Recombinant plasmid for knocking out wild type diploid saccharomyces cerevisiae HO gene at one time

By constructing recombinant plasmids using CRISPR/Cas9 technology, the process of knocking out the HO gene in Saccharomyces cerevisiae was simplified, improving gene editing efficiency and sporulation rate. This solved the problems of complex operation and low efficiency in existing technologies, and enabled efficient genetic modification of Saccharomyces cerevisiae.

CN121915069APending Publication Date: 2026-04-24NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NORTHWEST A & F UNIV
Filing Date
2026-01-30
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing technologies for knocking out the HO gene in Saccharomyces cerevisiae suffer from problems such as complex operation, low efficiency, and low sporulation rate. In particular, the cre/loxp homologous recombination technology requires four transformations and has low recognition efficiency, making it difficult to meet the needs of efficient genetic modification.

Method used

Recombinant plasmids were constructed using CRISPR/Cas9 technology. Homologous arms of HO were ligated by double digestion with BamHI and salI, followed by overlap PCR. Highly specific crRNAs were then screened to achieve a one-time knockout of the HO gene in wild-type diploid Saccharomyces cerevisiae.

Benefits of technology

The experimental procedures were simplified, the gene editing specificity and efficiency were improved, the homozygous knockout efficiency reached over 70%, and the sporulation rate of Saccharomyces cerevisiae was significantly increased to 99%, meeting the application requirements of highly efficient and stable strains.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121915069A_ABST
    Figure CN121915069A_ABST
Patent Text Reader

Abstract

The invention discloses a recombinant plasmid for one-time knockout of a wild diploid saccharomyces cerevisiae HO gene, and belongs to the technical field of microbial engineering. The recombinant plasmid is constructed on the basis of a CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / CRISPR associated protein 9) technology, takes PRCC-K as an original plasmid, and comprises a nucleotide sequence as shown in SEQ ID NO.1. The CRISPR / Cas9 technology is adopted to replace a traditional cre / loxp homologous recombination technology, one-time knockout of the wild type diploid saccharomyces cerevisiae HO gene is achieved, original operation needing four times of transformation is simplified into single time of transformation, experimental operation steps and working hours are greatly reduced, and the workload of experimenters is reduced. The plasmids can be naturally lost through passage after being transformed into the yeast, an additional removal step is not needed, and the subsequent experimental process is simplified.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial engineering technology, and in particular to a recombinant plasmid that knocks out the HO gene of wild-type diploid Saccharomyces cerevisiae in a single step. Background Technology

[0002] As a classic eukaryotic model organism, *Saccharomyces cerevisiae* plays an irreplaceable role in genetic research, metabolic engineering, and industrial fermentation. The HO gene, a key gene regulating spore typing in *Saccharomyces cerevisiae*, leads to difficulties in sporulation under natural conditions and a high risk of typing and diploid formation. This severely impacts the efficiency of experimental research and production applications relying on yeast spore culture. Therefore, precise knockout of the HO gene is an important direction for improving *Saccharomyces cerevisiae* strains.

[0003] Currently, the knockout of the HO gene in diploid Saccharomyces cerevisiae mainly employs cre / loxp homologous recombination technology. However, this technology faces numerous unresolved issues in practical applications. On one hand, in the design and ligation of homologous arms, while short homologous arms of 20-50 bp can be directly synthesized with primers to bind to the vector fragment, gene recognition efficiency is extremely low. Mismatches are highly likely to occur during experiments, leading to the accidental replacement of non-target genes and resulting in poor knockout specificity. Increasing the homologous arm length to 400-500 bp to improve recognition specificity requires ligating the upstream homologous arm of HO, the PCR-amplified loxp-kan-loxp fragment on the vector, and the downstream homologous arm of HO. This ligation step is complex and inefficient, severely hindering the experimental process.

