Method for enhancing oxidative stress resistance of immune cells based on PRMT2 gene editing and application

By knocking out PRMT2 through gene editing, the antioxidant stress resistance of T cells and CAR-T cells is enhanced, which solves the problems of low survival rate and impaired function in the tumor microenvironment and achieves a stronger tumor killing effect.

CN121931053APending Publication Date: 2026-04-28EAST CHINA NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
EAST CHINA NORMAL UNIV
Filing Date
2025-12-30
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

In existing technologies, T cells and CAR-T cells suffer from low survival rates and impaired function due to oxidative stress in the tumor microenvironment. Existing strategies, such as overexpression of exogenous antioxidant enzymes, have off-target effects and instability, and there is a lack of effective methods to enhance endogenous antioxidant capacity.

Method used

By targeting and knocking out the protein arginine methyltransferase 2 (PRMT2) using gene editing technology, the antioxidant stress capacity of T cells and CAR-T cells is enhanced, the ability to clear ROS and the production of key cytokines are increased, and the killing ability against tumor cells is strengthened.

Benefits of technology

It significantly improved the survival rate and functional activity of T cells and CAR-T cells under oxidative stress conditions, enhanced their ability to kill tumor cells, and overcame the functional limitations in the oxidative stress environment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a method for enhancing the oxidative stress resistance of immune cells based on PRMT2 gene editing and application, and belongs to the technical fields of biology, biotechnology and immunotherapy. The invention further discloses a method for targeted knockout of protein arginine methyltransferase PRMT2 and application. The method can specifically, efficiently and stably silence expression of PRMT2. Experiments prove that the knockout of the PRMT2 can enhance the ROS removal capability of CD4 + T cells and CD8 + T cells and improve the oxidation resistance, so that the survival under oxidative stress and the generation of cell factors are enhanced; the killing activity of the CAR-T cells on tumor cells is effectively improved. The invention also discloses PRMT2 as an epigenetic inhibition factor of T cell immunity and a useful therapeutic target in infection and cancer immunotherapy. The method has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biology, biotechnology and immunotherapy, and relates to a method and application of enhancing the antioxidant capacity of immune cells based on PRMT2 gene editing. Specifically, it relates to a method for enhancing the survival rate and functional activity of T cells, especially CAR-T cells, under oxidative stress by knocking out the protein arginine methyltransferase 2 (PRMT2) through gene editing technology, and its application in the preparation of anti-tumor immune cell preparations. Background Technology

[0002] T-cell-based immunotherapy, especially chimeric antigen receptor T-cell (CAR-T) therapy, has shown great potential in treating tumors and infectious diseases. However, its efficacy is often limited by various inhibitory factors in the tumor microenvironment (TME), among which oxidative stress is a key factor. Under pathological conditions, high levels of reactive oxygen species (ROS) disrupt the redox balance within T cells, leading to oxidative damage to lipids, proteins, and DNA, thereby inhibiting T-cell proliferation, promoting apoptosis, and weakening cytokine secretion, ultimately limiting the effectiveness of immunotherapy. The high-intensity and persistent oxidative levels in the tumor microenvironment impair T-cell immunity and the efficacy of T-cell-based immunotherapy. Currently, enhancing the antioxidant capacity of T cells and CAR-T cells, alleviating oxidative damage, and restoring their survival and effector functions have become critical issues that urgently need to be addressed.

[0003] In hematologic malignancies such as leukemia, oxidative stress is particularly prominent in CAR-T cell therapy. The high metabolic activity of leukemia cells and immune cells leads to the continuous accumulation of reactive oxygen species (ROS), impairing mitochondrial function of CAR-T cells, interfering with their metabolic reprogramming, and inducing functional exhaustion, resulting in limited therapeutic efficacy and poor in vivo persistence. Currently, strategies to enhance the antioxidant capacity of T cells are still imperfect. Although some studies have attempted to clear ROS by overexpressing exogenous antioxidant enzymes (such as catalase CAT), this strategy has potential off-target effects and expression instability. Therefore, identifying endogenous regulatory targets to fundamentally enhance the inherent antioxidant capacity of T cells is an important direction for improving the efficacy of immunotherapy. Protein arginine methyltransferase 2 (PRMT2) is a member of the PRMT family, whose main function is to catalyze the monomethylation and asymmetric dimethylation of arginine residues in proteins, participating in various cellular processes such as transcriptional regulation and signal transduction. However, the role of PRMT2 in T cell function, especially in regulating oxidative stress responses, has not been clearly reported. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention aims to overcome the technical deficiencies of low survival rates and impaired function of immune cells such as T cells and CAR-T cells in the tumor microenvironment due to oxidative stress. Specifically, this invention provides a novel method for enhancing the antioxidant capacity and anti-tumor efficacy of immune cells by targeting and regulating endogenous genes. Specifically, it provides a method for enhancing the survival rate and functional activity of T cells, especially CAR-T cells, under oxidative stress by knocking out the protein arginine methyltransferase 2 (PRMT2) using gene editing technology, and its application in the preparation of anti-tumor immune cell preparations. This invention also provides a method and its application for alleviating oxidative damage to T cells based on epigenetic modification, a method and its application for immune cells based on PRMT2 gene editing, a method and its application for preparing immune cells with enhanced antioxidant capacity, and a method and its application for enhancing the antioxidant capacity of immune cells based on PRMT2 gene editing.

