Rice histone OsHIS3 gene and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and provides a rice histone OsHIS3 gene and application thereof, and the application is that the histone OsHIS3 mutant gene is applied to rice planting. According to the invention, four OsHIS3 mutants are prepared by adopting a gene editing technology, and the influence of the OsHIS3 mutants on rice growth is evaluated; results show that the histone OsHIS3 is located in a cell nucleus, the inorganic phosphorus content of rice leaves is increased by changing genes of a phosphorus signal network after mutation, and growth and development of rice plants are affected.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to histone OsHIS3, specifically to a rice histone OsHIS3 gene and its applications. Background Technology

[0002] Epigenetic regulation plays a crucial role in plant adaptation to biotic and abiotic stresses. Epigenetic regulation is independent of DNA sequence alterations, stably regulating gene expression through DNA methylation and histone modifications. Histone 3 is a key target protein in epigenetic regulation, possessing various modifying enzymes and modification sites, and participating in plant growth, development, and pathogen defense. However, research on its role in plant nutrient stress is limited, as is research on the expression characteristics of histone genes themselves. This invention, by creating an OsHIS3 mutant, elucidates the function of histone OsHIS3 in the adaptation of rice to phosphorus deficiency stress, providing direction for understanding the plant phosphorus deficiency signaling regulatory network and laying the foundation for breeding phosphorus-efficient varieties. Summary of the Invention

[0003] The purpose of this invention is to provide a rice histone OsHIS3 gene and its application. The OsHIS3 mutant gene was applied to rice growth, and it was found that the mutant OsHIS3 affects the growth of rice plants, providing a new approach and means for breeding high-phosphorus rice varieties.

[0004] To achieve the above objectives, the technical solution of the present invention is as follows:

[0005] This invention provides a gRNA of rice histone OsHIS3, the gRNA sequence of which is TCCAGTTCGAACGCTCCCCTCGG.

[0006] This invention also provides a method for constructing a rice histone OsHIS3 gene mutant vector, comprising the following steps:

[0007] a. Design the gRNA of the aforementioned histone OsHIS3;

[0008] b. Use PCR to anneal the primers to form a double strand of DNA;

[0009] c. The vector pRGEB31 was recovered after being digested with BsaⅠ enzyme, and the vector pRGEB31 and the DNA double strand were ligated using T4 ligase;

[0010] d. The ligation product obtained in step c. was transformed with E. coli DH5α, and four OsHIS3 mutants with different editing types were identified.

[0011] Preferably, the PCR system consists of: 1 µL of 100 µM upstream primer, 1 µL of 100 µM downstream primer, 1 µL of 10× T4 DNA ligase Buffer, and 7 µL of ddH2O.

[0012] Preferably, the upstream primer is OsHIS3-gRNA-PF:GGCATCCAGTTCGAACGCTCCCCT, and the downstream primer is OsHIS3-gRNA-PR:AAACAGGGGAGCGTTCGAACTGGA.

[0013] Preferably, the PCR program is as follows: hold at 37°C for 60 min, hold at 95°C for 10 min, and then cool down to 25°C at a cycle rate of -0.1°C / sec.

[0014] Preferably, the identification is a sequencing identification, including sequencing primers OsHIS3-seq-PF:GTTTGAAAACCCACCGCCAC and OsHIS3-seq-PR:TGCAAAGGGGACAAGCAAGA.

[0015] The present invention also provides the application of the above-mentioned gRNA in rice growth.

[0016] The present invention also provides a histone OsHIS3 gene mutation vector obtained by the above construction method.

[0017] The present invention also provides the application of the above-mentioned gRNA in the construction of rice histone OsHIS3 gene mutant vector.

[0018] This invention also provides the application of the above-mentioned histone OsHIS3 gene mutant vector in rice growth.

[0019] The beneficial effects of this invention are:

[0020] This invention uses gene editing technology to prepare four histone OsHIS3 gene mutants. By inducing the expression of OsHIS3 mutants, it was found that histone OsHIS3 is located in the cell nucleus. After OsHIS3 mutation, the inorganic phosphorus content in rice leaves is increased by changing the genes of the phosphorus signaling network, thereby affecting the growth and development of rice plants. Attached Figure Description

[0021] Figure 1This is a subcellular localization map of histone OsHIS3 in rice protoplasts in this invention (A is the localization map of co-expression of empty vector PM999::GFP and nuclear marker; B is the localization map of co-expression of OsHIS3::GFP and nuclear marker; C is the localization map of co-expression of GFP::OsHIS3 and nuclear marker).

