Apple lncRNA30130 gene and application of apple lncRNA30130 gene in regulation and control of plant wax biosynthesis
By overexpressing or silencing the apple lncRNA30130 gene, the biosynthesis of plant waxes was regulated, which solved the problem of insufficient research on wax synthesis in apple fruits and leaves, improved fruit quality and stress resistance, and provided genetic resources and technical support.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- QINGDAO AGRI UNIV
- Filing Date
- 2026-01-23
- Publication Date
- 2026-04-24
AI Technical Summary
There is a lack of research on genes involved in the synthesis of waxes in apple fruits and leaves in existing technologies, which affects the improvement of fruit quality and stress resistance.
We provide the apple lncRNA30130 gene and its related recombinant vectors, and regulate plant wax biosynthesis by overexpressing or silencing this gene to increase or decrease wax content.
It increases the wax content of apple plants, improves fruit quality and stress resistance, provides important genetic resources and technical support, and has significant economic and social benefits.
Smart Images

Figure CN121915032A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to an apple lncRNA30130 gene and its application in regulating plant wax biosynthesis. Background Technology
[0002] Apples are a widely cultivated economic crop globally, playing a vital role in increasing fruit growers' income and rural economic development. The quality of the fruit directly impacts its economic value and growers' income. The waxy coating on the apple peel acts as a protective barrier, significantly contributing to improved fruit quality and resistance to disease.
[0003] Fruit wax acts as a natural protective barrier. On one hand, it effectively reduces water loss, maintains fruit freshness and plumpness, and minimizes post-harvest shriveling and drying caused by water loss, significantly extending shelf life. On the other hand, the dense waxy layer resists pathogen infection, blocks the attachment and invasion of harmful microorganisms, reduces post-harvest rot, ensures fruit quality, and minimizes economic losses. For leaves, sufficient and appropriate wax content helps regulate stomatal conductance, optimizes water use efficiency, and enables leaves to maintain normal photosynthesis and physiological metabolism under adverse conditions such as drought or high temperatures. Moreover, wax can reflect some strong light, reducing photoinhibition damage to leaves, enhancing the overall stress resistance of apple plants, ensuring healthy tree growth, and laying the foundation for high-quality and high-yield fruit. However, excessive wax can also affect the appearance of the fruit, reducing consumer willingness to buy. Excessive wax content in leaves may also hinder the normal opening and closing of stomata, affecting normal plant growth. Therefore, regulating the wax content of plants is of great significance in ensuring normal plant growth and improving plant economic benefits.
[0004] Previous studies have focused on various factors affecting apple growth and development, while also exploring key functional genes that can specifically increase the wax content of apple fruits and leaves. It is currently known that the synthesis of plant waxes involves a series of complex biochemical pathways regulated by multiple genes. However, research on genes that enhance wax content in apple fruits and leaves is limited. Therefore, in-depth exploration and analysis of related functional genes are of great significance for revealing the mechanism of apple wax synthesis, optimizing apple quality, and enhancing stress resistance. Summary of the Invention
[0005] The purpose of this invention is to provide an apple lncRNA30130 gene and its application in regulating plant wax biosynthesis, thereby addressing the problems existing in the prior art. This invention has found that the lncRNA30130 gene plays a crucial role in regulating wax synthesis in apple fruits and leaves. Overexpression of the lncRNA30130 gene can increase the wax content of apple plants, while silencing or inhibiting its expression can reduce the wax content. This invention provides important genetic resources and technical support for improving fruit quality and enhancing stress resistance in fruit trees, and has significant economic and social benefits for improving fruit quality.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] This invention provides an apple lncRNA30130 gene, the nucleotide sequence of which is shown in SEQ ID NO.3.
[0008] The present invention also provides a recombinant vector containing the above-mentioned apple lncRNA30130 gene.
[0009] The present invention also provides a recombinant vector that silences or interferes with the above-mentioned apple lncRNA30130 gene.
[0010] The present invention also provides a recombinant microorganism comprising the above-described recombinant vector.
