Eel feed using schizochytrium microalgae and method for producing same

By using biomass from Schizochytrium microalgae as eel feed, the problem of fishmeal shortage was solved, achieving the effects of promoting eel growth and reducing costs.

CN121941418APending Publication Date: 2026-04-28CJ CHEILJEDANG CORP
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-07-03
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

The current shortage and high price of fishmeal have led to high costs for aquaculture feed, making the search for affordable and high-quality alternative protein sources a challenge for the industry.

Method used

Biomass from Schizochytrium microalgae is used as an eel feed composition, containing nutrients such as protein and fatty acids to promote eel growth.

Benefits of technology

It improved the weight gain rate, feed efficiency, and specific growth rate of eels, and reduced farming costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121941418A_ABST
    Figure CN121941418A_ABST
Patent Text Reader

Abstract

The present invention relates to a feed composition for eels, the composition comprising a biomass derived from microalgae of the genus Schizochytrium, and a method for culturing eels using the composition. When an eel feed composition containing a biomass derived from a microalgae belonging to the genus Schizochytrium is supplied to an eel, the growth of the eel is promoted, and thus the biomass can be advantageously used as a feed composition or a feed additive for the eel.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross-references to related applications

[0002] This disclosure claims the benefit based on priority of Korean Patent Application No. 10-2023-0086717, filed on July 4, 2023, and all the contents disclosed in the relevant Korean patent application are incorporated herein as part of this disclosure.

[0003] Throughout this disclosure, numerous papers and patent documents are cited, and their citations are indicated. The contents of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly describe the level of the technical field to which this disclosure pertains and the content of this disclosure.

[0004] This disclosure relates to a feed composition for eels using microalgae of the genus Schizochytrium sp. and a method for preparing the same. Background Technology

[0005] Concerns about future food security persist due to global population growth and the stagnation and continued decline in crop and fisheries production. Many scientists believe that aquaculture has unique potential to address this food problem. Global farmed fish production grew from 2.4 million tons half a century ago to 87.5 million tons in 2020, accounting for 49% of total marine product production. Among these farmed fish, the feed intake of marine fish and crustaceans has increased rapidly (FAO 2022), and this upward trend is expected to continue. Today, fish feed nutrition is one of the key factors for success in aquaculture. It is a well-known fact in aquaculture that once a key farmable fish species is selected and seed production technology is developed, it is essential to support feeding management using high-quality feed. Feed costs, in particular, vary depending on the fish species, but considering they account for 30-60% of the unit cost of aquaculture production, the importance of feed nutrition is evident.

[0006] Feed utilization varies depending on the protein source. Fishmeal, made by drying fish cakes or fish scraps remaining after fish oil extraction into powder, has long been used as a major protein source in aquaculture feed due to its high protein content, excellent amino acid composition, and high palatability. However, due to a recent sharp decline in production, unstable supply, and soaring prices, it accounts for the largest portion of the cost of purchasing feed ingredients. The catch of various miscellaneous fish used to make fishmeal has declined rapidly due to overfishing and marine environmental problems, and production is projected to continue to decline from now until 2030. For this reason, numerous studies have been conducted to find inexpensive and high-quality alternative protein sources that can replace fishmeal in mixed feeds for farmed fish. Existing technology

[0007] [Patent Literature]

[0008] (Patent Document 01) Korean Patent Publication No. 10-2011-0026232 Summary of the Invention

[0009] [Technical Issues]

[0010] The inventors have conducted extensive research efforts to develop aquaculture feeds for fish that utilize microalgae. As a result, feed compositions containing biomass derived from Schizochytrium microorganisms have been shown to promote eel growth, thus completing this disclosure.

[0011] Therefore, one object of this disclosure is to provide a feed composition for eels comprising biomass derived from microorganisms of the genus Schizochytrium.

[0012] Another object of this disclosure is to provide a method for aquaculture of eels, and / or a method for promoting eel growth, which includes feeding eels a feed composition for eels containing biomass derived from the aforementioned Schizochytrium microorganisms.

[0013] [Technical Solution]

[0014] A detailed explanation follows. On the other hand, the various descriptions and embodiments disclosed in this disclosure can also be applied to other various descriptions and embodiments. In other words, all combinations of the various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure should not be considered limited to the specific descriptions below. Moreover, those skilled in the art can recognize or confirm many equivalent substitutions of the specific embodiments of this disclosure described herein using only ordinary experiments. Furthermore, these equivalent substitutions are intended to be incorporated into this disclosure.