[0022] Figure 2 This is the identification of the OsHIS3 mutant editing type in the embodiments of the present invention;

[0023] Figure 3 This invention relates to the phenotypic analysis of the OsHIS3 mutant under normal phosphorus (+P) and phosphorus deficiency (-P) conditions in this embodiment (A is the phenotypic diagram, 1-4 correspond to his3-1, his3-2, his3-3, his3-4, WT is the wild type; B is the plant height; C is the root length; D is the aboveground dry weight; E is the root dry weight; *P<0.05, **P<0.01, ***P<0.001, intergroup comparison).

[0024] Figure 4 The inorganic phosphorus content of leaves and roots of the OsHIS3 mutant under normal phosphorus (+P) and phosphorus deficiency (-P) conditions in this embodiment of the invention is shown in the figures (A represents the phosphorus content of different tissues under normal phosphorus conditions; B represents the phosphorus content of different tissues under phosphorus deficiency conditions; *P<0.05, **P<0.01, intergroup comparison). Detailed Implementation

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0026] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0028] Example 1: Subcellular localization analysis of OsHIS3 protein

[0029] The applicant's team previously used the promoter of a gene specifically induced by phosphorus deficiency in rice roots as bait to screen a yeast single-hybrid library, and screened a histone gene, with the gene number LOC_Os05g41080, named OsHIS3. The function of this gene has not yet been reported.

[0030] Searching for gene ID LOC_Os05g41080 in the Rice Genome Annotation Project (RGAP) database, the CDS sequence of OsHIS3 is as follows: ATGGCTCGCACGAAGCACCCGGCGGTGAGGAAGTCGAAGGCGGAGCCCAAGAAGAAGCTCCAGTTCGAACGCTCCCCTCGGCCGTCGAAGGCGCAGCGCGCTGGTGGCGGCACGGGTACCTCGGCGACCACGAGGAGCGCGCGGCTGGAACATCGGCTTCAGGGACGCCTAGGCAGCAAACGAAGCAGAGGAAGCCACACCGCTTCCGTCCAGGCACAGTGGCA CTGCGGGAGATCAGGAAATTTCAGAAAACCACCGAACTGCTGATCCCGTTTGCACCATTTTCTCGGCTGGTCAGGGAGATCACTGATTTCTATTCAAAGGATGTGTCACGGTGGACCCTTGAAGCTCTCCTTGCAT TGCAAGAGGCAGCAGAATACCACTTAGTGGACATATTTGAAGTGTCAAATCTCTGCGCCATCCATGCTAAGCGTGTTACCATCATGCAAAAGGACATGCAACTTGCCAGGCGTATCGGTGGGCGGAGGCCATGGTGA

[0031] Vector construction: Using cDNA from Nipponbare rice as a template, the CDS sequence of OsHIS3 was amplified by PCR. This CDS sequence was then ligated to the linearized vector PM999::GFP using a seamless cloning kit (ABclonal) to construct the vector OsHIS::GFP or GFP::OsHIS3, fused to the N-terminus or C-terminus of GFP. The vector was then transformed into *E. coli* DH5α strain using the heat shock method. Positive clones were selected for PCR verification, and these clones were sequenced. Plasmids that were correctly identified were then subjected to plasmid extraction and protoplast transformation.