[0011] The present invention also provides the application of the above-mentioned apple lncRNA30130 gene, the above-mentioned recombinant vector, or the above-mentioned recombinant microorganism in regulating plant wax biosynthesis.
[0012] Furthermore, the regulation method is to increase the wax content of plants by overexpressing the apple lncRNA30130 gene in plants; or to decrease the wax content of plants by silencing or interfering with the expression of the apple lncRNA30130 gene in plants.
[0013] Optionally, the plant may include apples.
[0014] The present invention also provides a method for regulating plant wax biosynthesis, comprising the step of overexpressing the apple lncRNA30130 gene in a plant to increase the wax content in the plant;
[0015] Alternatively, it may include the step of silencing or interfering with the expression of the apple lncRNA30130 gene in plants to reduce the wax content in said plants;
[0016] The nucleotide sequence of the apple lncRNA30130 gene is shown in SEQ ID NO.3.
[0017] Optionally, the plant may include apples.
[0018] The present invention discloses the following technical effects:
[0019] This invention isolated a transcription factor, lncRNA30130, from apple. Analysis revealed differential expression of the lncRNA30130 gene during fruit development. Further experiments using apple transient injection and transgenic methods confirmed that the lncRNA30130 gene plays a crucial role in regulating wax synthesis in apple fruits and leaves. Overexpression of lncRNA30130 increased the wax content of apple plants, while silencing or inhibiting its expression reduced the wax content. This invention elucidates the mechanism of plant wax synthesis, providing important genetic resources and technical support for improving fruit quality and enhancing stress resistance in fruit trees, thus offering significant economic and social benefits. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 The results are the electrophoretic detection results of the lncRNA30130 gene PCR products; lane M is DL2000, and lanes 1-3 are all lncRNA30130 gene PCR products.
[0022] Figure 2 The structural map of the overexpression vector lncRNA30130-pRI101E;
[0023] Figure 3 The results of transient overexpression of the lncRNA30130 gene are for functional validation. A represents the fruit phenotype of lncRNA30130-pRI101E apples and pRI101E apples; B represents the wax content in the peel of lncRNA30130-pRI101E apples and pRI101E apples; C represents the expression levels of wax synthesis-related genes in the fruits of lncRNA30130-pRI101E apples and pRI101E apples.
[0024] Figure 4This is the result of functional validation of the transiently silenced lncRNA30130 gene; where A represents the fruit phenotype of lncRNA30130-pTRV2 apple and pTRV2 apple; B represents the wax content in the peel of lncRNA30130-pTRV2 apple and pTRV2 apple; and C represents the expression level of wax synthesis-related genes in the fruits of lncRNA30130-pTRV2 apple and pTRV2 apple.
[0025] Figure 5 The results show the detection of lncRNA30130 overexpressing apple tissue culture seedlings; where A represents the leaf phenotype of wild-type and lncRNA30130 overexpressing apple tissue culture seedlings; B represents the leaf wax content of wild-type and lncRNA30130 overexpressing apple tissue culture seedlings; and C represents the expression level of wax synthesis-related genes in wild-type and lncRNA30130 overexpressing apple tissue culture seedlings.
[0026] Figure 6 The results of detection of lncRNA30130 interference in apple tissue culture seedlings are shown. Among them, A represents the leaf phenotype of wild-type and lncRNA30130 interference apple tissue culture seedlings; B represents the leaf wax content of wild-type and lncRNA30130 interference apple tissue culture seedlings; and C represents the expression level of wax synthesis-related genes in wild-type and lncRNA30130 interference apple tissue culture seedlings. Detailed Implementation
[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0028] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0029] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0030] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.
[0031] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0032] The research approach of this invention is as follows:
[0033] This invention, through sequencing analysis of lncRNAs in Fumei apple fruits, identified a differentially expressed lncRNA gene, 30130. During fruit development, the expression level of lncRNA 30130 significantly increased during the developmental stage. Based on this, the present invention investigates the function of the lncRNA 30130 gene through the following embodiments.