[0015] According to one aspect of this disclosure, a feed composition for eels is provided, comprising biomass derived from microalgae of the genus Schizochytrium; and / or the use of the biomass derived from said microalgae and / or the feed composition for eels for promoting eel growth.

[0016] Species chytridum microalgae

[0017] In this specification, the term "microalgae" refers to organisms that are not easily visible to the naked eye and float freely in water among plants, and is also known as phytoplankton. Microalgae come in a wide variety of species, including strains that cannot photosynthesize and can only grow heterotrophically. In this specification, the term "microalgae" may be used interchangeably with "strain".

[0018] In this specification, the term "Schizochytrium sp." is the name of a genus belonging to the family Thraustochytriaceae of the order Thraustochytriales, and can be used interchangeably with the term "genus Schizochytrium".

[0019] In this specification, the genus *Schizochytrium* refers to microorganisms belonging to the family Schizochytriumceae, and may be at least one selected from the group consisting of *Schizochytrium aggregatum*, *Schizochytrium limacinum*, and *Schizochytrium minutum*, but is not limited thereto.

[0020] In one implementation, the genus *Schizochytrium* microalgae may be *Schizochytrium slugii*.

[0021] In one implementation, the genus *Schizochytrium* microalgae may be *Schizochytrium aggregates*.

[0022] In one implementation, the genus *Schizochytrium* microalgae may be *Schizochytrium microsporum*.

[0023] In one embodiment of this disclosure, the aforementioned Schizochytrium microalgae may be strain CD03-7004 (accession number KCTC15006BP), but are not limited thereto.

[0024] The inventors induced a mutation in the wild-type Schizochytrium CD01-5000 strain (accession number KCTC 14344BP) by irradiating it with gamma rays. From the mutant strain, they screened for strains with antioxidant pigment production capabilities, named them Schizochytrium CD03-7004, and deposited them on June 20, 2022, in accordance with the Budapest Treaty, at the Korean Collection for Type Cultures (KCTC), an international depository institution of the Korea Research Institute of Bioscience and Biotechnology, with accession number KCTC15006BP.

[0025] Biomass derived from microalgae of the genus Schizochytrium

[0026] In this specification, the term "biomass" refers to a living organism that can be used as chemical energy, such as plants, animals, and microorganisms, i.e., a bioenergy source, and also refers to the weight or amount of energy of a specific living organism. Furthermore, biomass includes, but is not limited to, compounds secreted by cells, and may contain not only extracellular substances but also cellular and / or intracellular contents.

[0027] In this specification, biomass derived from microalgae may comprise the microalgae themselves, their cultures, their fermentation products, their dried products, their lysates, or products produced by culturing or fermenting microalgae, or may comprise concentrates or dried products of biomass, but is not limited thereto. In one embodiment, the biomass derived from microalgae may comprise at least one selected from the group consisting of microalgae, microalgae cultures, dried products of cultures, and lysates of dried products. Drying may be carried out by spray drying, hot air drying, freeze drying, natural drying, vacuum drying, but is not limited thereto.

[0028] The term "culture" of microalgae refers to a product produced by culturing microalgae, specifically, it can be a culture medium containing microalgae or a culture filtrate from which microalgae have been removed, but is not limited thereto. The term "dried product" of a microalgae culture is a product from which water has been removed from the microalgae culture; for example, it can be in the form of dried microalgae cells, but is not limited thereto. Furthermore, the term "lysate" of the dried product is a general term for the lysis result of the dried product from the microalgae culture after water removal; for example, it can be dried microalgae cell powder, but is not limited thereto. Microalgae cultures can be prepared by inoculating microalgae into a microalgae culture medium according to cultivation methods known in the art, and the dried product of the culture and its lysate can also be prepared according to methods known in the art for treating or drying microalgae and culture medium.