[0004] On the other hand, the cre / loxp homologous recombination technology itself suffers from a cumbersome operational procedure. Knockout of the HO gene in diploid Saccharomyces cerevisiae requires four transformation operations, significantly increasing the workload of researchers and prolonging the experimental cycle. Furthermore, even after overcoming these operational difficulties, the subsequent sporulation rate of the HO gene knockout strains obtained using this technology still falls short of ideal levels, failing to meet the application requirements for yeast strains with high sporulation rates. These problems make existing HO gene knockout technology inefficiently suited to the genetic modification needs of diploid Saccharomyces cerevisiae, necessitating the development of a simpler, more efficient knockout technique that yields superior subsequent strain performance. Summary of the Invention

[0005] The purpose of this invention is to provide a recombinant plasmid that knocks out the HO gene of wild-type diploid Saccharomyces cerevisiae in a single step, so as to solve the problems existing in the prior art.

[0006] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is a recombinant plasmid for knocking out the HO gene of wild-type diploid Saccharomyces cerevisiae in a single step. The recombinant plasmid is constructed based on CRISPR / Cas9 technology, with PRCC-K as the original plasmid, and contains the nucleotide sequence shown in SEQ ID NO.1.

[0007] The second technical solution of the present invention, the method for constructing the recombinant plasmid, includes the following steps: (1) The original plasmid PRCC-K was double-digested with BamHI and salⅠ to obtain large and small fragments; (2) Amplify and obtain the upstream and downstream homologous arms of the HO gene; (3) The upstream homologous arm and the downstream homologous arm obtained in step (2) are ligated by overlapping PCR, and a TAATAA stop codon is introduced at the ligation site; (4) Screening for crRNAs with high specificity and low off-target rate; (5) The double enzyme digestion fragment from step (1), the homologous arm ligation product from step (3), and the primer containing the crRNA from step (4) are assembled by one-step cloning to obtain a recombinant plasmid.

[0008] The third technical solution of the present invention is the application of the recombinant plasmid in knocking out the HO gene of wild-type diploid Saccharomyces cerevisiae.

[0009] The fourth technical solution of the present invention is a method for knocking out the HO gene in wild-type diploid Saccharomyces cerevisiae, comprising the following steps: transferring the recombinant plasmid into wild-type diploid Saccharomyces cerevisiae, culturing it on YPD plates containing 200 ug / ml kanamycin resistance for 2-3 days, and screening strains with successful HO gene knockout.

[0010] The fifth technical solution of the present invention is a strain of diploid Saccharomyces cerevisiae with the HO gene knocked out by the knockout method.

[0011] Based on the above technical solution, the present invention has the following technical effects: This invention utilizes CRISPR / Cas9 technology to replace the traditional cre / loxp homologous recombination technology, achieving a one-time knockout of the HO gene in wild-type diploid Saccharomyces cerevisiae. This simplifies the original four-transformation process to a single transformation, significantly reducing experimental steps and time, and lowering the workload for researchers. The plasmid is naturally lost through passage after transformation into yeast, eliminating the need for additional knockout steps and simplifying subsequent experimental procedures.

[0012] In terms of gene editing specificity and efficiency, by optimizing the design of upstream and downstream homologous arms of the HO gene and the sgRNA screening of the CRISPR / Cas9 system, the problems of easy mismatch of traditional short homologous arms and low connection efficiency of long homologous arms are effectively avoided. The homozygous knockout efficiency can reach more than 70%, and the knockout efficiency of some strains is even improved to 81%, which significantly reduces the off-target risk and the single knockout ratio.

[0013] Meanwhile, this technology can significantly improve the sporulation performance of Saccharomyces cerevisiae. The sporulation rate of strains after HO gene knockout in potassium acetate medium is as high as 99%, which is significantly higher than the sporulation rate after treatment with traditional cre / loxp technology. This provides an efficient and stable strain basis for related experiments and production that rely on yeast spore culture, and has the advantages of convenient operation, accurate editing and practical application. Attached Figure Description

[0014] Figure 1 This is a plasmid map of PRCC-K.

