Application of ZmWRKY43 gene in corn drought response

Abstract

The invention discloses application of a ZmWRKY43 gene in corn drought response, and belongs to the technical field of biology. According to the application of the ZmWRKY43 gene disclosed by the invention in corn drought response, the CDS (Coding Sequence) of the ZmWRKY43 gene is as shown in SEQ ID NO. 2. The coding gene of the knockout protein ZmWRKY43 can negatively regulate the drought resistance of plants, and has a positive effect on accelerating improvement of drought-resistant varieties of corns.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to the application of the ZmWRKY43 gene in the drought response of maize. Background Technology

[0002] corn( Zea mays Maize (L.) is the world's most widely cultivated dual-purpose crop (food and forage), and it is highly sensitive to drought stress throughout its growth and development. Therefore, identifying and cloning key drought-resistant genes in maize and creating new drought-resistant maize germplasm is of great significance for accelerating the breeding of superior maize germplasm resources. WRKY transcription factors are a class of plant-specific transcription factors involved in plant responses to abiotic stresses. For example, Wu et al.'s research indicated that overexpression of OsWRKY11 in rice can enhance its drought resistance. Given the important role of WRKYs in plant abiotic stress, identifying and cloning WRKYs in maize is of great significance for the study of crop stress resistance mechanisms and their application in production.

[0003] Therefore, providing an application of the ZmWRKY43 gene in the drought response of maize is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0004] In view of this, the present invention provides the application of the ZmWRKY43 gene in the drought response of maize.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: Application of the ZmWRKY43 gene in drought response of maize, wherein the CDS sequence of the ZmWRKY43 gene is shown in SEQ ID NO.2.

[0006] Furthermore, the application of knocking out the ZmWRKY43 gene in negatively regulating the drought response in maize, the CDS sequence of the ZmWRKY43 gene is shown in SEQ ID NO.2.

[0007] Furthermore, the application of biomaterials with the ZmWRKY43 gene knocked out in the negative regulation of drought response in maize, wherein the CDS sequence of the ZmWRKY43 gene is shown in SEQ ID NO.2; The biomaterial is any one of the following: A: An expression cassette capable of silencing the ZmWRKY43 gene with a CDS sequence as shown in SEQ ID NO.2; B: A recombinant vector containing the expression cassette described in A; C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

[0008] Furthermore, the application of the ZmWRKY43 gene in maize breeding, wherein the CDS sequence of the ZmWRKY43 gene is shown in SEQ ID NO.2.

[0009] Furthermore, the application of the ZmWRKY43 gene in the breeding of drought-resistant maize germplasm is described, with the CDS sequence of the ZmWRKY43 gene shown in SEQ ID NO.2.

[0010] As can be seen from the above technical solution, compared with the prior art, this invention discloses the application of the ZmWRKY43 gene in the drought response of maize, identifies a maize ZmWRKY43 (Zm00001d043025) protein and its encoding gene. The protein ZmWRKY43 belongs to the WRKYs family. Identifying and cloning WRKYs in maize is of great significance for the study of crop stress resistance mechanisms and production applications. By constructing the pCXB053-sgRNA recombinant plasmid to knock out the ZmWRKY43 gene, three different edited plants of the ZmWRKY43 gene were obtained. The drought resistance of the mutant seedlings was identified in an artificial climate chamber greenhouse, and it was found that the drought resistance of the mutant plants was reduced, providing new materials for the breeding of drought-resistant maize varieties. Attached Figure Description

[0011] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0012] Figure 1 This is a schematic diagram of the pCXB053-sgRNA recombinant vector structure.

[0013] Figure 2 Identification of knockout mutants of ZmWRKY43; where A is a schematic diagram of the ZmWRKY43 gene structure, gRNA1 and gRNA2 are the two target sites of pCXB053-gRNA; B is the mutation site information of the zmwrky43 edited strain; compared with wild type, zmwrky43-1 has a deletion of 158 bp; zmwrky43-2 has a deletion of 39 bp; zmwrky43-3 has a deletion of 2 bp in the first gRNA1 and an insertion of 1 bp in the second gRNA2.

[0014] Figure 3 Phenotypic identification of CRISPR / Cas9 ZmWRKY43 knockout mutants; where A represents leaf phenotypes of wild-type and ZmWRKY43 knockout mutant lines; and B represents survival rates of wild-type and ZmWRKY43 knockout mutants.