[0005] In one specific embodiment, this invention first constructs CAR-T cells targeting CD19 B lymphoma. Based on this, it further constructs CAR-T cells with the protein arginine methyltransferase PRMT2 knocked out. It is proposed that PRMT2 knockout can significantly enhance the ROS clearance capacity of T cells, improve overall antioxidant levels, thereby effectively improving the survival rate of T cells under oxidative stress conditions, and promote the production of key cytokines such as IFN-γ and Granzyme B, enhancing the cytotoxicity of CAR-T cells and thus improving their ability to kill tumor cells. This invention suggests that PRMT2 can serve as a potential intervention target for enhancing the efficacy of CAR-T and other immunocellular therapies, providing a new approach to overcoming the functional limitations of existing T-cell therapies in oxidative stress environments.

[0006] In one specific embodiment, this invention, through in-depth research, proposes for the first time that PRMT2 plays the role of a negative regulator of oxidative stress in T cells. By specifically knocking out PRMT2, the ROS clearance capacity of T cells can be significantly enhanced, their overall antioxidant level can be improved, thereby effectively improving their survival rate under oxidative stress conditions, and promoting the production of key effector cytokines (such as IFN-γ, Granzyme B, etc.), ultimately enhancing the tumor-killing ability of CAR-T cells.

[0007] The method and application of enhancing the antioxidant stress capacity of immune cells based on PRMT2 gene editing described in this invention are proposed for the first time. The main innovation of this invention is the discovery that knocking out PRMT2 can alleviate oxidative stress and damage to immune cells, thereby enhancing immune function and increasing the killing activity against target cells. The main focus is on the target and cells edited based on the target.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] This invention provides an engineered immune cell in which the expression and / or activity of the PRMT2 gene has been selectively blocked / inhibited / reduced / knocked out.

[0010] Specifically, the engineered immune cells are an innovative concept proposed in this invention.

[0011] In one specific embodiment, the engineered immune cells include gene-edited immune cells, etc.

[0012] The present invention also provides a method for constructing engineered immune cells as described above, the method comprising selectively blocking / inhibiting / reducing / knocking out the expression and / or activity of the PRMT2 gene in immune cells to obtain engineered immune cells.

[0013] Furthermore, the construction method also includes introducing a genetically engineered antigen receptor that specifically binds to the target antigen into the immune cells.

[0014] The present invention also provides engineered immune cells obtained by the construction method described above.

[0015] The present invention also provides a cell preparation, which includes engineered immune cells as described above.

[0016] In one specific embodiment, the cell preparation further includes prmt2. - / - CD4 + T cells, prmt2 - / - CD8 + T cells, CAR-prmt2 - / - CD4 + T cells, CAR-prmt2 - / - CD8 + One or more of the following: T cells, etc.

[0017] The present invention also provides a drug / drug composition comprising one or more of the engineered immune cells and cell preparations described above.

[0018] Furthermore, the pharmaceutical composition includes a pharmaceutically acceptable carrier, etc.

[0019] Preferably, the pharmaceutically acceptable carrier refers to a carrier that, when properly administered to animals or humans, does not produce adverse, allergic, or other adverse reactions. Pharmaceutically acceptable carriers include, but are not limited to: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium methylcellulose, ethylcellulose, and methylcellulose; tragacanth gum powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers such as Tween; wetting agents such as sodium lauryl sulfate; colorants; flavoring agents; tableting agents; stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic salt solutions; and phosphate buffers, etc. These substances are used as needed to help stabilize the formulation or to improve its activity or bioavailability or to produce an acceptable taste or smell when taken orally.

[0020] Specifically, the pharmaceutical composition may also contain physiologically compatible excipients, including buffers, diluents, excipients, fillers, binders, humectants, disintegrants, absorption enhancers, surfactants, adsorbents, lubricants, etc.

[0021] Specifically, the drug / drug composition includes liquid dosage forms, gaseous dosage forms, solid dosage forms, and semi-solid dosage forms.

[0022] Specifically, the pharmaceutical composition can be formulated into injections, sterile powders for injection, tablets, pills, capsules, lozenges, liniments, powders, granules, syrups, solutions, tinctures, aerosols, powder inhalers, or suppositories, etc. All of the above dosage forms of the drug / pharmaceutical composition can be prepared according to conventional methods in the pharmaceutical field.

[0023] Specifically, the pharmaceutical composition is administered orally, by injection, nasal administration, transdermal administration, or mucosal administration.

[0024] Specifically, the pharmaceutical composition can be introduced into the body, such as into muscles, intradermal tissues, subcutaneous tissues, veins, or mucous membranes, via injection, spray, nasal drops, eye drops, penetration, absorption, or physical or chemical mediated methods; or it can be introduced into the body after being mixed with or encapsulated by other substances. Preferably, it is administered by injection. The drug / pharmaceutical composition can also be used in combination with other treatment methods, including surgery, radiotherapy, chemotherapy, and targeted therapy.

[0025] The dosage level of the pharmaceutical composition described in this invention can be adjusted according to the amount of composition required to achieve the desired diagnostic or therapeutic outcome. The administration regimen can also be a single injection or multiple injections, or adjustments thereof. The selected dosage level and regimen are subject to reasonable adjustment based on various factors, including the activity and stability (i.e., half-life) of the cellular drug / pharmaceutical composition, the formulation, the route of administration, the combination with other drugs or treatments, the disease or condition to be detected and / or treated, and the health status and prior medical history of the subject to be treated.

[0026] The therapeutically effective amount of the pharmaceutical composition described in this invention can initially be estimated in cell culture experiments or animal models such as rodents, rabbits, dogs, pigs, and / or primates. Animal models can also be used to determine suitable concentration ranges and routes of administration. These can then be used to determine the effective dose and route of administration in humans. Generally, the determination and adjustment of the effective dose or dosage, and the assessment of when and how to make such adjustments, are known to those skilled in the art.