[0015] Figure 2 This is an illustration of the electrophoresis diagram for plasmid PRCC-K double digestion. MK: DL 15000 DNA Ladder, digestion fragment 1: 9859 bp, digestion fragment 2: 396 bp.

[0016] Figure 3 This is an explanatory diagram of the electrophoresis results of the upstream and downstream homologous arms of the HO gene. M: Trans DNA Marker II; lanes 1-6 show the amplification results of primer A-up-F / N-upstream-R; lanes 7-12 show the amplification results of primer N-downstream-F / A-downstream-R.

[0017] Figure 4 In the diagram, A shows the electrophoresis diagram illustrating the ligation of the upstream and downstream homologous arms of HO, and B shows the sequencing diagram of the ligation of the upstream and downstream homologous arms of HO. M: Trans DNA Marker II, lanes 1-9 show the results of overlapping PCR amplification. Upstream homologous arm of HO: 331 bp, downstream homologous arm of HO: 402 pb, upstream and downstream homologous arms of HO: 733 bp.

[0018] Figure 5 This is an electrophoresis diagram illustrating the recombinant plasmid PRCC-K. M stands for Trans2K Plus DNA Marker. The diagram shows the amplification results of primers PRCC-1-F / PRCC-2-R. Lanes 1 and 25 represent the control group amplification results, while lanes 2-24 and 26-48 represent the reconstructed plasmid amplification results. Unsuccessful construction: 822 bp; Successful construction: 1555 bp. Colonies with bright and single bands were selected for plasmid extraction.

[0019] Figure 6The electrophoresis diagram is for verification purposes. Mark: DL5000 Marker. The image shows the amplification results of primers Y-CAS-HO-F / Y-CAS-HO-R. Lanes 1-20 show the amplification results of Saccharomyces cerevisiae NX12413, amplified to 943 bp. The CRISPR / CAS9 inhibitors cause base mutations, deletions, and insertions to disrupt the signal, which are therefore difficult to detect on electrophoresis and require sequencing control.

[0020] Figure 7 Sequencing results of homozygous knockout of wild-type diploid Saccharomyces cerevisiae NX12413.

[0021] Figure 8 Sequencing results of single knockout of wild-type diploid Saccharomyces cerevisiae NX12413 and wild-type diploid Saccharomyces cerevisiae NX349.

[0022] Figure 9 These are the amplification results using primers Y-CAS-HO-F / Y-CAS-HO-R. Lanes 1-26 show the amplification results for wild-type diploid Saccharomyces cerevisiae strain NX349. The amplified value is 943 bp. The CRISPR / CAS9 primers use base mutations, deletions, and insertions to disrupt the signal, making them difficult to detect on electrophoresis; sequencing is required for comparison.

[0023] Figure 10 This is the sequencing result of homozygous knockout of wild-type diploid Saccharomyces cerevisiae NX349. Different strains using this plasmid produce the same homozygous knockout sequence; therefore... Figure 10 and Figure 7 Exactly the same.

[0024] Figure 11 The sporulation rate is denoted by the CRISPR / CAS method.

[0025] Figure 12 The sporulation rate is denoted by the cre / loxp method. Detailed Implementation

[0026] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0027] This invention provides a recombinant plasmid for knocking out the HO gene of wild-type diploid Saccharomyces cerevisiae in a single step. The recombinant plasmid is constructed based on CRISPR / Cas9 technology, uses PRCC-K as the original plasmid, and contains the nucleotide sequence shown in SEQ ID NO.1.

[0028] This invention also provides a method for constructing the recombinant plasmid, comprising the following steps: (1) The original plasmid PRCC-K was double-digested with BamHI and salⅠ to obtain large and small fragments; (2) Amplify and obtain the upstream and downstream homologous arms of the HO gene; (3) The upstream homologous arm and the downstream homologous arm obtained in step (2) are ligated by overlapping PCR, and a TAATAA stop codon is introduced at the ligation site; (4) Screening for crRNAs with high specificity and low off-target rate; (5) The double enzyme digestion fragment from step (1), the homologous arm ligation product from step (3), and the primer containing the crRNA from step (4) are assembled by one-step cloning to obtain a recombinant plasmid.