[0015] Figure 4 Physiological changes in the ZmWRKY43 knockout mutant are shown below; where A represents the water loss rate of wild-type WT and ZmWRKY43 knockout mutants; B represents the relative water content of wild-type WT and ZmWRKY43 knockout mutants under normal treatment and drought stress; C represents the malondialdehyde content of wild-type WT3 and ZmWRKY43 knockout mutants under normal treatment and drought stress; and D represents the proline content of wild-type WT and ZmWRKY43 knockout mutants under normal treatment and drought stress. Detailed Implementation

[0016] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0017] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0018] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0019] The pCXB053 vector and Agrobacterium EHA105 were provided by Weimi Biotechnology Co., Ltd., and have been documented in: High-throughput CRISPR / Cas9 mutagenesis streamlines trait gene identification in maize. Plant Cell, 2020; 32(5):1397-1413.

[0020] The following examples use EXCEL statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The T-test is used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates an extremely significant difference.

[0021] The amino acid sequence of ZmWRKY43 is shown in SEQ ID NO.1.

[0022] MTTSSSGSIEAPANSRPGSFSFASTSTSFTNMLGGSADAAGGASRYKAMTPPSLPLSPSSFFSNIPDGLNPADFLDSPALLSSSIFPSPTTNAFASQQFSWLVTPGAEQGGKDEQRQSYPDFSFQTAPTAEDAVRTTTFQPPVPAAPPVEEAYRGQQQPWAYQQQQAAGMDAGSSQAAYGGPFHQAASSDAAAMAPHVPASGGYSHQAQQSQRRSSDDGYNWRKYGQKQVKGSENPRSYYKCTFPSCPTKKKVERSLDGQITEIVYKGTHNHAKPQNTRRNSSSAAAAQLLQGGDASEHSFGGMSGTPAATPENSSASFGDDEVGVGSPRAGNAGGDEFDEDEPDSKRWRKDGGDGEGISMAGNRTVREPRVVVQTMSDIDILDDGYRWRKYGQKVVKGNPNPRSYYKCTTVGCPVRKHVERASHDLRAVITTYEGKHNHDVPAARGSAALYRPAPPPADTAGHHYLAAARPGVAYQTGQQYGFGDQLGSFGLSGAPAQSGGGGFAFSSGFDNPMGSYMSQHQQQQRQNDAMHASRAKEEPREDMFFPTSLLYTD; SEQ ID NO.1。

[0023] The CDS sequence of ZmWRKY43 is shown in SEQ ID NO.2. ATGACCACCTCGTCCTCCGGGA TCGTTGCTGTACACTGA CTGA ; SEQ ID NO.2.

[0024] The nucleotide sequence of ZmWRKY43 is shown in SEQ ID NO.3.

[0025] ACATGACCCCAGCCACGTCGCCACCGTTCACCCACGGTGTCCGCCGCTAGTGGTGGGTATCTGGGCGTCATGCCGTCGCGAAGCTGGCCTGGCCAGCGAGGGCCGCCAGTCAAACTCCACGAGCTTTGACTGGTCAACAGTCAAACTTTCCAAGCCTTATATACATTCCAACTCCCCGTCCGAACAAATCCAAAGCAGTTCCCACCTCATCGCCTTCCTCCTTCCACCGTTCCCTGCCCGCCAACCAGGACGTACACGCCGGACACACGTCACAGCCTTGAAGCCTCCCTCCCACACAACCCCAAGCCCCAACACAAACACACACACACGATCGGTCTCGTCGCAGCGCAGCGCCGCGCCGCGGGTTTGATCGTCACGAGTGGCGACTTCCTTCCCCTCCCTCTTTCGCCG ATGACCACCTCGTCCTCCGGGA GCATCGAAGCACCGGCGAACTCCAGACCCGGCTCGTTCTCGTTCGCGAGCACGAGCACGAGCTTCACGAACATGCTGGGGGGATCTGCGGACGCGGCCGGCGGGGCGTCGAGGTACAAGGCCATGACCCCACCGTCCCTGCCCCTGTCGCCGTCGTCCTTC TTCAGT AACATCCCCGACGGCCTCAACCCCGCCGACTTC TCGTTGCTGTACACTGACTGA AGGACAAGGACGGCAGGACATGGCGTGGTGTGGTGTCCATAAACTGTTCCTTTGGCACACGGATTGTTGTTGTTGTTGTTGTTGTTGTATCTAGGATAGGTTGAACAGATTTCTTTATTTGTTTGGAGGCCTCCATGTTGGCAGTGGCAGATGCTTGCCGTGCCGCAGGGGTGTCTCCCTTAACACGTGAAAGGGGGGAAAGAAAGGGATTTAGGATACTAGAGTCTAGGACACGTGGCAATTACACAGAAGGGGTAAAGAAGTTTTGTTCCTCAAAGACAAATTCACACATGAGACTTGTTGTAGTCAGGATTGGACATAATTTCATGTCACAGAACATTTGTTAAGATTC; SEQ ID NO.3.

