Crucian circular RNA (Ribonucleic Acid) as well as overexpression vector, preparation method and application thereof

Abstract

The invention discloses a crucian circular RNA (Ribonucleic Acid), an overexpression vector thereof, a preparation method of the overexpression vector and application of the overexpression vector and the overexpression vector. The nucleotide sequence of the crucian circular RNA is shown as SEQ ID NO.1. According to the application, the function of circdmrt1 in testis development of red crucian carp, white crucian carp and filial generation carassius auratus and carassius auratus No.2 is completely elaborated for the first time, it is clear that circdmrt1 can inhibit cell apoptosis and promote cell proliferation to participate in testis development, a circdmrt1 overexpression vector is provided, and a foundation is laid for application of a circdmrt1 preparation in aquatic product breeding in the future.

Description

Technical Field

[0001] This invention relates to the field of bioengineering, and more particularly to a circular RNA from crucian carp. Background Technology

[0002] Red carp ( red Carassius auratus Red crucian carp (Crucian carp) are bony fish with muscles rich in amino acids and trace elements. Their bright red color makes them valuable for both ornamental and edible purposes. Furthermore, their strong resistance to disease and ease of cultivation make them popular among aquarium enthusiasts and fish farmers. Based on the genetic advantages of red crucian carp, aquaculture breeders have created several new germplasm through distant hybridization. Examples include the hybrid offspring *Hefangji* (WR), obtained by crossing white crucian carp (WCC, ♀) with red crucian carp (RCC, ♂), and *Hefangji* No. 2 (WRII), obtained by crossing WR (♀) with WCC (♂). These offspring significantly outperform their parents in growth rate, disease resistance, and ecological adaptability, and have high nutritional value in their muscle. They are now widely farmed in various provinces. However, despite significant breakthroughs in artificial breeding techniques and reproductive regulation of red crucian carp, reproductive dysfunction frequently occurs in production practice, significantly impacting fry production and the healthy development of the aquaculture industry. Therefore, in-depth research into the reproductive regulation of red crucian carp and its *Hefangji* strain has significant economic and practical value.

[0003] circRNAs are a class of novel non-coding RNA molecules formed by backsplicing of source genes, characterized by closed circular structures, poor degradation, and widespread distribution in eukaryotes. They exhibit tissue-, time-, and disease-specific properties, as well as high species conservation. Numerous studies have shown that circRNAs play crucial roles in biological processes such as reproduction, development, and innate immunity. They can act as competitive endogenous RNAs (ceRNAs) to adsorb specific miRNAs, directly participate in protein translation, and form complex interaction networks with RNA-binding proteins or other non-coding RNAs. In recent years, with the development and application of high-throughput technologies, circRNAs have been found to be prevalent in an increasing number of species. However, they have been rarely reported in the aquaculture industry. Therefore, combined with research on the molecular mechanisms of circRNAs, the in vitro preparation of circRNAs holds great promise for applications in aquaculture. Summary of the Invention

[0004] This invention provides a crucian carp circular RNA, the corresponding siRNA, an RNA overexpression vector, its preparation method, and its application, in order to solve the technical problems mentioned in the background art.

[0005] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows: A circular RNA from crucian carp, the nucleotide sequence of which is shown in SEQ ID NO.1, is named circdmrt1.

[0006] The sequence of SEQ ID NO.1 is: ATGCCTAGTGGAAATGGTCGCCTGTCCAGCCATAACGTGTCCCCCCAGTACCGCACACACTCCTACTATTCCTCTTACCTGAGTCAGGGGCTCGGCACGACTGCATGTGTGCCCCCCAGCACCTGCCCTGAACCCAAAGCAGCAG.

[0007] Based on the same technical concept, the present invention also provides a siRNA corresponding to the above-mentioned crucian carp circular RNA, the nucleotide sequence of which is shown in SEQ ID NO.2 or SEQ ID NO.3, and the corresponding siCtrl nucleotide sequence is shown in SEQ ID NO.4.

[0008] The sequence of SEQ ID NO.2 is: CACUAGGCAUCUGCUGUUTT.

[0009] The sequence of SEQ ID NO.3 is: AGGCAUCUGCUGCUUUGGGTT.