[0034] Example 1: Cloning of the apple lncRNA30130 gene
[0035] 1. RNA extraction and reverse transcription from Fumei apple fruit
[0036] 1.1 Extraction of total RNA from plants
[0037] The total RNA content of apple fruit samples was extracted using the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (Tiangen Biotech Co., Ltd.). The specific steps are as follows:
[0038] 1) Grind 50-100 mg of fruit peel into powder rapidly in liquid nitrogen, add 500 μL of lysis buffer SL, and immediately vortex vigorously to mix.
[0039] 2) Centrifuge at 12000 rpm for 2 min.
[0040] 3) Transfer the supernatant to the CS filter column in the collection tube, centrifuge at 12000 rpm for 2 min, and carefully aspirate the supernatant from the collection tube into a new RNase-free centrifuge tube, avoiding contact between the pipette tip and cell debris in the collection tube as much as possible.
[0041] 4) Slowly add 0.4 times the volume of supernatant in anhydrous ethanol, mix well, and transfer the resulting solution and precipitate into the adsorption column CR3. Centrifuge at 12000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.
[0042] 5) Add 350 μL of protein removal solution RW1 to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.
[0043] 6) Preparation of DNase I working solution: Take 10 μL of DNase I stock solution and put it into a new RNase-Free centrifuge tube. Add 70 μL of RDD buffer and mix gently.
[0044] 7) Add 80 μL of DNase I working solution to the center of the adsorption column CR3 and let it stand at room temperature for 15 min.
[0045] 8) Add 350 μL of protein removal solution RW1 to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.
[0046] 9) Add 500 μL of washing solution RW to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.
[0047] 10) Repeat step 9).
[0048] 11) Centrifuge at 12000 rpm for 2 min. Transfer the adsorption column CR3 to a new RNase-Free centrifuge tube. Add 30-50 μL of RNase-Free ddH2O dropwise to the center of the adsorption membrane. Incubate at room temperature for 2 min, then centrifuge at 12000 rpm for 1 min to obtain the RNA solution. Store at -80℃. Before storage, check the integrity of the RNA using agarose gel electrophoresis and determine the RNA concentration using an Agilent 2100 bioanalyzer (Santa Clara, California, USA).
[0049] 1.2 RNA reverse transcription into cDNA
[0050] RNA was reverse transcribed using the HiScript II Q RT SuperMix for qPCR kit (Vazyme, Nanjing). The specific steps are as follows:
[0051] 1) Genomic DNA removal
[0052] Prepare the following mixture in an RNase-free centrifuge tube: 4 × g DNA wiper mix 4 μL, template RNA 1 pg-1 μg, and RNase-free ddH2O to a final volume of 16 μL; gently mix by pipetting. Incubate at 42°C for 2 min.
[0053] 2) Preparation of reverse transcription reaction system
[0054] Add the following reagents to the reaction tube in step 1: 4 μL of 5 × HiScript II qRT SuperMix II and 16 μL of the reaction solution from step 1. Gently mix by pipetting.
[0055] 3) Perform reverse transcription: 50℃ for 15 min, 85℃ for 5 s. Obtain the reverse transcription product cDNA. The product can be used immediately for qPCR, or stored at -20℃ and used within six months. Avoid repeated freeze-thaw cycles on the cDNA.
[0056] 2. Cloning of the full-length lncRNA30130 gene
[0057] Using cDNA from Fumei apple fruits as a template, amplification was performed using Phanta Max Super-Fidelity DNA Polymerase (P505) (Vazyme, Nanjing). The upstream and downstream primers for lncRNA30130 are as follows:
[0058] lncRNA30130-F:
[0059] TGATACATATGCCCGTCGACAAACTCGATATCCTGACCAATAAA (SEQ ID NO. 1);
[0060] lncRNA30130-R:
[0061] CCCTTGCTCACCATGGATCCAGTATACATGATGACAACTTATAGTTGAATATC (SEQ ID NO. 2).
[0062] The amplification steps are as follows:
[0063] 1) PCR reaction system
[0064] Upstream primer (10 μM) 2.5 μL, downstream primer (10 μM) 2.5 μL, 2 × Phanta Max Buffer 25 μL, template DNA x μL, ddH2O to bring the total to 50 μL.