[0027] For further guidance on formulations, dosages, administration regimens, and measurable treatment outcomes, see Berkow et al. (2000) The Merck Manual of Medical Information and Merck & Co. Inc., Whitehouse Station, New Jersey; Ebadi (1998) CRC Desk Reference of Clinical Pharmacology.

[0028] Furthermore, the pharmaceutical composition may also contain other drugs, etc.

[0029] The present invention also provides a method for enhancing the antioxidant stress resistance of immune cells, wherein the method enhances the antioxidant stress resistance of immune cells by reducing and / or knocking out the expression or activity of the PRMT2 gene in the immune cells.

[0030] In one specific embodiment, the method includes reducing or knocking out the expression or activity of the PRMT2 gene in the immune cells through gene editing, thereby enhancing the immune cells' ability to resist oxidative stress.

[0031] Preferably, the gene editing method employs the Cre / loxP system.

[0032] Furthermore, the primers used in the Cre / loxP system target a specific sequence of the PRMT2 gene. The design and application of the sgRNA is one of the key aspects of this invention.

[0033] In one specific implementation, the method includes the following steps:

[0034] The first step was to design and synthesize sgRNA targeting the PRMT2 gene.

[0035] The second step involves introducing a gene-editing system containing the sgRNA and Cas9 protein synthesized in the first step into isolated T cells.

[0036] The third step is to culture the T cells introduced in the second step to knock out the PRMT2 gene and obtain PRMT2 knockout T cells.

[0037] Optionally, the PRMT2 knockout T cells are transduced with CAR to prepare PRMT2 knockout CAR-T cells.

[0038] The present invention also provides a population of PRMT2 knockout immune cells (such as T cells, CAR-T cells, etc.) prepared by the above method.

[0039] The present invention also provides a method for preventing / inhibiting / alleviating / reducing / treating a disease, the method comprising administering to a subject in need one or more of the following: engineered immune cells as described above, cell preparations as described above, drugs / pharmaceutical compositions as described above. The method may also be in vitro or non-therapeutic.

[0040] Specifically, the object or individual for preventing / inhibiting / alleviating / reducing / treating the disease is preferably a mammal, including but not limited to humans, primates, livestock (such as sheep, cattle, horses, donkeys, and pigs), pets (such as dogs and cats), laboratory test animals (such as mice, rabbits, rats, guinea pigs, and hamsters), or captured wild animals (such as foxes and deer). Preferably, the object is a primate. Most preferably, the object is a human.

[0041] Specifically, the subject may be a patient with a disease or an individual who wishes to prevent the disease. One or more of the engineered immune cells, cell preparations, and drugs / drug compositions described above may be administered to the subject before, during, or after disease treatment.

[0042] The present invention also provides a primer whose nucleotide sequence includes one or more of the nucleotide sequences shown in SEQ ID NO:1-11.

[0043] The present invention also provides a primer pair, wherein the nucleotide sequence of the primer pair includes two or more of the nucleotide sequences shown in SEQ ID NO:1-11.

[0044] This invention also provides applications of the engineered immune cells, cell preparations, drugs / drug compositions, methods, primers, or primer pairs described above in epigenetic modification to alleviate T cell oxidative damage, preparation of immune cells with enhanced antioxidant capacity, immunotherapy for infection and cancer, therapeutic targets useful in immunotherapy for infection and cancer, enhancing T cell ROS clearance capacity, improving overall T cell antioxidant level, effectively improving T cell survival rate under oxidative stress, enhancing CAR-T cell cytotoxicity, improving the killing ability of immune cells against tumor cells, intervention targets for the efficacy of immunocellular therapy, overcoming the functional limitations of existing T cell therapies in oxidative stress environments, enhancing the efficacy of immunocellular therapy, and enhancing antioxidant capacity.

[0045] This invention also provides the application of the engineered immune cells, cell preparations, drugs / drug compositions, methods, primers, or primer pairs described above in the preparation of immune cells for the prevention / inhibition / alleviation / reduction / treatment of diseases, for the treatment of tumors or infectious diseases, for epigenetic modification to alleviate T cell oxidative damage, for enhancing antioxidant stress capacity, for immunotherapy of infections and cancer, for enhancing T cell ROS clearance capacity, for improving the overall antioxidant level of T cells, for effectively improving the survival rate of T cells under oxidative stress, for enhancing the cytotoxicity of CAR-T cells, for improving the killing ability of immune cells against tumor cells, for enhancing the efficacy of immunotherapy, and for enhancing antioxidant stress capacity.

[0046] This invention also provides the application of the PRMT2 gene as a target, as described above, in epigenetic modification to alleviate T cell oxidative damage, preparation of immune cells with enhanced antioxidant stress capacity, immunotherapy for infection and cancer, a useful therapeutic target in immunotherapy for infection and cancer, enhancing the ability of T cells to clear ROS, improving the overall antioxidant level of T cells, effectively improving the survival rate of T cells under oxidative stress, enhancing the cytotoxicity of CAR-T cells, improving the killing ability of immune cells against tumor cells, an intervention target for the effect of immunotherapy, overcoming the functional limitations of existing T cell therapies in oxidative stress environments, enhancing the effect of immunotherapy, and enhancing antioxidant stress capacity.

[0047] This invention also provides the application of the PRMT2 gene as a target, as described above, in the preparation of drugs for the prevention / inhibition / alleviation / reduction / treatment of diseases, for the treatment of tumors or infectious diseases, for epigenetic modification to alleviate T cell oxidative damage, for enhancing the antioxidant stress capacity of immune cells, for immunotherapy of infections and cancer, for enhancing the ROS clearance capacity of T cells, for improving the overall antioxidant level of T cells, for effectively improving the survival rate of T cells under oxidative stress, for enhancing the cytotoxicity of CAR-T cells, for improving the killing ability of immune cells against tumor cells, for enhancing the effect of immunotherapy, and for enhancing the antioxidant stress capacity.