[0010] The sequence of SEQ ID NO.4 is: siCtrl: ACGUGACACGUUCGGAGAATT.

[0011] Based on the same technical concept, the present invention also provides an RNA overexpression vector comprising the above-mentioned crucian carp circular RNA.

[0012] Based on the same technical concept, the present invention also provides a method for preparing the above-mentioned RNA overexpression vector, comprising the following operations: A circular RNA sequence from crucian carp was synthesized. The synthesized circular RNA sequence included the dmrt1 exon 4 sequence and intron sequences at both ends. Then, circular-promoting sequences were added to both ends. The nucleotide sequence of the synthesized circular RNA sequence is shown in SEQ ID NO.5. The circular RNA was ligated to a vector to obtain the RNA overexpression vector.

[0013] The sequence of SEQ ID NO.5 is: .

[0014] As a further preferred embodiment of the above technical solution, the vector is a pcDNA3.1(+) vector, and the synthesized crucian carp circular RNA sequence is linked between the restriction enzyme sites KpnI and BamHI of the vector.

[0015] Based on the same technical concept, the present invention also provides the application of the above-mentioned crucian carp circular RNA or RNA overexpression vector in promoting the gonadal development of crucian carp.

[0016] As a further preferred embodiment of the above technical solution, the crucian carp circular RNA or the RNA overexpression vector is used to promote the development of crucian carp testes.

[0017] Based on the same technical concept, the present invention also provides the application of the above-mentioned crucian carp circular RNA or RNA overexpression vector in the preparation of vaccines and nucleic acid drugs during fish farming.

[0018] The present invention has the following beneficial effects: This invention is the first to fully elucidate the promoting effect of circdmrt1 on the testis development of red crucian carp, white crucian carp and their offspring Hefang crucian carp and Hefang crucian carp No. 2, and clarifies that circdmrt1 can inhibit apoptosis and promote cell proliferation to participate in testis development. It also provides an overexpression vector for circdmrt1, laying the foundation for the future application of its preparations in aquatic breeding. Attached Figure Description

[0019] Figure 1 This section describes the characterization of circRNA in the testes of red crucian carp in Example 1. A represents the formation of the circular RNA circdmrt1 from the reverse splicing of exon 4 of the Dmrt1 gene; B shows the PCR amplification of circdmrt1 using specific primers and the Sanger sequencing of the related PCR products; C shows the RNase R resistance detection of circdmrt1; and D shows the relative expression level of circdmrt1 at different testicular developmental stages in red crucian carp.

[0020] Figure 2 The in vivo interference effect of circdmrt1 in Example 2 is shown in A, where A represents the effect of intracellular siRNA interference; and B represents the in vivo interference effect of circdmrt1 and its influence on apoptosis.

[0021] Figure 3 The effect of the circdmrt1 overexpression vector on testicular development in Example 3 is shown in Figure A, where A represents the expression status of the synthesized circdmrt1 overexpression vector and the detection results on cell proliferation capacity; B represents the effect of circdmrt1 overexpression on the expression of apoptosis genes.

[0022] Figure 4 This section presents the genetic characteristics analysis of circdmrt1 in Example 4. A represents the identification of circdmrt1 in the testes of white crucian carp and its offspring, Hefang crucian carp and Hefang crucian carp No. 2; B represents the sequence alignment of circdmrt1 in the testes of white crucian carp and its offspring, Hefang crucian carp and Hefang crucian carp No. 2. Detailed Implementation The embodiments of the present invention will be described in detail below with reference to the accompanying drawings, but the present invention can be implemented in many different ways as defined and covered by the claims.

[0023] Example 1: This embodiment describes the molecular identification and detection of circular RNA circdmrt1 during the testicular development of red crucian carp: First, by comparing the red crucian carp genome, it was found that the source gene of the circular RNA circdmrt1, Dmrt1, is located on chromosome 5 (e.g., Figure 1As shown in Figure A), genomic DNA (gDNA) and total RNA (Total RNA) were extracted from the testes of red crucian carp and reverse transcribed into cDNA. Then, using gDNA and cDNA as templates, circdmrt1 and dmrt1 mRNA were amplified by PCR. The relevant primer sequences and amplification reaction systems are shown in Tables 1 and 2. Experimental results verified the existence of circdmrt1, and Sanger sequencing confirmed its single and successful crossing of the circdmrt1 splice site (e.g., [missing information]). Figure 1 As shown in B).

