[0111] GATAGACAGCCAGCGTCCAAGCGAAAGCGTTAAGTTATCCACCTGGGGAGTACGC
[0112] CCGCAAGGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAGCA
[0113] TGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTGAAAGTTAGTGAA
[0114] GAGTGCAGAGACGCACTCGTCCTTCGGGACACGAAACTAGGTGCTGCATGGCTGT
[0115] CGTCAGCTTC
Claims
1. A type of Sphingobacterium sp., characterized in that, The preservation number of the *Sphingosine monocytogenes* is CCTCC NO:M 2024175.
2. A microbial inoculant, characterized in that, The microbial agent contains the *Sphingosine monocytogenes* as described in claim 1.
3. A method for degrading aromatic hydrocarbon organic pollutants, characterized in that, The method includes: mixing the *Sphingomonas* of claim 1 or the microbial agent of claim 2 with a liquid containing aromatic hydrocarbon organic pollutants in an inorganic salt liquid culture medium, and then carrying out a degradation reaction.
4. The method according to claim 3, characterized in that, The preparation method of the bacterial agent includes: inoculating Sphingosine Bacillus with preservation number CCTCC NO:M 2024175 into a solid culture medium for culture, and then inoculating the cultured bacterial cells into a liquid culture medium for expansion culture.
5. The method according to claim 4, characterized in that, Based on a volume of 1L, the solid culture medium comprises: 0.5-1g yeast extract, 0.5-1g water-soluble starch, 0.5-1g MgSO4, 0.5-1g tryptone, 0.5-1g glucose, 0.3-0.6g sodium pyruvate, 0.45-0.9g K2HPO4, and 18-20g agar; And / or, based on a volume of 1L, the liquid culture medium comprises: 4-5g of Na2HPO4, 0.8-1.2g of KH2PO4, 2.3-2.8g of (NH3)2SO4, 0.18-0.23g of MgSO4, 0.022-0.24g of CaCl2, and 0.8-1.2mL of trace element stock solution; The trace element mother liquor, with a volume of 1L, comprises: 0.8-1.2 g / L FeSO4, 0.015-0.025 g / L CuSO4, 0.013-0.015 g / L H3BO3, 0.08-0.13 g / L MnSO4, 0.08-0.13 g / L ZnSO4, 0.015-0.025 g / L Na2MoO4, and 0.015-0.025 g / L CoCl2. And / or, the pH of the liquid culture medium is 4-10.
6. The method according to claim 4, characterized in that, The culture temperature is 25-30℃ and the time is 48-72h; and / or the expansion culture temperature is 25-30℃ and the time is 24-36h.
7. The method according to claim 3, characterized in that, During the mixing process, the amount of *Sphingosine monocytogenes* or the bacterial agent used is such that the total viable count relative to 1 mg of aromatic hydrocarbon organic pollutants is (3-10) × 10⁻¹⁰. 4 indivual.
8. The method according to claim 7, characterized in that, During the mixing process, the amount of *Sphingomonas* or the bacterial agent used is such that, relative to 1 mg of aromatic hydrocarbon organic pollutants, the total viable count is (3.4-9.1) × 10⁻⁶. 4 indivual.
9. The method according to claim 3, characterized in that, The degradation reaction is carried out at a temperature of 20-40℃ and at an initial pH of 5-8. And / or, the content of aromatic hydrocarbon organic pollutants in the feed liquid is 100-600 mg / L.
10. The method according to claim 3, characterized in that, The aromatic hydrocarbon organic pollutants in the feed liquid are selected from at least one of the C8 aromatic hydrocarbons.
Citation Information
Patent Citations
Sphingobacterium HY-100C and application thereof
CN115717116A