[0065] The template usage amounts are: 50-400 ng genomic DNA, 10 pg-30 ng plasmid or viral DNA, and 1-5 μL cDNA (not exceeding 1 / 10 of the total PCR reaction volume).
[0066] 2) PCR reaction program: 95℃ pre-denaturation for 3 min; cycling parameters: 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 70 s, for 35 cycles; 72℃ extension for 5 min.
[0067] After the PCR reaction is complete, the PCR products are detected by electrophoresis, such as... Figure 1 As shown, a 1430 bp PCR product was obtained. The PCR product was recovered, ligated into the cloning vector PLB, transformed into *E. coli* DH5α, plated on LB agar medium supplemented with 50 mg / L ampicillin, and incubated overnight at 37°C. Single colonies were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were compared with the JGI database (https: / / phytozome-next.jgi.doe.gov) using BLAST to ensure sequence consistency. The full-length lncRNA30130 gene is 1430 bp, and its nucleotide sequence is shown in SEQ ID NO.3.
[0068] SEQ ID NO.3:
[0069]
[0070] Example 2 Construction of lncRNA30130 gene-related vector
[0071] 1. Construction of overexpression vectors
[0072] Using the full-length lncRNA30130 gene sequence obtained in Example 1 as a template, amplification was performed using a primer pair (SQE ID NO. 1-2) with BamHI and SalI restriction sites. Then, following the gene cloning method in "2. Cloning of the full-length lncRNA30130 gene" in Example 1, the amplification product was ligated into the intermediate vector PLB to obtain the fusion plasmid lncRNA30130-PLB.
[0073] The empty vector pRI101E and the fusion plasmid lncRNA30130-PLB were digested with restriction endonucleases BamHI and Sal I, respectively. Agarose gel electrophoresis and gel recovery were then performed. The linear pRI101E vector and the target gene lncRNA30130 fragment were ligated using T4-DNA ligase. The ligation product was transformed into *E. coli* DH5α. From single colonies with correct sequencing, the recombinant plasmid lncRNA30130-pRI101E was extracted, which is the overexpression vector containing the lncRNA30130 gene (vector map shown). Figure 2 ).
[0074] 2. Construction of interference vectors
[0075] To investigate the function of the lncRNA30130 gene, silencing and interference vectors for the lncRNA30130 gene were constructed. The silencing and interference vectors were constructed using a specific fragment of the lncRNA30130 gene, cloned according to the method described in Example 1, Section 2, "Cloning of the Full-Length lncRNA30130 Gene". The specific fragment is 400 bp in length, and its nucleotide sequence is shown in SEQ ID NO.4.
[0076] SEQ ID NO.4:
[0077] AAACTCGATATCCTGACCAATAAACCCCTTCCTTCTAACCCTATTTTCCTTTCTAGCGCATATCTTCACTACCGCACAACAAACTACTCTCTCTCTCTCTCGCTCTCTCGTCTGATCGATCTGTCTTGAATCTTGGTGTCCTAATCTTAGCTAGACAAACCGAGAAATTTACACAGGCCTCTAGCTACAAGCTAAGAT GCATAAATAACACAAGTAGTTCGAGCTCAGGATTAAAGGTGGATCGGAGGCATGGAAAACGCCCGCTTCCTTCAGAAGCATCAGAGGAGAAAGAGAGGGAGGATCGTCCCCACCACCATGATTTCCCTTCTGACTACGAATCTTCCTGGACGGAAGCTGGCATGTCAGCCATGGTTTCTGCTCTCACTCAAGATTGGAAC.
[0078] Using a specific fragment of the lncRNA30130 gene as a template, amplification was performed using primer pairs (SEQ ID NO. 5-6) containing Spe I and BamHI restriction sites. Then, following the gene cloning method described in Example 1, "2. Cloning of the full-length lncRNA30130 gene," the amplified product was ligated into the intermediate vector PLB to obtain the fusion plasmid lower-lncRNA30130-PLB. The amplification primer sequences are as follows:
[0079] lncRNA30130-RNAi-Spe IF:ACTAGTAAACTCGATATCCTGACCAATAAA (SEQ ID NO.5);
[0080] lncRNA30130-RNAi-BamH IR: GGATCCGTTCCAATCTTGAGTGAGAGCA (SEQ ID NO. 6).