[0029] In some specific implementations, the method for amplifying the upstream and downstream homologous arms of the HO gene is as follows: the upstream homologous arm of the HO gene is amplified using primers shown in SEQ ID NO.2-3, and the downstream homologous arm of the HO gene is amplified using primers shown in SEQ ID NO.4-5.

[0030] In some specific implementations, the crRNA sequence is shown in SEQ ID NO.6, and the corresponding PAM sequence is TGG.

[0031] This invention also provides the application of the recombinant plasmid in knocking out the HO gene of wild-type diploid Saccharomyces cerevisiae.

[0032] This invention also provides a method for knocking out the HO gene in wild-type diploid Saccharomyces cerevisiae, comprising the following steps: transforming the recombinant plasmid into wild-type diploid Saccharomyces cerevisiae, culturing it on a YPD plate containing 200 ug / ml kanamycin resistance for 2-3 days, and screening for strains with successful HO gene knockout.

[0033] In some specific implementation schemes, strains with successful HO gene knockout are screened on 200 ug / ml kan resistance plates.

[0034] The present invention also provides strains of diploid Saccharomyces cerevisiae with the HO gene knocked out by the knockout method.

[0035] This invention provides a plasmid for knocking out wild-type diploid Saccharomyces cerevisiae genes. The improvement is that the method for knocking out the HO gene in diploid Saccharomyces cerevisiae has been changed from cre / loxp (homological recombination) to cristr / cas9. The cre / loxp knockout of HO requires four transformations, which is reduced to one transformation. Furthermore, this recombinant plasmid is easily lost after passage in yeast.

[0036] The existing cre / loxp (homologous recombination) technology, if the homologous arms of the target gene HO are between 20-50 bp, can directly synthesize primers for the homologous arms of tens of bp at both ends of the loxp-kan-loxp fragment obtained from the gel electrophoresis of plasmid PCR amplification. However, the recognition efficiency is low, and mismatches are very easy to occur in the experimental process, resulting in the replacement of other genes.

[0037] Alternatively, the target gene HO homologous arm can be added to a length of 400-500 bp. In this case, the upstream and downstream homologous arms at both ends cannot be directly used for primer synthesis. It is necessary to ligate the three segments: the upstream homologous arm of HO, the loxp-kan-loxp fragment obtained by gel electrophoresis of plasmid PCR amplification, and the downstream homologous arm of HO. Although the recognition specificity is high, the ligation efficiency of this step is low.

[0038] Regardless of the length of the upstream and downstream homologous arms of the HO gene, there are issues with the efficiency of ligation and recognition. The cre / loxp (homologous recombination) process itself requires four transformations, significantly increasing experimental time. Furthermore, the sporulation rate of *Saccharomyces cerevisiae* after applying this method is not very high.

[0039] This invention mainly addresses the problem that using cre / loxp (homological recombination) in experiments requires four transformations and two knockouts, which is time-consuming, labor-intensive, and results in a relatively low sporulation rate.

[0040] The plasmid disclosed in this invention can knock out the HO alleles on two chromosomes of wild-type diploid Saccharomyces cerevisiae in one transformation, which greatly reduces the workload and time of the experimenter and improves the sporulation rate of wild-type diploid Saccharomyces cerevisiae strain. The homozygous knockout efficiency of this plasmid is ≥70%.

[0041] Example 1 1. Construction method: The original plasmid used in this invention is PRCC-K, purchased from the Addgene website, and its image is shown below. Figure 1 As shown.