[0026] The sequence of the recombinant plasmid pCXB053-sgRNA expression cassette is composed of SEQ ID NO.4 and SEQ ID NO.5 connected in sequence.

[0027]

[0028]

[0029] sgRNA1: CCGGCGAACTCCAGACCCGGCTC; SEQ ID NO.6.

[0030] sgRNA2: TTCTTCAGTAACATCCCCGACGG; SEQ ID NO.7.

[0031] Example 1: Obtaining the ZmWRKY43 gene mutant 1. Cloning of the ZmWRKY43 gene Leaves of maize inbred line B73 seedlings that had reached the two-leaf stage were immediately flash-frozen in liquid nitrogen. RNA was extracted using the RNA EasyFast Plant Tissue kit (TIANGEN) and reverse transcribed using the HiScript III 1st Strand cDNA Synthesis Kit (Vazyme) to synthesize first-strand cDNA. Using the cDNA template, homologous recombination primers F-ZmWRKY43-CDS / R-ZmWRKY43-CDS were designed based on the cDNA sequence of the ZmWRKY43 gene for PCR amplification (PCR amplification kit – 2×KOD PCR MasterMix, purchased from Bio-Rad Laboratories, catalog number: ALH211). The primer sequences are as follows: F-ZmWRKY43-CDS: 5'-ATGACCACCTCGTCCTCCGGGA-3'; SEQ ID NO. 8.

[0032] R-ZmWRKY43-CDS: 5'-TCAGTCAGTGTACAGCAACGA-3'; SEQ ID NO. 9.

[0033] PCR amplification reaction system: KOD Buffer 15 µL, dNTP 5 µL, ddH2O 6 µL, KOD FOX 1 µL, Forward Primer 1 µL, Reverse Primer 1 µL, cDNA 1 µL, total system 30 µL.

[0034] PCR amplification program: 94℃ for 2 min; 98℃ for 10 s, 60℃ for 30 s, 68℃ for 1 min, 35 cycles; 68℃ for 7 min.

[0035] The obtained PCR product was sequenced. The CDS sequence of ZmWRKY43 was 1668 bp in length, encoding a protein of 555 amino acids, belonging to the WRKYs family. The coding sequence (CDS) of the ZmWRKY43 gene in maize B73 is SEQ ID NO.2, encoding the ZmWRKY43 protein with the amino acid sequence SEQ ID NO.1. The genomic gene encoding the ZmWRKY43 protein in the genomic DNA of maize B73 is shown in SEQ ID NO.3. A schematic diagram of the structure of the ZmWRKY43 gene is shown below. Figure 2 A.

[0036] 2. Extraction of DNA from maize leaves DNA was extracted from maize leaves using a plant DNA extraction kit (purchased from Beijing TransGen Biotech Co., Ltd., catalog number: EE141-01). 2-10 mg of seedling leaves were placed into sterile 2 mL centrifuge tubes containing steel balls, frozen in liquid nitrogen, and ground into powder using a plant tissue homogenizer. 100 µL of PDA was added to the centrifuge tube, and the mixture was incubated at 50°C for 5-15 min, occasionally shaking. 100 µL of PDB was then added and gently vortexed to mix. The mixture was allowed to stand at room temperature for 5 min, and then centrifuged at 12000 rpm for 10 min. Pipette approximately 80-100 µL of the supernatant and transfer it to a new 1.5 mL centrifuge tube. Add an equal volume of anhydrous ethanol, mix well, let stand for 10 min, centrifuge at 12000 rpm for 2 min, discard the supernatant, add 800 µL of 70% ethanol to wash the precipitate, centrifuge at 12000 rpm for 2 min to precipitate DNA, discard the supernatant, let cool to allow the residual ethanol to evaporate, add 20-100 µL of sterile water, and obtain maize leaf genomic DNA.