[0081] Using the lncRNA30130 gene-specific fragment as a template, amplification was performed using primer pairs (SEQ ID NO. 7-8) with Asc I and Swa I restriction sites. Then, following the gene cloning method described in Example 1, "2. Cloning of the full-length lncRNA30130 gene," the amplified product was ligated into the intermediate vector PLB to obtain the fusion plasmid -lncRNA30130-PLB. The amplification primer sequences are as follows:
[0082] lncRNA30130-RNAi-Asc IF: GGCGCGCCAAACTCGATATCCTGACCAATAAA (SEQ IDNO.7);
[0083] lncRNA30130-RNAi-Swa I -R: ATTTAAATGTTCCAATCTTGAGTGAGAGCA (SEQ ID NO. 8).
[0084] The empty vector pFGC1008 and the lower-lncRNA30130-PLB were digested with restriction endonucleases Spe I and BamHI, respectively, followed by agarose gel electrophoresis and gel recovery. The linear pFGC1008 vector and the target gene lncRNA30130 fragment were ligated using T4-DNA ligase. The ligation product was transformed into E. coli DH5α. The recombinant plasmid lower-lncRNA30130-pFGC1008 was extracted from single colonies with correct sequencing.
[0085] Next, the lower-lncRNA30130-pFGC1008 and upper-lncRNA30130-PLB were digested with restriction endonucleases Asc I and Swa I, respectively, followed by agarose gel electrophoresis and gel recovery. The linear pFGC1008 vector and the target gene lncRNA30130 fragment were ligated using T4-DNA ligase. The ligation product was transformed into E. coli DH5α. For single colonies with correct sequencing, the recombinant plasmid lncRNA30130-pFGC1008 was extracted, which is the interference vector.
[0086] 3. Construction of viral silencing vector
[0087] Using the lncRNA30130 gene-specific fragment as a template, amplification was performed using primer pairs (SEQ ID NO. 9-10) containing BamHI and XhoI restriction sites. Then, following the gene cloning method described in Example 1, "2. Cloning of the full-length lncRNA30130 gene," the amplified product was ligated into the intermediate vector PLB to obtain the fusion plasmid lncRNA30130-VIGS-PLB. The amplification primer sequences are as follows:
[0088] pTRV2-lncRNA30130(BamH I)-F: GGATCCGTTCCAATCTTGAGTGAGAGCA (SEQ IDNO.9);
[0089] pTRV2-lncRNA30130(Xho I)-R: CTCGAGAAACTCGATATCCTGACCAATAAA (SEQ ID NO. 10).
[0090] The empty vector pTRV2 and lncRNA30130-VIGS-PLB were digested with restriction endonucleases BamHI and XhoI, respectively, followed by agarose gel electrophoresis and gel recovery. The linear pTRV2 vector and the specific fragment of the target gene lncRNA30130 were ligated using T4-DNA ligase. The ligation product was transformed into E. coli DH5α. The recombinant plasmid lncRNA30130-pTRV2 was extracted from single colonies with correct sequencing, which is the viral silencing vector.
[0091] The two recombinant plasmids, lncRNA30130-pRI101E and lncRNA30130-pTRV2, were transformed into Agrobacterium GV3101 using the freeze-thaw method. The recombinant plasmid lncRNA30130-pFGC1008 was transformed into Agrobacterium LBA4404 using electroporation.
[0092] Example 3: Transient conversion and functional verification of lncRNA30130 gene
[0093] I. Functional verification of overexpression of lncRNA30130 gene
[0094] 1. Transient conversion of overexpression vectors
[0095] 1) Centrifuge the lncRNA30130-pRI101E vector bacterial culture, which has been cultured until golden yellow, at 20℃ for 10 min at 5000 rpm and discard the supernatant.