[0048] In one specific embodiment, the present invention also provides the use of the PRMT2 knockout immune cells in the preparation of medicaments for treating tumors or infectious diseases. Preferably, the tumor is B-cell lymphoma or the like.

[0049] In one specific embodiment, the present invention also provides the application of the PRMT2 gene as a target, as described above, in enhancing the efficacy of immune cell therapy.

[0050] In one specific embodiment, the present invention also provides the application of the PRMT2 gene as a therapeutic target in infection and cancer immunity, as described above.

[0051] In this invention, the immune cells include one or more of NK cells, T cells, monocytes, macrophages, and granulocytes. Preferably, the immune cells are T cells, and more preferably CD4 cells. + T cells, CD8 + T cells, CAR-CD4 + T cells or CAR-CD8 + One or more of T, etc.

[0052] In one specific embodiment, the immune cells further comprise genetically engineered antigen receptors that specifically bind to target antigens.

[0053] In one specific embodiment, the immune cells further comprise CD19-targeting cells. + Genetically engineered antigen receptors for B-cell lymphoma, etc.

[0054] In one specific embodiment, the immune cells further comprise CD19-targeting cells. + Chimeric antigen receptor (CAR) and other factors associated with B-cell lymphoma.

[0055] In one specific embodiment, the immune cells further include a second genetically engineered antigen receptor that recognizes different antigens.

[0056] In one specific embodiment of the present invention, the disease includes one or more of the following: tumors, infectious diseases, etc.

[0057] In one specific embodiment, the tumor includes B-cell lymphoma, etc.

[0058] In one specific embodiment of the present invention, the nucleotide sequence described above includes a nucleotide sequence having at least 85% sequence identity with the nucleotide sequence; or a nucleic acid sequence having the same function as the nucleotide sequence formed by substitution, deletion or addition of one or more nucleic acid bases; or a nucleotide sequence that hybridizes with the nucleotide sequence or its full-length complement under stringent conditions; or a nucleotide sequence that is distinct from the nucleotide sequence due to the degeneracy of the genetic codon.

[0059] In one specific embodiment of the present invention, the amino acid sequence described above includes: an amino acid sequence having at least 85% sequence identity with the amino acid sequence; or an amino acid sequence having the same function but with one or more amino acid residues substituted, deleted, or added; or an amino acid fragment expressed having the same function after substitution, deletion, or addition of one or more nucleic acid bases based on the coding nucleotide sequence of the amino acid sequence; or an amino acid sequence having the same function that can hybridize with the coding nucleotide sequence of the amino acid sequence under moderately stringent conditions and encode the same function.

[0060] Compared with existing technologies, the beneficial effects of this invention include: Novel target: For the first time, it reveals that PRMT2 is a key negative regulator of T cell anti-oxidative stress capacity, and its knockout can serve as a new strategy to enhance immune cell function. Significant effects: Compared with wild-type T cells, PRMT2 knockout T cells show significantly reduced intracellular ROS levels under oxidative stress conditions. PRMT2 knockout T cells exhibit reduced apoptosis levels, weakened caspase-3 activity, and increased survival rates. PRMT2 knockout T cells (including CAR-T cells) show significantly enhanced ability to secrete effector cytokines such as IL-2, IFN-γ, Granzyme B, and TNF-α. In in vitro killing experiments, PRMT2 knockout CAR-T cells exhibit stronger cytotoxicity against target cells (such as B-cell lymphoma cells) and can more effectively induce target cell apoptosis. The method provided by this invention can significantly improve the durability and efficacy of adoptive immunotherapy such as CAR-T in the oxidative stress tumor microenvironment, providing a new solution and drug development target for overcoming existing immunotherapy bottlenecks.

[0061] The beneficial effects of this invention also include: compared with WT (wild-type) T cells, prmt2 - / -T cells showed lower intracellular ROS levels, increased IL-2 and IFN-γ expression, and lower apoptosis levels and caspase 3 activity, indicating that prmt2 knockout T cells had stronger antioxidant capabilities and alleviated oxidative stress-induced apoptosis and functional impairment. This suggests that prmt2 knockout T cells have stronger antioxidant capacity. Compared with WT CAR-T cells, prmt2 - / - Increased expression of IL-2, IFN-γ, Granzyme B, and TNF-α in T cells, along with increased secretion of IL-2 and IFN-γ, enhances cytotoxicity against B-cell lymphoma cells and exacerbates apoptosis and caspase-3 activity in target cells. This indicates that prmt2 knockout T cells possess stronger immune function and tumor-killing ability. Attached Figure Description

[0062] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0063] Figure 1 This demonstrates the construction and identification of PRMT2 knockout mice.

[0064] Figure 2 : This shows PRMT2 knockout (prmt2) - / - Flow cytometry plot comparing intracellular ROS levels of T cells and wild-type (WT) T cells under H2O2-induced oxidative stress, and statistical graph of antioxidant gene expression.

[0065] Figure 3 : Shows CAR-T cells with PRMT2 knockout (prmt2 - / - A comparison of the killing efficiency of CAR-T cells and wild-type CAR-T cells (WTCAR-T) against B lymphoma cells in an in vitro co-culture system (detected by apoptosis and LDH release assay).