[0037] 3. Obtaining the CRISPR / Cas9 knockout mutant of ZmWRKY43 Two target sequences with low off-target rates and high target rates were selected from the first exon of the WRKY43 coding gene as the target sequences for constructing the vector. The vector was then ligated into the pCXB053 vector and subsequently transformed into the maize inbred line B73.

[0038] 1) Obtaining the ZmWRKY43 target sequence The coding region of WRKY43 was knocked out using the CRISPR / Cas9 system. Specific target sequences sgRNA1 (as shown in SEQ ID NO. 6) and sgRNA2 (as shown in SEQ ID NO. 7) of ZmWRKY43 were designed using Guide Design Resources (https: / / zlab.bio / guide-design-resources). Primers containing these target sequences were designed, and their information is as follows: pSG-ZmWRKY43-F:5'-CAAT CCGGCGAACTCCAGACCCGGCTC -3';SEQ ID NO.10。

[0039] pSG-ZmWRKY43-R:5'- TTCTTCAGTAACATCCCCGACGG ATTG-3'; SEQ ID NO.11.

[0040] 2) Construction of the pCXB053-sgRNA recombinant vector The pCXB053 vector was digested with BsaI-HF at 37°C for 1 hour. The digestion system was as follows: 5 µL 10x Cutsmart, 1 µL BsaI-HF, 10 µL pCXB053 vector, and 34 µL ddH2O. Then, the pCXB053 vector and the primers containing the target sequence were homologously recombinated using T4 ligase. The ligation system was as follows: 5 µL pCXB053, 1 µL pSG-ZmWRKY43-F, 1 µL pSG-ZmWRKY43-R, 10 µL T4 ligase, and 3 µL T4 ligase buffer (T4 ligase was purchased from Thermo Fisher Scientific, catalog number: 15224041). The reaction was run in a PCR instrument at 16°C for 1 hour, then incubated for 3 hours or overnight to obtain the pCXB053-sgRNA recombinant plasmid.

[0041] The recombinant plasmid pCXB053-sgRNA was transformed into competent E. coli DH5α cells. After removing the competent DH5α cells from the refrigerator, they were immediately placed on ice. After 5 minutes, once the bacterial clumps had dissolved, the ligation product was added. The cells were incubated on ice for 25 minutes, then heat-shocked at 42°C for 45 seconds, and incubated on ice for 2 minutes (without shaking). 100 µl of antibiotic-free LB was added, and the cells were incubated at 37°C and 200 rpm for 1 hour. The culture was then plated and incubated with LB + Kanamed Alkane (50 μg / mL) at 37°C for one day. Single clones were picked in a clean bench for PCR amplification and sequencing. The PCR amplification system consisted of 15 µL of PCRMix, 1 µL each of QC1-F and QC1-R, and 3 µL of H2O. The PCR primers are as follows: QC1-F: 5'-CTGGCGAAAGGGGGATGTGCTGCAA-3'; SEQ ID NO. 12.

[0042] QC1-R: 5'-CTTAGACATGCAATGCTCAT-3'; SEQ ID NO. 13.

[0043] Transform correctly sequenced single clones into Agrobacterium EHA105 using the following transformation system: 20 µl Agrobacterium EHA105 + 1 µl plasmid. Incubate on ice for 5 min, then flash freeze in liquid nitrogen for 5 min, incubate in water at 37°C for 5 min, and then on ice for 5 min. Add 100 µl of antibiotic-free LB agar and incubate at 28°C and 200 rpm for 2 h. Then, directly plate the mixture with YEP + Kana + Rif (concentrations of 50 μg / mL and 50 μg / mL, respectively) and incubate at 28°C for two days. After two days, pick one single clone and place it in a 5 ml sterile EP tube. Add 2 ml of YEP + Kana + Rif beforehand, incubate overnight, and obtain a suspension.