[0096] 2) Resuspend the bacterial cells with ddH2O, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.
[0097] 3) Resuspend the bacterial cells in 10mM MgCl2, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.
[0098] 4) 10 mM MgCl2 suspension of bacterial cells, adjusting OD 600nm =0.6-0.8.
[0099] 5) Add 10 mM MES and 150 mM acetylsuccinone (AS).
[0100] 6) After standing in the dark for 2-3 hours, inject apple fruits and observe the phenotype after 3-5 days.
[0101] 7) Following steps 1) to 6), inject the empty vector pRI101E into apple fruits and observe the phenotype after 3-5 days.
[0102] 2. Observation of apple fruit phenotype and analysis of wax components
[0103] 2.1 Photographs of apple fruit morphology
[0104] Apple fruits from the experimental group (lncRNA30130-pRI101E) and the control group (pRI101E) were placed in a small photography studio, and photographs were taken with a camera pointing directly at the injection holes. Clear injection holes were observed on the surface of the fruits in both groups. The phenotypes of the pRI101E and lncRNA30130-pRI101E apple fruits are as follows: Figure 3 As shown in Figure A.
[0105] 2.2 Analysis of wax components
[0106] The fruit slices were immersed in chloroform, and the extracts were concentrated and combined using a rotary evaporator under a nitrogen stream at 55°C. The wax yield was determined by gravimetric analysis. The wax content was calculated using the following equation:
[0107] Wax content (μg / dm) 2 = Wax weight / area of the peeled sample.
[0108] The results are as follows Figure 3 As shown in Figure B, the wax content in the pericarp of lncRNA30130-pRI101E fruit is significantly increased, being twice that of pRI101E fruit.
[0109] 3. Expression detection of genes related to wax synthesis
[0110] 1) Apple fruits from the experimental group (lncRNA30130-pRI101E) and the control group (pRI101E) were sampled and rapidly fixed in liquid nitrogen. Total RNA was extracted from the peel of each group and reverse transcribed into cDNA, using the same method as in "1. RNA extraction and reverse transcription from Fumei apple fruits" in Example 1.
[0111] 2) Specific primers were designed targeting the non-conserved regions of the lncRNA30130 gene, and specific primers were designed targeting the non-conserved regions of the MdCER1, MdCER2, MdCER4, MdKCS1, MdKCS7, MdLTPG1, and MdLACS2 genes. Internal control primers MdActin-F and MdActin-R were also designed. The specific sequences are as follows:
[0112] MdlncRNA30130-qRT-F: CAGAAGCATCAGAGGAGAA (SEQ ID NO. 11);
[0113] MdlncRNA30130-qRT-R: CCAGGAAGATTCGTAGTCA (SEQ ID NO. 12);
[0114] MdActin-qRT-F:TGACCGAATGAGCAAGGAAATTACT(SEQ ID NO.13);
[0115] MdActin-qRT-R: TACTCAGCTTTGGCAATCCACATC (SEQ ID NO.14)
[0116] MdCER1-qRT-F:CTTGGAAGCTTTTAAGCATGTGG(SEQ ID NO.15);
[0117] MdCER1-qRT-R:GGAGGAATGGTGATGTGAGTGG(SEQ ID NO.16);
[0118] MdCER2-qRT-F: ATCCGGATAACCGAAACGGG (SEQ ID NO.17)
[0119] MdCER2-qRT-R:AGGCAGAAAACGCATCTCCA (SEQ ID NO.18)
[0120] MdCER4-qRT-F:CTCTCAATACTTTGGGAGC (SEQ ID NO.19) ;
[0121] MdCER4-qRT-R: AGTTTTTCTTGGAGCAGCC (SEQ ID NO.20)
[0122] MdKCS1-qRT-F:CGTCTCCGTAATAATCCAGCTCA(SEQ ID NO.21);
[0123] MdKCS1-qRT-R:GAGGCCAAAGAAGAAGAGAAGGA(SEQ ID NO.22);
[0124] MdKCS7-qRT-F:CCCTAAAAACCAACATCACCAC (SEQ ID NO.23) ;
[0125] MdKCS7-qRT-R: AGGCACCTCTACAGGAAACTCA (SEQ ID NO.24)
[0126] MdLTPG1-qRT-F:AAATGATTGCGGTGTTGTT(SEQ ID NO.25);
[0127] MdLTPG1-qRT-R: TCCAGTAGTGGGAGTTGCT (SEQ ID NO. 26);
[0128] MdLACS2-qRT-F: CTCCCACAAGAAAAAGCAGCACC (SEQ ID NO. 27);
[0129] MdLACS2-qRT-R: CTCTCAGGCAAATCTCTCCACGG (SEQ ID NO. 28).