[0024] Stability of circular RNA circdmrt1: Total RNA extracted was digested with RNase R in a 37°C water bath for 30 min, followed by heating at 70°C for 10 min to inactivate RNase R. Subsequently, circdmrt1 and dmrt1 mRNA were amplified using RT-qPCR (related amplification reaction systems are shown in Table 3) with cDNA as a template. The primers used are shown in Table 1 below. The results are as follows: Figure 1 As shown in Figure C, dmrt1 mRNA exhibits low stability after RNase R digestion, while circdmrt1 shows high resistance to RNase R. Total RNA was extracted from testicular tissues at different time points and reversed into cDNA, and circdmrt1 expression was detected using RT-qPCR. The results are shown below. Figure 1 As shown in D, circdmrt1 expression is highly positively correlated with the degree of testicular development in red crucian carp.

[0025] The results of this embodiment demonstrate that circdmrt1 is a stable circular RNA that is positively correlated with testicular development.

[0026] Table 1. This invention relates to relevant primer sequences.

[0027] Table 2 PCR amplification system of Example 1

[0028] Table 3. qPCR amplification system for Registration Example 1

[0029] Example 2: This invention specifically designed two siRNAs (siRNA1 and siRNA2, sequences shown in SEQ ID NO.2 and SEQ ID NO.3) targeting the circdmrt1 expression sequence of red crucian carp, and transfected them into HEK293T cells overexpressing circdmr1. A control group transfected with the blank vector si-Ctrl (sequence shown in SEQ ID NO.4) was used. RNA was harvested 48 h after transfection, and the knockdown effect of the siRNAs was identified using RT-qPCR. The results are as follows: Figure 2 As shown in Figure A, HEK293T cells treated with siRNA showed significantly low expression of circdmrt1, proving the successful design of the siRNA.

[0030] Five-month-old red crucian carp were selected for an in vivo injection experiment. The specific steps are as follows: (1) Three days before the experiment, 12 male red crucian carp with good physical condition and uniform size were selected from the pond and placed in net cages for transition. They were randomly divided into 4 groups and labeled as siCtrl1, siCtrl2, siRNA1 and siRNA2.

[0031] (2) Each fish was injected with 10 μg siRNA in a volume of 100 μL. The siRNA was diluted with physiological saline and injected intraperitoneally.

[0032] (3) Observe the mental state and vitality of the red crucian carp daily after injection for 3 consecutive days. On the 4th day, sacrifice the red crucian carp for dissection. Extract total RNA from the testes of the red crucian carp and reverse it to cDNA for RT-qPCR detection to identify the in vivo interference effect of circdmrt1 (e.g., Figure 2 As shown in B).

[0033] Experimental results are as follows Figure 2 As shown in Figure B, circdmrt1 was significantly knocked down in the testes of the siRNA-injected group, and this interference effect was statistically significant. Simultaneously, it was determined that in vivo knockdown of circdmrt1 significantly affected testicular cell apoptosis. Figure 2 B). Therefore, it can be clearly seen that circdmrt1 is an important molecule regulating the development of the testes of red crucian carp, and is an important target for regulating the reproductive development of red crucian carp.

[0034] Example 3: This embodiment constructed an overexpression vector for the crucian carp circular RNA circdmrt1. The specific method was as follows: First, a circdmrt1 sequence was synthesized, consisting of the dmrt1 exon 4 sequence plus intron sequences at both ends, followed by circularization sequences added to both ends. The sequence was digested with KpnI and BamHI and ligated into the pCDNA3.1+ vector. The synthesized circdmrt1 nucleotide sequence is shown in SEQ ID NO. 5. This overexpression vector was transfected into HEK293T cells using lipo3000. After 24 h, total RNA was extracted using Trizol and reverse transcribed into cDNA. The expression level of circdmrt1 was detected using RT-qPCR, and the results are shown below. Figure 3 As shown in Figure B, compared with the control, the expression level of circdmrt1 in the experimental wells increased significantly, proving that the circdmrt1 overexpression vector was successfully constructed.