[0066] Figure 4 The graph shows a flow cytometry comparison and statistical plot of intracellular IFN-γ and Granzyme B expression levels in PRMT2 knockout CAR-T cells and wild-type CAR-T cells after stimulation, as well as the secretion of IL-2 and TNF-α. Detailed Implementation

[0067] The present invention will be described in detail below with reference to embodiments and accompanying drawings. Except for the contents specifically mentioned below, the processes, conditions, and experimental methods for implementing the present invention are all common knowledge and general knowledge in the art, and the present invention does not have any particular limitations.

[0068] The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the invention or its application or use. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.

[0069] In all examples shown and discussed herein, any specific values ​​should be interpreted as merely exemplary and not as limitations. Therefore, other examples of exemplary embodiments may have different values.

[0070] This invention discloses a method and application for preparing immune cells that alleviate oxidative stress in T cells and enhance their anti-tumor effects, belonging to the field of biological technology. This invention also provides a method and application for targeted knockout of the protein arginine methyltransferase PRMT2, which can specifically, efficiently, and stably silence PRMT2 expression. Experiments of this invention demonstrate that PRMT2 knockout can enhance CD4+ expression. + T cells and CD8 + The invention enhances the ROS scavenging capacity of T cells, improves antioxidant capacity, thereby enhancing survival under oxidative stress and cytokine production; and effectively improves the cytotoxic activity of CAR-T cells against tumor cells. This invention establishes PRMT2 as an epigenetic repressor of T cell immunity and a useful therapeutic target in the immunotherapy of infection and cancer.

[0071] The reagents, instruments, and experimental methods used in the following examples, unless otherwise specified, were performed under conventional or supplier-recommended conditions.

[0072] In the following embodiments of the present invention, mouse PRMT2 (GenBank: BC125275.1) and target cells were all CD19. + A20B lymphoma cells; T cells are mainly CD4+. + T cells and CD8 + T cells.

[0073] Example 1: Construction of PRMT2 gene knockout mouse model

[0074] (1) Design and construction of gene knockout vectors:

[0075] Design a targeting vector for homologous recombination. The vector contains: a long DNA sequence (homologous arm) homologous to the flanking region of the mouse PRMT2 genome; such as Figure 1 As shown in Figure A, loxP1 and loxP2 sites were inserted flanking the key coding exon of PRMT2 to form the "Floxed" allele; the lacZ reporter gene was driven by the endogenous PRMT2 promoter; and a drug resistance marker gene was used for positive and negative screening. Identification primers were designed as follows: loxP2 primer pair (upstream: CCCCCTGAACCTGAAACAT (SEQ ID NO:1), downstream: CCGCCTACTGCGACTATAGA (SEQ ID NO:2), product 349 bp); lacZ primer pair (upstream: GAGCTTGGGTAATAAGCGTTGGCAAATT (SEQ ID NO:3), downstream: GCAGTAAGGCGGTCGGGATAGTTT (SEQ ID NO:4), product 488 bp).

[0076] (2) Embryonic stem cell targeting and first-generation mouse culture:

[0077] The targeting vector was electroporated into embryonic stem cells (ES cells) of a black-haired mouse strain, and positive ES clones were obtained through drug screening. These positive ES cell clones were microinjected into host blastocysts and transplanted into the uterus of pseudopregnant mice, resulting in the birth of chimeric first-generation mice. These first-generation mice were then mated with wild-type C57BL / 6N mice to obtain stably inherited F1 generation mice.

[0078] (3) Genotyping:

[0079] Preliminary screening: PCR was performed using the loxP2 and lacZ primer pairs (SEQ ID NO:1-4), and the amplification of the expected bands indicated the integration of the exogenous sequence.

[0080] Template preparation for PCR amplification:

[0081] reagents

[0082] Lysis Buffer 1

[0083] reagents Dosage ( / 250ml) Final concentration 10N NaOH 625 ul 25mM 0.5M EDTA 100 ul 0.2mM

[0084] Lysis Buffer 2

[0085] reagents Dosage ( / L) Final concentration Tris-HCl 4.8456g 40mM

[0086] When the size of the PCR amplification product is less than 1000bp, it can be used as template DNA for DNA extraction (referring to the tail DNA of the F1 generation mice in step (2)).

[0087] The specific steps of the G1+G2 extraction method are as follows:

[0088] (1) Add 100 μL of lysis buffer 1 to each tube of tissue and centrifuge at 12000g for 15 seconds (centrifuge the tissue to the bottom of the tube. After centrifugation, confirm that the tissue has been completely centrifuged to the bottom of the tube and then soak it in lysis buffer 1).

[0089] (2) Heat at 95℃ for 20 minutes;

[0090] (3) Centrifuge at 12000g for 15s to bring the liquid to the bottom of the tube;

[0091] (4) Then add 100 μl of lysis buffer 2 and vortex to mix. Centrifuge at 12000 g to the bottom of the tube. Store at 4℃ for later use. This sample is best used immediately and should not be stored for a long time (not more than one week).

[0092] Knockout allele identification: PCR was performed using Prmt2 locus-specific primers. The shared upstream primer was GGGTAGGTTACTCAGAAAGCGAAGC (SEQ ID NO:5). The downstream primer Prmt2-WT-R1 (TTCAGCCTTACCCCGAACATTACC (SEQ ID NO:6)) was used to amplify the wild-type fragment (577 bp). The downstream primer Prmt2-KO-R1 (TCCTACATAGTTGGCAGTGTTTGGG (SEQ ID NO:7)) was used to amplify the knockout fragment (334 bp). Genotype was determined based on the band combinations.