[0029] In one embodiment, the aforementioned microalgae-derived biomass may contain 40 wt% to 95 wt% protein (crude protein), more specifically, it may contain 40 wt% to 95 wt%, 40 wt% to 90 wt%, 40 wt% to 85 wt%, 40 wt% to 82.5 wt%, 40 wt% to 81.5 wt%, 40 wt% to 80.5 wt%, 50 wt% to 95 wt%, 50 wt% to 82.5 wt%, 50 wt% to 81.5 wt%, 50 wt% to 80.5 wt%, 60 wt% to 95 wt%, 60 wt% to 85 wt%, 60 wt% to 82.5 wt%, 60 wt% to 81.5 wt%, and 60 wt% to 80.5 wt%. wt%, 70 wt% to 95 wt%, 70 wt% to 90 wt%, 70 wt% to 85 wt%, 70 wt% to 82.5 wt%, 70 wt% to 81.5 wt%, 70 wt% to 80.5 wt%, 75 wt% to 95 wt%, 75 wt% to 90 wt%, 75 wt% to 85 wt%, 75 wt% to 82.5 wt%, 75 wt% to 81.5 wt%, 75 wt% to 80.5 wt%, 77.5 wt% to 95 wt%, 77.5 wt% to 80 wt%, 77.5 wt% to 82.5 wt%, 77.5 wt% to 81.5 wt%, 77.5 wt% to 80.5 wt%, 79.5 wt% to 95 wt%, 79.5 Protein (crude protein) in wt% to 90 wt%, 79.5 wt% to 85 wt%, 79.5 wt% to 82.5 wt%, 79.5 wt% to 81.5 wt%, or 79.5 wt% to 80.5 wt%, but not limited thereto.

[0030] In one embodiment, the aforementioned microalgae-derived biomass may contain 3 wt% to 30 wt% of fat (crude lipids), more specifically, it may contain 3 wt% to 30 wt%, 3 wt% to 20 wt%, 3 wt% to 15 wt%, 3 wt% to 13 wt%, 3 wt% to 12 wt%, 6 wt% to 30 wt%, 6 wt% to 20 wt%, 6 wt% to 15 wt%, 6 wt% to 16 wt%, 6 wt% to 12 wt%, 9 wt% to 30 wt%, 9 wt% to 20 wt%, 9 wt% to 15 wt%, 9 wt% to 16 wt%, 9 wt% to 12 wt%, 10 wt% to 30 wt%, 10 wt% to 20 wt%, 10 wt% to 15 wt%, 10 wt% to 16 wt%, 10 wt% to 12 wt%, 11 wt% to 30 wt%. wt%, 11 wt% to 20 wt%, 11 wt% to 15 wt%, 11 wt% to 16 wt%, or 11 wt% to 12 wt% of fat (crude lipids), but not limited thereto.

[0031] In one embodiment, the aforementioned microalgae-derived biomass may contain 0.05 wt% to 5 wt% water, more specifically, it may contain 0.05 wt% to 5 wt%, 0.05 wt% to 3 wt%, 0.05 wt% to 1.75 wt%, 0.05 wt% to 1.5 wt%, 0.05 wt% to 1 wt%, 0.05 wt% to 0.7 wt%, 0.1 wt% to 5 wt%, 0.1 wt% to 3 wt%, 0.1 wt% to 1.75 wt%, 0.1 wt% to 1.5 wt%, 0.1 wt% to 1 wt%, 0.1 wt% to 0.7 wt%, 0.5 wt% to 5 wt%, 0.5 wt% to 3 wt%, 0.5 wt% to 1.75 wt%, 0.5 wt% to 1.5 wt%, 0.5 wt% to 1 ... Moisture content of wt% to 0.7 wt%, 0.6 wt% to 5 wt%, 0.6 wt% to 3 wt%, 0.6 wt% to 1.75 wt%, 0.6 wt% to 1.5 wt%, 0.6 wt% to 1 wt%, and 0.6 wt% to 0.7 wt%, but not limited to these.

[0032] In this specification, ash can refer to the ash produced by burning a sample or all the minerals contained in the sample. Ash can be used interchangeably with terms such as minerals, inorganic matter, inorganic salts, and mineral substances, and may contain at least one inorganic element selected from the group consisting of calcium, phosphorus, potassium, sulfur, sodium, chloride, magnesium, iron, copper, manganese, iodide, cobalt, zinc, molybdenum, selenium, chromium, fluorine, boron, arsenic, tin, silicon, vanadium, and nickel.

[0033] In one embodiment, the aforementioned microalgae-derived biomass may contain 2.5 wt% to 20 wt% ash, more specifically, it may contain 2.5 wt% to 20 wt%, 2.5 wt% to 15 wt%, 2.5 wt% to 13.5 wt%, 2.5 wt% to 12.5 wt%, 2.5 wt% to 10 wt%, 2.5 wt% to 8 wt%, 2.5 wt% to 7.5 wt%, 5 wt% to 20 wt%, 5 wt% to 15 wt%, 5 wt% to 13.5 wt%, 5 wt% to 12.5 wt%, 5 wt% to 10 wt%, 5 wt% to 8 wt%, 5 wt% to 7.5 wt%, 7 wt% to 20 wt%, 7 wt% to 15 wt%, 7 wt% to 13.5 wt%, 7 wt% to 12.5 wt%, 7 Ash content of wt% to 10 wt%, 7 wt% to 8 wt%, or 7 wt% to 7.5 wt%, but not limited to these.