[0032] Protoplast transformation: After dehulling, seeds were sterilized with 75% alcohol, 84 disinfectant, and sterilized water, then sown in rooting tubes containing solid nutrient solution and cultured in the dark at 28℃ for 10-12 days to obtain yellow rice seedlings. Stems and leaf sheaths of the yellow rice seedlings were taken, cut into 0.1-1.0 mm pieces, placed in enzymatic hydrolysate, vacuum-sealed for 30 min, and placed on a shaker at 45 r / min for 4-5 h in the dark. Twice the volume of W5 solution was added, and the enzymatic hydrolysate was filtered through a 400-mesh nylon mesh. Protoplasts were collected by centrifugation at 100 g for 10 min. The supernatant was discarded, 10 mL of W5 solution was added and gently mixed, centrifuged at 100 g for 5 min, and an appropriate volume of MMG solution was added. The mixture was then placed on ice for 30 min. Add 5 µg of plasmids to each 2 mL centrifuge tube, along with 200 µL of protoplasts and 220 µL of 40% PEG solution. Mix gently and incubate at room temperature for 20 min. Terminate the reaction by adding 1 mL of W5 solution. Centrifuge at 100g for 5 min, discard the supernatant, add 1 mL of W5 solution, mix gently, and incubate horizontally in a 28℃ incubator in the dark for 12-15 h. Observe the fluorescence signal in the cells using a laser confocal microscope (Leica). The excitation / emission wavelengths of GFP are 488 nm / 505-545 nm, and the excitation / emission wavelengths of mCherry are 552 nm / 580-645 nm.

[0033] The results are as follows Figure 1 As shown in Figure A, the empty vector is highly expressed in the cell membrane, cytoplasm, and nucleus. Figure 1 B and Figure 1 C shows that the green fluorescence signals of OsHIS3::GFP and GFP::OsHIS3 overlap with the red fluorescence signal of the nuclear marker, indicating that histone OsHIS3 is located in the cell nucleus.

[0034] Example 2: Editing Type Analysis of OsHIS3 Mutants

[0035] Mutant Material Creation: OsHIS3 edited material was created using gene editing technology. First, the OsHIS3 gRNA was designed using the website (http: / / www.genome.arizona.edu / crispr / ). Primers were annealed to form double-stranded DNA using a PCR instrument. The PCR system consisted of 1 µL of 100 µM upstream primer, 1 µL of 100 µM downstream primer, 1 µL of 10× T4 DNA ligase buffer, and 7 µL of ddH2O. The PCR program was: 37℃ for 60 min, 95℃ for 10 min, then decreasing to 25℃ at a rate of -0.1℃ / sec. The sample was diluted 1:200 and stored at 4℃. The vector pRGEB31 was recovered after digestion with BsaI and ligated to the linear vector and double-stranded DNA using T4 ligase. The ligation product was then transformed into *E. coli* DH5α. Plasmids that correctly aligned with sequencing results were transformed into *Agrobacterium* EHA105. Genetic transformation of rice was carried out using Agrobacterium-mediated transgenic technology. The transgenic materials obtained were subjected to molecular detection. The target segment of gRNA was amplified using OsHIS3-specific primers and sequenced. Gene-edited materials were screened and propagated to obtain homozygotes.

[0036] gRNA sequence: TCCAGTTCGAACGCTCCCCTCGG.

[0037] Vector construction primers: OsHIS3-gRNA-PF: GGCATCCAGTTCGAACGCTCCCCT; OsHIS3-gRNA-PR: AAACAGGGGAGCGTTCGAACTGGA.

[0038] Mutant identification sequencing primers: OsHIS3-seq-PF:GTTTGAAAACCCACCGCCAC;

[0039] OsHIS3-seq-PR:TGCAAAGGGGACAAGCAAGA.

[0040] Identification of mutant materials: such as Figure 2 As shown, after sequencing and alignment, four different types of OsHIS3 mutants were finally obtained, including his3-1 with a deletion of 51 bases, his3-2 with a deletion of 6 bases, his3-3 with a deletion of 3 bases, and his3-4 with an insertion of 3 bases.

[0041] Example 3 Phenotypic Analysis of OsHIS3 Mutants

[0042] After germination, rice seeds were cultured in normal nutrient solution for 10 days, followed by normal phosphorus (+P) and phosphorus-deficient (-P) treatments for 15 days. Phenotypic data were recorded by photographing, and plant height and root length were measured. The roots were washed three times with distilled water, and the above-ground parts and roots were sampled separately, bagged, dried, and weighed.

[0043] The results are as follows Figure 3 As shown in the AC (P<0.05, P<0.01, P<0.001), under normal phosphorus conditions, the mutant plant height and root length were significantly shorter than the wild type. Under phosphorus deficiency conditions, there was no difference in plant height, but the mutant root length was also significantly shorter than the wild type. Figure 3 As shown in the DE (P<0.05, P<0.01) results, under both normal phosphorus and phosphorus-deficient conditions, the dry weight of the aboveground parts and roots of the mutant was significantly lower than that of the wild type. This indicates that the OsHIS3 mutation affects the growth and development of rice.