[0044] A schematic diagram of the structure of the recombinant plasmid pCXB053-sgRNA is shown below. Figure 1 The nucleotide sequence of the recombinant plasmid pCXB053-sgRNA is shown in SEQ ID NO.4-5. pCXB053-sgRNA expression targets sgRNA1 and sgRNA2 of the ZmWRKY43 gene. The target sequence of sgRNA1 is 5'-CCGGCGAACTCCAGACCCGGCTC-3' (SEQ ID NO. 6). The target site of sgRNA1 is located in the first exon of the ZmWRKY43 gene, and the nucleotide sequence of the target site of sgRNA1 is positions 445-467 of SEQ ID NO. 3 or positions 34-56 of SEQ ID NO. 2. The target sequence of sgRNA2 is 5'-TTCTTCAGTAACATCCCCGACGG-3' (SEQ ID NO. 7). The target site of sgRNA2 is located in the first exon of the ZmWRKY43 gene, and the nucleotide sequence of the target site of sgRNA is positions 592-614 of SEQ ID NO. 3 or positions 181-203 of SEQ ID NO. 2.

[0045] The nucleotide sequence of pCXB053-sgRNA is formed by sequentially linking SEQ ID NO.4 and SEQ ID NO.5. The sgRNA1 gene is shown as nucleotides 794-816 of SEQ ID NO.4, and nucleotides 274-773 are the promoter for initiating sgRNA1 gene transcription. The sgRNA2 gene is shown as nucleotides 1349-1371 of SEQ ID NO.4, and nucleotides 829-1328 are the promoter for initiating sgRNA2 gene transcription. In pCXB053-sgRNA, the nucleotide sequence of the Cas9 protein is positions 3498-7598 of SEQ ID NO.4. Nucleotides 1391-3375 are the promoter for initiating Cas9 protein gene transcription, and nucleotides 7656-7939 are the terminator for terminating Cas9 protein gene transcription.

[0046] 3) Obtaining T0 generation transgenic plants Using freshly peeled corn embryos (approximately 1 mm in diameter), about 150 embryos were placed in 2 ml plastic centrifuge tubes containing 1.8 mL of suspension and incubated for 30 min. The suspension was then removed, and the remaining corn embryos were placed in the tubes with 1.0 ml of suspension and incubated for 5 min. The embryos in the centrifuge tubes were then resuspended and transferred to a co-culture medium (main components: 1 / 2 MS salt; sucrose: 30 g / L; 6-BA: 1.0 mg / L; NAA: 0.1 mg / L; acetylsuccinone: 20 mg / L; agar: 7 g / L). Excess Agrobacterium tumefaciens on the surface was removed with a pipette, and the mixture was co-cultured in the dark at 23°C for 3 days. After co-culture, the immature embryos were transferred to resting medium (major components: 1 / 2 MS salt; sucrose: 30 g / L; 6-BA: 1.0 mg / L; NAA: 0.1 mg / L; cephalosporin: 400 mg / L; termethin: 200 mg / L; agar: 7 g / L) and cultured in the dark at 28 °C for 6 days. Then, they were transferred to selection medium containing diammonium phosphate (concentration of 5 mg / L) (major components: MS salt; sucrose: 30 g / L; 6-BA: 2.0 mg / L; NAA: 0.01 mg / L; kanamycin: 100 mg / L; cephalosporin: 200 mg / L; agar: 7 g / L) for two weeks of selection culture. The medium was then replaced with fresh selection medium and cultured for another two weeks. Resistant callus tissue was transferred to differentiation medium (main components: MS salt; sucrose: 20 g / L; 6-BA: 0.5 mg / L; GA3: 0.5 mg / L; kanamycin: 25 mg / L; agar: 7 g / L) and cultured at 25℃, 5000 lx, under light for 3 weeks. The differentiated seedlings were then transferred to rooting medium (main components: 1 / 2 MS salt; sucrose: 15 g / L; IBA: 0.5 mg / L; agar: 6 g / L) and cultured at 25℃, 5000 lx, under light until rooting. The seedlings were then transferred to small pots for growth, and after a certain growth stage, they were transplanted into a greenhouse. The offspring seeds were harvested 3-4 months later.

[0047] The obtained T0 generation maize transgenic with the ZmWRKY43 gene knockout was cultured to the T3 generation. After self-pollination, each generation of maize was identified by PCR and sequencing to screen for homozygous lines. Three homozygous mutant plants (i.e., the mutations on the two homologous chromosomes were identical) were obtained and named zmwrky43-1, zmwrky43-2, and zmwrky43-3, respectively.

[0048] DNA was extracted from leaves of T3 generation plants and amplified using specific sequencing primers ZmWRKY43-F / ZmWRKY43-R. DNA from the wild-type maize inbred line B73 was used as a control. The PCR products were sent to a sequencing company. The amplification primers are as follows: ZmWRKY43-F: 5'-CTCCACGAGCTTTGACTGGT-3'; SEQ ID NO. 14.