[0042] ① PRCC-K was double-digested using BamHI and salⅠ to obtain a large fragment and a small fragment. Successful digestion was verified by gel electrophoresis. The two fragments were then recovered from the gel. The electrophoresis results are shown below. Figure 2 .

[0043] ②The upstream homologous arm (331 bp, amplification primers: upstream-F (SEQ ID NO.2): TTACATGACTCGAGcggtgaaattaaagacatc; upstream-R (SEQ ID NO.3): actcaccttcaacTTATTAaccatcaagcgtctgacattg) and downstream homologous arm (402 pb, amplification primers: downstream-F (SEQ ID NO.4): gacgcttgatggtTAATAAgttgaaggtgagtttgccg; downstream-R (SEQ ID NO.5): GAGAAAGGTTTAAGTCGAataatgaagccttacatgtttg) of the HO gene (NCBI official website NC_001136.10) were obtained by PCR. The gel electrophoresis confirmed the success, and the two fragments were excised and recovered. The electrophoresis image is shown below. Figure 3 .

[0044] ③ Overlap PCR was performed on the upstream and downstream homologous arms of HO, and a TAATAA stop codon was added at the junction to connect them. Successful gel electrophoresis confirmed the connection, and the long fragment was recovered from the gel. The electrophoresis image is shown below. Figure 4 As shown.

[0045] ④ At this URL https: / / crispor.gi.ucsc.edu / The aim was to find a crRNA with high specificity, low off-target rate, and high knockout efficiency. The crRNA used in this invention is (SEQ ID NO.6): TCATTGGGAATGTCTTATGA, PAM: TGG. The primer sequence containing the crRNA is shown in SEQ ID NO.7 (SEQ ID NO.7: GAAAGATAAATGATCGGATCTCATTGGGAATGTCTTATGAGTTTTAGAGCTAGAAATAGC).

[0046] ⑤ The above four fragments (the large and small fragments after double digestion of the original plasmid in step ①, the upstream and downstream homologous arms of HO in step ③, and the primers containing crRNA in step ④) are ligated together by one-step cloning to obtain the recombinant plasmid.

[0047] The successfully connected sequence is shown in SEQ ID NO.1.

[0048]

[0049] ⑥ The plasmid was transferred into Escherichia coli DH5α for amplification.

[0050] ⑦ Extract plasmids for PCR verification, such as... Figure 5 .

[0051] 2. Knockout of the HO gene in diploid Saccharomyces cerevisiae ① The recombinant plasmid was transformed into Saccharomyces cerevisiae using the lithium acetate conversion method, and then cultured on kanamycin (KAN) resistant plates at 200 ug / ml for 2-3 days to screen for strains with successful HO gene knockout. Single colonies growing on kanamycin resistant plates were selected for PCR and sequencing verification to determine whether it was homozygous knockout or single knockout based on the test results.

[0052] ② After PCR using the primers designed in this invention, the samples are sent for sequencing. The sequencing results are used to determine whether it is a homozygous knockout or a single knockout. The electrophoresis results are as follows: Figure 6 .

[0053] Crispril / Cas9 disrupts DNA through base mutations, deletions, and insertions, making it difficult to detect in electrophoresis and requiring sequencing as a control.

[0054] Y-CAS-HO-F (SEQ ID NO.8): CTGAAAACACGACTATTCTGATGGCT; Y-CAS-HO-R (SEQ ID NO. 9): TCGCCGTACATAAATTCAGGGATTTGC.

[0055] Sequencing results as follows Figure 7 As shown, the absence of overlapping peaks indicates that both alleles in the chromosome have the same length of base deletion, which is a homozygous base deletion. NX12413 is a base deletion knockout and also shows no overlapping peaks, indicating that it is a homozygous single clone. Of the 20 sequences, 14 were homozygous knockouts, with a homozygous base deletion rate of 70%.