[0093] Long fragment PCR validation: Validation was performed using 5' homologous arm primer pairs (5F2: GGGCTAGTCACTCCTCTTCTGTATG (SEQ ID NO:8), 5R2: GCTTGTCCCTCTTTGTTAGGGTTCT (SEQ ID NO:9), product 5.9kb) and 3' homologous arm primer pairs (3F2: CTCCTGCCGAGAAAGTATCCATC (SEQ ID NO:10), 3R2: CCTCATTCCAAGGATCAAGTGATTG (SEQ ID NO:11), product 6.9kb) to ensure accurate homologous recombination.

[0094] like Figure 1 B and Figure 1 As shown in C, correctly identified heterozygous mice were mated to obtain homozygous knockout of the PRMT2 gene (prmt2). - / - The study used mice, and Western blotting confirmed that no PRMT2 protein was expressed in the spleen leukocyte samples of knockout mice.

[0095] Example 2: Effect of PRMT2 knockout on the antioxidant capacity of T cells

[0096] (1) Lymphocyte isolation and activation:

[0097] Take WT (wild type) and prmt2 - / - Mouse spleen was used to prepare single-cell suspensions. Red blood cells were lysed and mouse spleen single-cell suspensions were prepared using ACK red blood cell lysis buffer.

[0098] ACK Red Blood Cell Lysis Buffer

[0099] reagents Dosage ( / 1000ml) Final concentration NH4CL 625 ul 25mM 0.5M EDTA 100 ul 0.2mM

[0100] Red blood cell lysis method: Mouse spleen was aseptically harvested, washed with RPMI 1640 medium, and the tissue was ground to prepare a cell suspension. The suspension was transferred to a 15 mL centrifuge tube, centrifuged at 2000 rpm for 3 min, and the supernatant was discarded. 3 mL of ACK red blood cell lysis buffer was added to fully suspend the cells. The suspension was allowed to stand for 1 min to fully lyse the red blood cells. 12 mL of RPMI 1640 medium was added and mixed thoroughly. The suspension was centrifuged at 2000 rpm for 3 min, and the supernatant was discarded. The cells were then resuspended in RPMI 1640 medium (10% FBS + 1% penicillin / streptomycin) for later use.

[0101] T cells were activated by using 24-well plates coated with anti-CD3 antibody (2 μg / mL) and adding anti-CD28 antibody (2 μg / mL) and lymphocytes.

[0102] (2) ROS (Reactive Oxygen Species) Level Detection:

[0103] T cells were stimulated with 10 µM H2O2 for 8 hours to activate them. Cells were collected and incubated with a DCFH-DA probe (10 µM) at 37°C for 20 minutes. After washing, cells were stained with PE-anti-mouse CD4 and APC-anti-mouse CD8 antibodies, and CD4 counts were detected by flow cytometry. + and CD8 + ROS levels in T cells ( Figure 2 ).

[0104] like Figure 2 A, the results show that prmt2 - / - The ROS level of T cells was significantly lower than that of WT T cells, indicating that prmt2 - / - T cells have a stronger ability to clear ROS.

[0105] (3) Enzyme activity detection:

[0106] Take 2 x 10 6 One WT or PRMT2 - / -Mouse spleen leukocytes were added to 24-well cell culture plates, and 2 μg / mL of anti-mouse CD3 monoclonal antibody and anti-mouse CD28 monoclonal antibody were added to activate T cells. After 24 h of activation, the cells were collected and washed once with PBS. After sonication, the cells were centrifuged at 12000 rpm for 5 min, and the supernatant was collected. The enzyme activity of the specified enzyme was detected according to the total superoxide dismutase assay kit (Nanjing Jiancheng, A001-3-2) or the glutathione peroxidase assay kit (Nanjing Jiancheng, A005-1-2).

[0107] like Figure 2 B shows that prmt2 - / - SOD1 and GSH-px enzyme activities were higher in T cells than in WT cells, indicating that prmt2 - / - T cells have stronger antioxidant capabilities.

[0108] Example 3: Construction of CD19-targeting CAR-T cells and preparation of PRMT2 knockout CAR-T cells

[0109] (1) Construction of CAR molecules:

[0110] Using the MSCV retroviral vector as a backbone, WPRE (marmot hepatitis virus post-transcriptional regulatory element) elements were inserted. An anti-mouse CD19 CAR sequence was synthesized, containing: 1D3 scFv, mouse 4-1BB intracellular domain, and mouse CD3ζ intracellular region. The CAR and GFP were tandemly linked via the P2A sequence and cloned into the MSCV vector (…). Figure 1 ), thus obtaining the mCD19-GFP-CAR plasmid.

[0111] (2) Preparation of CAR-T cells:

[0112] Retrovirus preparation: BOSC23 cells were co-transfected with the mCD19-GFP-CAR plasmid or GFP control plasmid obtained in step (1) and the PCL-ECO helper plasmid. Viral supernatant was collected 72 hours later. Frozen BOSC23 cells were removed from liquid nitrogen, thawed, and passaged 1-3 times. Subsequently, BOSC23 cells were digested with 500 μL trypsin at 37°C, resuspended in 5 mL DMEM medium, centrifuged at 1000 rpm for 3 min, the supernatant was discarded, and the cell pellet was collected. After resuspending and counting, 2 × 10⁶ cells were seeded per 60 mm culture plate. 6 -2.2×10 6Seed cells onto a plate. When cell confluence reaches 75%-85%, discard the original culture medium and slowly add 3 mL of DMEM medium containing 25 μM chloroquine (containing 1% penicillin antibody and 10% FBS), and incubate at 37°C. Simultaneously, add 5 μg of the mCD19-GFP-CAR plasmid or GFP control plasmid obtained in step (1), 1.5 μg of pCL-ECO plasmid, and 30 μL of 2.5 M CaCl2 to an EP tube, and add sterile water to a final volume of 500 μL to form a mixed system. Then, gently blow bubbles with a glass tube while simultaneously adding 500 μL of 2×HEBS buffer to form a transfection system. After mixing this 1 mL transfection system, add it dropwise to the cell culture plate, gently shake to mix, and then perform transfection. After 8 h of transfection, replace the medium with 3 mL of DMEM medium (1% penicillin antibody and 10% FBS), and change the medium 1-2 times periodically during this period. The supernatant was collected 12 h after the last medium change, centrifuged at 1200 rpm for 5–10 min to obtain a suspension containing retroviruses, aliquoted and stored at -80℃.