[0035] Two experimental groups were set up: (1) NC group: Cells were transfected with pcDNA 3.1 (+) empty vector; (2) OE-circdmrt1: circdmrt1 overexpression vector group constructed by cell transfection.

[0036] The transfection systems are shown in Tables 4 and 5.

[0037] Table 4. Transfection system 1 of Example 3

[0038] Table 5. Transfection system 2 of Example 3

[0039] After preparing the respective systems, let them stand at room temperature for 5 min, then mix systems 1 and 2 together, let them stand at room temperature for 15 min, and then add them dropwise to HEK293T cells at a density of approximately 70%. 24 h after transfection, CCK-8 assays were performed on the cells. The results showed that, compared to the NC group, the cell proliferation rate steadily increased with the enhancement of circdmrt1 expression. Figure 3 A). RNA was extracted using the Trizol method and reverse transcribed into cDNA. RT-qPCR was then performed to detect the expression of relevant apoptosis genes, and the results are as follows: Figure 3 As shown in B, compared with the NC group, overexpression of circdmrt1 significantly inhibited apoptosis.

[0040] The results of this embodiment indicate that in vitro application of circdmrt1 can promote cell proliferation efficiency.

[0041] Example 4: This embodiment studies the genetic characteristics of the crucian carp circular RNA circdmrt1 in a hybrid strain: During the breeding season, high-quality red crucian carp (RCC) were used as the male parent and white crucian carp (WCC) as the female parent to crossbreed, resulting in the offspring of hybrid crucian carp (WR). Then, hybridization was performed using WR as the female parent and white crucian carp as the male parent, resulting in the offspring of hybrid crucian carp 2 (WRII). To investigate the genetic characteristics of circdmrt1 in the crucian carp hybrid strain, specific circdmrt1 primers were used, and the hybrid offspring were used as templates for amplification. Sanger sequencing identified that circdmrt1 was stably present in the testis tissues of white crucian carp, WR, and WRII (e.g., ...). Figure 4 As shown in A), and through sequence alignment, it was found that the circular sequence of Hefangji No. 2 is completely consistent with the sequences of Red Crucian Carp and White Crucian Carp (as shown in A). Figure 4 (As shown in B). It can be seen that circdmrt1 has paternal inheritance characteristics in the hybrid crucian carp strain.

[0042] The above description is merely a preferred embodiment of the present invention, and the scope of protection of the present invention is not limited to the above embodiments. For those skilled in the art, improvements and modifications obtained without departing from the inventive concept should also be considered within the scope of protection of the present invention.

[0043] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A crucian carp circular RNA, characterized in that, The nucleotide sequence is shown in SEQ ID NO.

1.

2. An RNA overexpression vector, characterized in that, The RNA overexpression vector comprises the crucian carp circular RNA as described in claim 1.

3. A method for preparing the RNA overexpression vector according to claim 2, characterized in that, Includes the following operations: A circular RNA sequence from crucian carp was synthesized. The synthesized circular RNA sequence included the dmrt1 exon 4 sequence and intron sequences at both ends. Then, circular-promoting sequences were added to both ends. The nucleotide sequence of the synthesized circular RNA sequence is shown in SEQ ID NO.

5. The circular RNA from crucian carp was ligated into a vector to obtain the RNA overexpression vector.

4. The method for preparing the RNA overexpression vector according to claim 3, characterized in that, The vector is a pcDNA3.1(+) vector, and the synthesized crucian carp circular RNA sequence is ligated between the KpnI and BamHI restriction sites of the vector.

5. The application of the crucian carp circular RNA of claim 1 or the RNA overexpression vector of claim 2 in promoting the gonadal development of crucian carp.

6. The application according to claim 5, characterized in that, The crucian carp circular RNA or the RNA overexpression vector is used to promote crucian carp testis development.

7. The application of the crucian carp circular RNA of claim 1 or the RNA overexpression vector of claim 3 in the preparation of vaccines and nucleic acid drugs during fish farming.

Images