[0056] like Figure 8 As shown, a typical mutant requires a single peak upstream of the sequencing line, with overlapping peaks appearing starting from the target site. NX12413 is a base deletion knockout. Peak overlap analysis revealed a deletion of one HO base on the chromosome, while the other allele remained intact. This result indicates a single knockout, but it represents a low percentage; only 6 out of 20 samples (30%) were single knockouts.

[0057] Subsequently, this plasmid was used to knock out another wild-type diploid Saccharomyces cerevisiae strain, NX349, with the following results: Figure 9-10As shown, NX349 is a base deletion knockout strain with no overlapping peaks, indicating it is a homozygous base deletion monoclonal strain. Of the 26 clones sequenced, 21 were homozygous knockouts, representing a homozygous base deletion rate of 81%. Since the HO gene controls the spore-matching transformation of *Saccharomyces cerevisiae*, *Saccharomyces cerevisiae* without HO gene knockout has difficulty sporulation and is prone to diploid transformation. For strains with HO knockout using recombinant plasmids, sporulation on potassium acetate medium for 8 days showed an extremely high sporulation rate exceeding 99%, significantly higher than that achieved using cre / loxp.

[0058] Figure 11 Malachite green staining identifies spores, while guava red staining identifies diploid vegetative cells. After culturing bacteria in potassium acetate medium for 8 days, staining with malachite green and guava red was performed for microscopic observation. Spores stained green with malachite green but not red with guava red, while diploid vegetative cells stained red with guava red but not green with malachite green. Under the microscope, the entire screen appeared green, demonstrating that this method has an extremely high sporulation rate.

[0059] Figure 12 The sporulation rate was obtained using the cre / loxp method. It can be seen that the sporulation rate is much lower than that of the method of this invention; under the microscope, a large number of diploid vegetative cells stained red can still be observed.

[0060] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A recombinant plasmid for one-time knockout of the HO gene in wild-type diploid Saccharomyces cerevisiae, characterized in that, The recombinant plasmid was constructed using CRISPR / Cas9 technology, with PRCC-K as the original plasmid, and contains the nucleotide sequence shown in SEQ ID NO.

1.

2. The method for constructing the recombinant plasmid as described in claim 1, characterized in that, Includes the following steps: (1) The original plasmid PRCC-K was double-digested with BamHI and salⅠ to obtain large and small fragments; (2) Amplify and obtain the upstream and downstream homologous arms of the HO gene; (3) The upstream homologous arm and the downstream homologous arm obtained in step (2) are ligated by overlapping PCR, and a TAATAA stop codon is introduced at the ligation site; (4) Screening for crRNAs with high specificity and low off-target rate; (5) The double enzyme digestion fragment from step (1), the homologous arm ligation product from step (3), and the primer containing the crRNA from step (4) are assembled by one-step cloning to obtain a recombinant plasmid.

3. The construction method according to claim 2, characterized in that, The method for amplifying the upstream and downstream homologous arms of the HO gene is as follows: the upstream homologous arm of the HO gene is amplified using primers shown in SEQ ID NO.2-3, and the downstream homologous arm of the HO gene is amplified using primers shown in SEQ ID NO.4-5.

4. The construction method according to claim 2, characterized in that, The crRNA sequence is shown in SEQ ID NO.6, and the corresponding PAM sequence is TGG.

5. The application of the recombinant plasmid as described in claim 1 in knocking out the HO gene of wild-type diploid Saccharomyces cerevisiae.

6. A method for knocking out the HO gene in wild-type diploid Saccharomyces cerevisiae, characterized in that, The process includes the following steps: transforming the recombinant plasmid described in claim 1 into wild-type diploid Saccharomyces cerevisiae, culturing it on YPD plates containing 200 ug / ml kanamycin resistance for 2-3 days, and screening for strains with successful HO gene knockout.

7. The knockout method according to claim 6, characterized in that, Strains with successful HO gene knockout were screened using 200 ug / ml kan resistance plates.

8. The *Saccharomyces cerevisiae* strain with the HO gene knocked out as described in claims 6-7.