[0049] ZmWRKY43-R: 5'-CGACCATGACCCACACAGAA-3'; SEQ ID NO. 15.

[0050] The reaction system for PCR amplification using sequencing primers was as follows: 12.5 µL of 2xEsTaq Master Mix, 1 µL of Forward Primer, 1 µL of Reverse Primer, 2 µL of DNA, 0.5 µL of DMSO, and 13 µL of ddH2O.

[0051] PCR amplification program: 95℃ for 3 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 80 s, 35 cycles; 72℃ for 5 min.

[0052] The results are as follows Figure 2 As shown in B, three different edited strains were identified: zmwrky43-1, zmwrky43-2, and zmwrky43-3.

[0053] Sequencing analysis revealed that, compared to the genomic DNA of the maize inbred line B73, the genes encoding the ZmWRKY43 protein in both homologous chromosomes of the zmwrky43-1 line underwent the following mutations: a deletion occurred between the first and second target sgRNA sites, with "5'- CCGGCGAACTCCAGACCCGGCTC-3' (SEQ ID NO. 6)" mutated to "5'-CCGGCG-----CGACGGCCTC-3' (SEQ ID NO. 16)". The mutation site corresponds to position 453 of SEQ ID NO. 3 (corresponding to position 42 of SEQ ID NO. 2). Following the sgRNA mutation, a frameshift mutation occurred at position 13 of the ZmWRKY43 protein sequence, resulting in the knockout of the gene encoding the ZmWRKY43 protein. Sequencing results of this mutation site and its surrounding nucleotides are shown below. Figure 2 B.

[0054] Sequencing analysis revealed that, compared to the genomic DNA of the maize inbred line B73, the genes encoding the ZmWRKY43 protein in both homologous chromosomes of the zmwrky43-2 line underwent the following mutations: The first target sgRNA remained unchanged; the second target sgRNA mutated, changing "5'-TTCTTCAGTAACATCCCCGACGG-3' (SEQ ID NO.7)" to "5'-TTC----C-3'", occurring at position 595 of SEQ ID NO.3 (corresponding to position 184 of SEQ ID NO.2). Following this second sgRNA mutation, a frameshift mutation occurred at position 62 of the ZmWRKY43 protein sequence, resulting in the knockout of the gene encoding the ZmWRKY43 protein. Sequencing results of this mutation site and its surrounding nucleotides are shown below. Figure 2 B.

[0055] Sequencing analysis revealed that, compared with the genomic DNA of the maize inbred line B73, the genes encoding the ZmWRKY43 protein in both homologous chromosomes of the zmwrky43-3 line underwent the following mutations: the first target sgRNA mutation, "5'-CCGGCGAACTCCAGACCCGGCTC-3' (SEQ ID NO. 6)" mutated to "5'-CCGGCGCTCCAGACCCGGCTC-3' (SEQ ID NO. 17)", with the mutation site corresponding to position 451 of SEQ ID NO. 3 (corresponding to position 40 of SEQ ID NO. 2); the second target sgRNA mutation, "5'-TTCTTCAGTAACATCCCCGACGG-3' (SEQ ID NO. 7)" mutated to "5'-TTCTTCAGTAACATCCCACGACGG-3' (SEQ ID NO. 18)", with an insertion of a base after position 608 of SEQ ID NO. 3 (and an insertion of a base after position 197 of SEQ ID NO. 2). When the first sgRNA1 mutated, a frameshift mutation occurred at position 14 of the ZmWRKY43 protein sequence, resulting in the knockout of the gene encoding the ZmWRKY43 protein. Sequencing results of this mutation site and its surrounding nucleotides are shown below. Figure 2 B.

[0056] Example 2: Identification of drought tolerance in seedlings of ZmWRKY43 CRISPR / Cas9 knockout mutant Maize inbred line B73 and edited lines zmwrky43-1, zmwrky43-2, and zmwrky43-3 were planted in four separate pots (length x width x height = 15 x 10 x 10 cm), with 24 seeds sown per line. After sowing, 2 L of water was applied evenly, followed by 19 days of withholding water. Significant phenotypic differences were observed between inbred line B73 and the edited lines. Then, 2 L of water was applied again to assess the drought tolerance of the CRISPR / Cas9 knockout mutant of ZmWRKY43. All materials were grown in a greenhouse at 28°C with a 16-hour light / 8-hour dark cycle, using three biological replicates.