[0044] Example 4: Inorganic phosphorus content analysis of the OsHIS3 mutant

[0045] To verify whether OsHIS3 affects phosphorus content in rice, the inorganic phosphorus content of different tissues in mutant materials under normal phosphorus and phosphorus-deficient conditions was measured. Rice seeds were cultured in normal nutrient solution for 10 days after germination, followed by normal phosphorus (+P) and phosphorus-deficient (-P) treatments for 15 days. Inorganic phosphorus content was measured in different leaves (Leaf 1-3 and Root) and roots. 25 mg of fresh sample was extracted with 25 µL of 5 M H2SO4 and 1.5 mL of pure water, centrifuged at 1000 rpm at 4℃ for 10 min, and the supernatant was diluted a certain factor. This supernatant was then mixed with malachite green working solution at a volume ratio of 1:3 and reacted at room temperature for 30 min. The OD value was measured at 650 nm, and the inorganic phosphorus content of the sample was calculated based on the KH2PO4 standard curve.

[0046] The results are as follows Figure 4 As shown in Figure A (P<0.05, P<0.01), under normal phosphorus conditions, the inorganic phosphorus content of the first, second, and third leaves of mutants his3-3 and his3-4 was significantly higher than that of the wild type. Figure 4 As shown in Figure B (P<0.01), under phosphorus deficiency conditions, the inorganic phosphorus content in the first leaf of mutants his3-2, his3-3, and his3-4 was significantly increased. This indicates that the OsHIS3 mutation increases the inorganic phosphorus content in rice leaves by altering genes in the phosphorus signaling network.

[0047] In summary, this invention has found that histone OsHIS3 is located in the cell nucleus, and mutation of OsHIS3 affects the growth and development of rice plants. By altering the genes of the phosphorus signaling network, it increases the inorganic phosphorus content in rice leaves, providing a theoretical basis for breeding high-phosphorus rice varieties.

[0048] The above-described embodiments are merely preferred embodiments of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. A gRNA of rice histone OsHIS3, characterized in that, The gRNA sequence is TCCAGTTCGAACGCTCCCCTCGG.

2. A method for constructing a rice histone OsHIS3 gene mutant vector, characterized in that, Includes the following steps: a. Design the gRNA of histone OsHIS3 as described in claim 1; b. Use PCR to anneal the primers to form a double strand of DNA; c. The vector pRGEB31 was recovered after being digested with BsaⅠ enzyme, and the vector pRGEB31 and the DNA double strand were ligated using T4 ligase; d. The ligation product obtained in step c. was transformed into E. coli DH5α, and four OsHIS3 mutants with different editing types were identified.

3. The construction method according to claim 2, characterized in that, The PCR annealing system consisted of: 1 µL of 100 µM upstream primer, 1 µL of 100 µM downstream primer, 1 µL of 10× T4 DNA ligase buffer, and 7 µL of ddH2O.

4. The construction method according to claim 2, characterized in that, The upstream primer is OsHIS3-gRNA-PF:GGCATCCAGTTCGAACGCTCCCCT, and the downstream primer is OsHIS3-gRNA-PR:AAACAGGGGAGCGTTCGAACTGGA.

5. The construction method according to claim 2, characterized in that, The PCR program was as follows: hold at 37°C for 60 min, hold at 95°C for 10 min, and then cool down to 25°C at a cycle rate of -0.1°C / sec.

6. The construction method according to claim 2, characterized in that, The identification is a sequencing identification, including sequencing primers OsHIS3-seq-PF:GTTTGAAAACCCACCGCCAC and OsHIS3-seq-PR:TGCAAAGGGGACAAGCAAGA.

7. The application of gRNA in rice cultivation as described in claim 1.

8. The histone OsHIS3 gene mutation vector obtained by any one of the construction methods described in claims 2-6.

9. The application of the gRNA as described in claim 1 in the construction of the rice histone OsHIS3 gene mutant vector.

10. The application of the histone OsHIS3 gene mutation vector as described in claim 8 in rice cultivation.

Images