[0130] 3) Using the cDNA obtained in step 1) as a template, adjust the cDNA template with apple internal reference primers MdActin-F and MdActin-R to make the concentration of each cDNA template consistent.
[0131] 4) Using cDNA templates of consistent concentration, qRT-PCR was performed to detect the expression differences of MdCER1, MdCER2, MdCER1, MdKCS1, MdKCS7, MdLTPG1, MdLACS2 and lncRNA30130 genes in the fruits of the experimental and control groups.
[0132] The results are as follows Figure 3 As shown in Figure C, the expression level of the lncRNA30130 gene in lncRNA30130-pRI101E fruit was significantly higher than that in pRI101E fruit; while the expression level of wax synthesis-related genes in lncRNA30130-pRI101E fruit was significantly upregulated.
[0133] II. Functional verification of the silenced lncRNA30130 gene
[0134] 1. Injection of viral silencing vector
[0135] 1) Centrifuge the lncRNA30130-pTRV2 vector bacterial culture and pTRV1 helper vector bacterial culture, which have been cultured until golden yellow, at 5000 rpm for 10 min at room temperature and discard the supernatant.
[0136] 2) Resuspend the bacterial cells with ddH2O, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.
[0137] 3) Resuspend the bacterial cells in 10 mM MgCl2, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.
[0138] 4) 10 mM MgCl2 suspension of bacterial cells, adjusting OD 600nm =0.6-0.8.
[0139] 5) Mix the pTRV2 vector and pTRV1 helper vector containing the gene in equal volumes at a ratio of 1:1.
[0140] 6) Add 10 mM MES and 150 mM acetylsuccinone.
[0141] 7) After standing in the dark for 2-3 hours, inject apple fruits and observe the phenotype after 3-5 days.
[0142] 8) Following steps 1)-7), inject the empty vector pTRV2 into apple fruits and observe the phenotype after 3-5 days.
[0143] 2. Observation of apple fruit phenotype and analysis of wax components
[0144] The operational steps are described in "I. Functional Verification of LncRNA30130 Overexpression". The apple fruit phenotypes of the experimental group (lncRNA30130-pTRV2) and the control group (pTRV2) are shown below. Figure 4 As shown in Figure A. The results of the wax component analysis are as follows: Figure 4 As shown in Figure B, the wax content in the pericarp of apples with lncRNA30130-pTRV2 was significantly lower than that of apples with pTRV2.
[0145] 3. Expression detection of genes related to wax synthesis
[0146] For the operation steps, please refer to "I. Functional verification of overexpression of lncRNA30130 gene".
[0147] The results are as follows Figure 4 As shown in Figure C. Compared with the control group, the expression level of the lncRNA30130 gene was significantly reduced in lncRNA30130-pTRV2 fruit, while the expression level of wax synthesis-related genes was significantly downregulated in lncRNA30130-pTRV2 fruit.
[0148] The above results indicate that the lncRNA30130 gene plays a positive regulatory role in fruit wax synthesis, and that this positive regulatory role is achieved by promoting wax biosynthesis.
[0149] Example 4: Construction and Detection of lncRNA30130 Transgenic Apple Tissue Culture Seedlings
[0150] 1. Construction of transgenic apple tissue culture seedlings
[0151] Using Agrobacterium-mediated leaf disc transformation technology, the overexpression vector lncRNA30130-pRI101E and the interference vector lncRNA30130-pFGC1008 were transformed into apple 'GL-3' leaf explants, and transgenic apple tissue culture seedlings were obtained after cultivation.