[0113] Viral-infected T cells: 6-8 week old female WT or prmt2 cells were used. - / - Mouse spleens were ground to obtain a single-cell suspension, which was then resuspended in RPMI 1640 medium to a concentration of 2 × 10⁻⁶ cells / mL. 6 Cells were seeded at a density of 1 / ml into 24-well plates treated with different stimulants (1 ml per well), and 100 U / ml IL-2 was added. The plates were then incubated at 37 ℃ in a 5% CO2 incubator. After 48 h of activation, the activated T cells from the 24-well plates were transferred to 6-well plates, with 3 mL of the corresponding virus added to each well, along with polybrene (final concentration 5 μg / mL) virus infection enhancement medium. After centrifugation at 1500 × g, 30 ℃ for 90 min, the plates were incubated at 37 ℃ in a 5% CO2 incubator for another 6–8 h. The culture medium was then replaced with fresh medium, and 100 U / mL IL-2 was added for another 48 h of incubation. Flow cytometry analysis confirmed that the GFP+ T cells were CAR-T cells (WT CAR-T cells, prmt2). - / - CAR-T cells).

[0114] CAR-T cells (WT CAR-T cells, prmt2) - / - Co-incubation of CAR-T cells and A20 B lymphoma cells: After counting the collected CAR-T cells, they were cultured with A20 B lymphoma cells at an effector-target ratio of 1:1 in 24-well plates (5 × 10⁶ cells per well). 5 After incubating A20 B lymphoma cells for 24 h, flow cytometry was used to detect apoptosis of A20 B lymphoma cells and cytokine expression of CAR-T cells.

[0115] Example 4: Evaluation of effector function of PRMT2 knockout CAR-T cells

[0116] (1) In vitro killing experiment:

[0117] The WT CAR-T cells and prmt2 obtained in Example 3 of this invention were used. - / - CAR-T cells were co-cultured with A20 B-cell lymphoma cells for 24 h. Cells were collected, washed once with PBS, and stained with PE-CY7 anti-mouse CD4, APC-anti-mouse CD8, and PE-anti-mouse CD107a on ice for 30 min. The expression of CD107a in T cells was detected by flow cytometry using FACS Buffer (PBS with 1% FBS). Figure 3 A, the results indicate that prmt2 - / - CAR-CD4 + T and prmt2 - / - CAR-CD8 + The expression of CD107a in T cells was significantly higher than that in WT cells with CAR-CD4. + T and WT CAR-CD8 + T. Furthermore, the cytotoxicity of CAR-T cells against A20 B lymphoma cells was assessed using an LDH release kit (Invitrogen, C20300). For example... Figure 3 D, the results show that prmt2 - / - CAR-T cells exhibit stronger killing activity.

[0118] (2) Detection of target cell apoptosis:

[0119] After co-culturing in step (1), cells were collected, and target cells were stained with PE-CY7 anti-mouse CD19. After incubation on ice for 30 min, the cells were washed once with FACS Buffer. Then, cells were stained with APC-Annexin V and 7-AAD, and CD19 was detected by flow cytometry. + Apoptosis of target cells. Simultaneously, CD19... +Intracellular cleaved caspase-3 antibody staining of target cells: After CD19 staining as described above, cells were fixed on ice for 30 min with BD Cytofix / Cytoperm buffer (Catalog #554722, BD Biosciences), then washed twice with 1× BD Perm / Wash buffer (Catalog #554723, BD Biosciences), and stained with Rabbit anti-mouse cleaved caspase-3 monoclonal antibody for 30 min. Following this, staining was continued on ice for 30 min in the dark with AF647 Goat anti-rabbit IgG (1:2000). After staining, cells were washed with 1× BD Perm / Wash buffer and analyzed by flow cytometry. Figure 3 B and 3C, the results show that prmt2 - / - In the CAR-T cell group, Annexin V in target cells + Both the cell ratio and cleaved caspase-3 activity were higher, indicating that prmt2 - / - CAR-T cells have a stronger ability to kill target cells.

[0120] (3) Detection of cytokines and effector molecules:

[0121] The CAR-T cells (WT CAR-T cells, prmt2 cells) obtained in Example 3 of this invention were used. - / - CAR-T cells were co-cultured with target cells for 24 hours (with the addition of a Golgi inhibitor). Cells were collected, stained surface (CD4, CD8), fixed and perforated as described above, and then subjected to intracellular staining (APC anti-mouse IL-2, BV421 anti-mouse IFN-γ, PE anti-mouse Granzyme B) followed by flow cytometry analysis. Figure 4 The results showed that prmt2 - / - The proportion of CAR-T cells producing IFN-γ and Granzyme B, as well as their mean fluorescence intensity, were significantly higher than those of WT CAR-T cells. Simultaneously, without the addition of a Golgi apparatus inhibitor, the supernatant after incubation was collected, and the secretion of TNF-α and IL-2 in the supernatant was detected using the Mouse TNF-α ELISA Kit (Beyotime, PT513) and the Mouse TNF-α ELISA Kit (Beyotime, PI575). Figure 4 As shown, prmt2 - / -The levels of TNF-α and IL-2 secreted by CAR-T cells were significantly higher than those secreted by WT CAR-T cells.