[0057] After 19 days of water control, the leaves of the inbred line B73 completely dried up, while the leaves of the transgenic lines showed a curled or wilted phenotype. Figure 3 A); Two days after the drought was reversed and the water was replenished, the number of surviving lines of inbred line B73 and edited lines with the ZmWRKY43 gene knocked out was counted. The survival rates of edited lines zmwrky43-1, zmwrky43-2, and zmwrky43-3 were significantly lower than those of inbred line B73. Figure 3 B).

[0058] Example 3: Evaluation of drought resistance of ZmWRKY43 CRISPR / Cas9 knockout mutant Wild-type maize (WT) and edited lines zmwrky43-1, zmwrky43-2, and zmwrky43-3 were planted in four separate pots (length x width x height = 15 x 10 x 10 cm), with 24 seeds sown per line. The plants were grown in a greenhouse at 28°C with a 16-hour light / 8-hour dark photoperiod. Two treatments were implemented: the normal control group (WW) received normal watering after sowing, while the experimental group (Drought) received watering only once after sowing. Sampling was conducted 16 days after sowing, when significant phenotypic differences were observed between the inbred lines and knockout mutants in the experimental group, to measure drought-related physiological indicators. Three biological replicates were used for each treatment.

[0059] After 16 days of water control, the water loss rate of wild-type WT and the edited line with the ZmWRKY43 gene knocked out was measured every hour.

[0060] The results showed that after 16 days of water control, the water loss rates of the edited strains zmwrky43-1, zmwrky43-2, and zmwrky43-3 were significantly higher than those of the wild-type WT. Figure 4 A).

[0061] Rinse the corn seedling leaves with deionized water and weigh them (W1). Then place them in distilled water for 24 hours, wipe the surface of the leaves dry and weigh them (W2). Then place them in an oven at 80℃ for 48 hours until the weight no longer changes and weigh them (W3). Measure the relative water content of the leaves (Relative water content = (W1-W3) / (W2-W3) × 100%).

[0062] The results showed that under normal treatment, there was no significant difference in the relative water content between wild-type WT and zmwrky43-1, zmwrky43-2, and zmwrky43-3, while under drought treatment, the relative water content of wild-type WT was significantly higher than that of the knockout lines. Figure 4 B).

[0063] The malondialdehyde (MDA) content and proline content were determined using a kit. 0.1 g of leaf material was weighed and placed into a 2.0 mL centrifuge tube containing a steel ball. The enzyme content was determined according to the kit instructions (CominAssay Kit).

[0064] The results showed that under normal treatment, there were no significant changes in MDA and Pro content in wild-type WT and knockout lines zmwrky43-1, zmwrky43-2, and zmwrky43-3; under drought stress, the MDA content of wild-type WT was significantly lower than that of the knockout lines. Figure 4 C), while the Pro content was significantly higher than that of the knockout strain (C). Figure 4 (D) The above indicates that the knockout mutant of ZmWRKY43 is less drought-tolerant than the wild type.

[0065] In summary, knocking out the maize ZmWRKY43 gene using CRISPR / Cas9 reduced the drought resistance of maize seedlings, and the ZmWRKY43 gene negatively regulated the drought resistance of maize.

[0066] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of the ZmWRKY43 gene in maize drought response, characterized in that, The CDS sequence of the ZmWRKY43 gene is shown in SEQ ID NO.

2.

2. The application of ZmWRKY43 gene knockout in negative regulation of drought response in maize, characterized by: The CDS sequence of the ZmWRKY43 gene is shown in SEQ ID NO.

2.

3. Application of biomaterials with the ZmWRKY43 gene knocked out in the negative regulation of drought response in maize, characterized in that, The CDS sequence of the ZmWRKY43 gene is shown in SEQ ID NO.2; The biomaterial is any one of the following: A: An expression cassette capable of silencing the ZmWRKY43 gene with a CDS sequence as shown in SEQ ID NO.2; B: A recombinant vector containing the expression cassette described in A; C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

4. The application of the ZmWRKY43 gene in maize breeding, characterized by: The CDS sequence of the ZmWRKY43 gene is shown in SEQ ID NO.

2.

5. The application of the ZmWRKY43 gene in the breeding of drought-resistant maize germplasm, characterized in that, The CDS sequence of the ZmWRKY43 gene is shown in SEQ ID NO.2.

Images