[0152] Apple tissue culture seedlings overexpressing lncRNA30130, transformed with the overexpression vector lncRNA30130-pRI101E, were named OE2 and OE3, respectively; apple tissue culture seedlings interfering with lncRNA30130, transformed with the interference vector lncRNA30130-pFGC1008, were named RNAi5 and RNAi8, respectively.
[0153] 2. Photographs of apple tissue culture seedling phenotypes
[0154] The phenotypes of wild-type 'GL-3' (WT) and transgenic apple tissue culture seedlings were photographed and observed, as shown below. Figure 5 China A and Figure 6 As shown in Figure A, it can be seen that the lncRNA30130 gene has no significant effect on the phenotype of apple seedlings.
[0155] 3. Analysis of wax components
[0156] For the procedure of sampling plant leaves and analyzing waxy components, please refer to Example 3.
[0157] The results are as follows Figure 5 China B and Figure 6 As shown in Figure B, the total wax content in the leaves of OE2 and OE3 plants was significantly higher than that of the wild-type plants. Figure 5 (B); The total wax content in the leaves of RNAi5 and RNAi8 plants was significantly lower than that in wild-type plants ( Figure 6 (Middle B). This result indicates that in apple 'GL-3', overexpression of the lncRNA30130 gene promotes wax synthesis.
[0158] 4. Expression detection of genes related to wax synthesis
[0159] The operating steps are described in Example 3.
[0160] The results are as follows Figure 5 C and Figure 6 As shown in Figure C, compared with the wild-type control, the expression levels of wax synthesis genes MdCER1, MdCER2, MdCER4, MdKCS1, MdKCS7, MdLTPG1, and MdLACS2 were significantly upregulated in OE2 and OE3 plants. Figure 5 In RNAi5 and RNAi8 plants, the expression levels of wax synthesis genes MdCER1, MdCER2, MdCER4, MdKCS1, MdKCS7, MdLTPG1, and MdLACS2 were significantly downregulated. Figure 6 (C). This result suggests that the lncRNA30130 gene may affect plant wax synthesis by regulating the expression of these key genes.
[0161] In summary, this invention has isolated a transcription factor, lncRNA30130, from apple. Functional verification through transient injection experiments in apples and functional verification in transgenic plants demonstrates that the lncRNA30130 gene plays a significant role in promoting apple wax synthesis. The discovery of the lncRNA30130 gene provides genetic resources and technical support for improving apple fruit quality, and has significant economic and social benefits for enhancing apple quality.
[0162] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. An apple lncRNA 30130 gene, characterized in that, The nucleotide sequence of the apple lncRNA30130 gene is shown in SEQ ID NO.
3.
2. A recombinant vector comprising the apple lncRNA30130 gene as described in claim 1.
3. A recombinant vector for silencing or interfering with the apple lncRNA30130 gene as described in claim 1.
4. A recombinant microorganism comprising the recombinant vector of claim 2 or 3.
5. The application of the apple lncRNA30130 gene of claim 1, the recombinant vector of claim 2 or 3, or the recombinant microorganism of claim 4 in regulating plant wax biosynthesis.
6. The application according to claim 5, characterized in that, The regulation method is to increase the wax content of plants by overexpressing the apple lncRNA30130 gene in plants; or to decrease the wax content of plants by silencing or interfering with the expression of the apple lncRNA30130 gene in plants.
7. The application according to claim 5 or 6, characterized in that, The plant mentioned includes apples.
8. A method for regulating the biosynthesis of plant waxes, characterized in that, The method includes the step of overexpressing the apple lncRNA30130 gene in plants to increase the wax content in said plants; Alternatively, it may include the step of silencing or interfering with the expression of the apple lncRNA30130 gene in plants to reduce the wax content in said plants; The nucleotide sequence of the apple lncRNA30130 gene is shown in SEQ ID NO.
3.
9. The method according to claim 8, characterized in that, The plant mentioned includes apples.