[0122] This invention utilizes gene editing technology to knock out PRMT2, successfully generating T cells and CAR-T cells with enhanced antioxidant capacity and anti-tumor activity. This strategy provides an effective new approach to address the challenge of limited function in current immunocellular therapies within an oxidative stress microenvironment, possessing significant theoretical and clinical application value.

[0123] As used in this invention, the terms "comprising" and "including" are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0124] As used in this invention, the term "and / or" includes any one or more of the related listed items and all combinations thereof.

[0125] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. An engineered immune cell, characterized in that, The expression and / or activity of the PRMT2 gene in the immune cells are selectively blocked / inhibited / reduced / knocked out.

2. A method for constructing engineered immune cells as described in claim 1, characterized in that, The construction method includes selectively blocking / inhibiting / reducing / knocking out the expression and / or activity of the PRMT2 gene in immune cells to obtain the engineered immune cells.

3. The construction method as described in claim 2, characterized in that, The construction method further includes introducing a genetically engineered antigen receptor that specifically binds to the target antigen into the immune cells.

4. An engineered immune cell obtained by the construction method as described in claim 3.

5. A cell preparation, characterized in that, The cell preparation includes engineered immune cells as described in claim 1 or 4.

6. A drug / drug composition, characterized in that, The drug / drug composition includes one or more of the engineered immune cells as described in claim 1 or 4, and the cell preparation as described in claim 5.

7. A method for enhancing the antioxidant stress resistance of immune cells, characterized in that, The method enhances the antioxidant capacity of immune cells by reducing and / or knocking out the expression or activity of the PRMT2 gene in immune cells as described in claim 1.

8. A primer / primer pair, characterized in that, The nucleotide sequence of the primer includes one or more of the nucleotide sequences shown in SEQ ID NO:1-11; and / or, the nucleotide sequence of the primer pair includes two or more of the nucleotide sequences shown in SEQ ID NO:1-11.

9. An application characterized in that, The application includes one or more of the following: (1) The engineered immune cells as described in claim 1 or 4, or the construction method as described in claim 2 or 3, or the cell preparation as described in claim 5, or the drug / drug composition as described in claim 6, or the method as described in claim 7, or the primer / primer pair as described in claim 8 are used in epigenetic modification to alleviate T cell oxidative damage, preparation of immune cells with enhanced antioxidant stress capacity, immunotherapy for infection and cancer, therapeutic targets useful in immunotherapy for infection and cancer, enhancing the ability of T cells to clear ROS, improving the overall antioxidant level of T cells, effectively improving the survival rate of T cells under oxidative stress, enhancing the cytotoxicity of CAR-T cells, improving the killing ability of immune cells against tumor cells, intervention targets for the effect of immunotherapy, overcoming the functional limitations of existing T cell therapy in oxidative stress environment, enhancing the effect of immunotherapy, and enhancing antioxidant stress capacity. (2) The use of engineered immune cells as described in claim 1 or 4, or the construction method as described in claim 2 or 3, or the cell preparation as described in claim 5, or the drug / drug composition as described in claim 6, or the method as described in claim 7, or the primer / primer pair as described in claim 8 in the preparation of drugs for the prevention / inhibition / alleviation / reduction / treatment of diseases, for the treatment of tumors or infectious diseases, for epigenetic modification to alleviate T cell oxidative damage, for enhancing antioxidant stress capacity, for the immunotherapy of infection and cancer, for enhancing the ability of T cells to clear ROS, for improving the overall antioxidant level of T cells, for effectively improving the survival rate of T cells under oxidative stress, for enhancing the cytotoxicity of CAR-T cells, for improving the killing ability of immune cells against tumor cells, for enhancing the effect of immunotherapy, and for enhancing antioxidant stress capacity; (3) The PRMT2 gene as described in claim 1 is used as a target in epigenetic modification to alleviate T cell oxidative damage, preparation of immune cells with enhanced antioxidant stress capacity, immunotherapy for infection and cancer, a useful therapeutic target in immunotherapy for infection and cancer, enhancing the ability of T cells to clear ROS, improving the overall antioxidant level of T cells, effectively improving the survival rate of T cells under oxidative stress, enhancing the cytotoxicity of CAR-T cells, improving the killing ability of immune cells against tumor cells, an intervention target for the effect of immunotherapy, overcoming the functional limitations of existing T cell therapy in oxidative stress environment, enhancing the effect of immunotherapy, and enhancing antioxidant stress capacity. (4) The application of the PRMT2 gene as described in claim 1 as a target in the preparation of drugs for the prevention / inhibition / alleviation / reduction / treatment of diseases, for the treatment of tumors or infectious diseases, for the epigenetic modification to alleviate T cell oxidative damage, for the enhancement of antioxidant stress capacity of immune cells, for the immunotherapy of infection and cancer, for the enhancement of T cell ROS clearance capacity, for the improvement of the overall antioxidant level of T cells, for the effective improvement of T cell survival rate under oxidative stress, for the enhancement of CAR-T cell cytotoxicity, for the enhancement of immune cell killing capacity of tumor cells, for the enhancement of the effect of immune cell therapy, and for the enhancement of antioxidant stress capacity.

10. The engineered immune cells, cell preparations, drugs / drug compositions, methods, primers / primer pairs, and applications as described in any one of claims 1-9, characterized in that, The immune cells include one or more of NK cells, T cells, monocytes, macrophages, and granulocytes; and / or, The disease includes one or more of the following: tumors and infectious diseases.