[0034] In one embodiment, the aforementioned biomass derived from microalgae may contain 30 to 70 parts by weight of glutamic acid, more specifically, it may contain 30 to 70 parts by weight, 30 to 60 parts by weight, 30 to 57 parts by weight, 30 to 54 parts by weight, 45 to 70 parts by weight, 45 to 60 parts by weight, 45 to 57 parts by weight, 45 to 54 parts by weight, 50 to 70 parts by weight, 50 to 60 parts by weight, 50 to 57 parts by weight, 50 to 54 parts by weight, 53 to 70 parts by weight, 53 to 60 parts by weight, 53 to 57 parts by weight, or 53 to 54 parts by weight of glutamic acid, based on 100 parts by weight of total amino acids, but is not limited thereto.

[0035] In one embodiment, the aforementioned biomass derived from microalgae may contain 7 to 25 parts by weight of arginine, more specifically, it may contain 7 to 25 parts by weight, 7 to 20 parts by weight, 7 to 15 parts by weight, 7 to 13 parts by weight, 10 to 25 parts by weight, 10 to 20 parts by weight, 10 to 15 parts by weight, 10 to 13 parts by weight, 12 to 25 parts by weight, 12 to 20 parts by weight, 12 to 15 parts by weight, or 12 to 13 parts by weight of arginine, based on 100 parts by weight of total amino acids, but is not limited thereto.

[0036] In one embodiment, the aforementioned microalgae-derived biomass may contain 20 to 50 parts by weight of palmitic acid, more specifically, it may contain 20 to 50 parts by weight, 20 to 40 parts by weight, 20 to 37 parts by weight, 30 to 50 parts by weight, 30 to 40 parts by weight, 30 to 37 parts by weight, 36 to 50 parts by weight, 36 to 40 parts by weight, or 36 to 37 parts by weight of palmitic acid, based on 100 parts by weight of total fatty acids, but is not limited thereto.

[0037] In this specification, the term "palmitic acid" refers to the substance with the chemical formula CH3(CH2). 14 COOH is a saturated fatty acid, also known as hexadecanoic acid, or abbreviated as C16:0.

[0038] In one embodiment, the aforementioned microalgae-derived biomass may contain 30 to 60 parts by weight of docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenoic acid, DHA), more specifically, it may contain 30 to 60 parts by weight, 30 to 50 parts by weight, 30 to 46 parts by weight, or 40 to 60 parts by weight. 0 parts by weight, 40 to 50 parts by weight, 40 to 46 parts by weight, 45 to 60 parts by weight, 45 to 50 parts by weight, or 45 to 46 parts by weight of docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenoic acid, DHA), based on 100 parts by weight of total fatty acids, but not limited thereto.

[0039] In this specification, the term "docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-docosahexaenoic acid-4,7,10,13,16,19-hexaenoic acid, DHA)" refers to a substance with the chemical formula C2. 22 H 32O2 is a polyunsaturated fatty acid, corresponding to an omega-3 fatty acid containing alpha-linolenic acid (ALA) and eicosapentaenoic acid (EPA). Its common name is cervonicacid, and it can also be abbreviated as C22:6n3. Docosahexaenoic acid cannot be produced in fish, so it must be obtained through food. It is considered an essential fatty acid, playing a vital role in fish metabolism and cellular function.

[0040] Feed composition

[0041] In this specification, the term "feed composition" can refer to a composition that provides nutrition or the necessary health maintenance or growth for animals (including single-celled or multicellular heterotrophic organisms such as zooplankton, livestock, fish, etc.). A feed composition can be a feed ingredient, a complete feed, or a supplementary feed. A feed ingredient can refer to plant-based, animal-based, or mineral substances used directly as feed or as ingredients in a complete feed. A supplementary feed can refer to supplementary feed added to a feed to prevent feed quality deterioration or to increase feed usability. A complete feed can be a complete feed in which feed ingredients, supplementary feeds, etc., are mixed or processed in appropriate proportions.

[0042] Feed compositions can refer to substances that provide organic or inorganic nutrients necessary for maintaining animal life or producing meat, milk, etc. Feed compositions may additionally contain nutrients necessary for maintaining animal life or producing meat, milk, etc. Feed compositions can be prepared in various forms of feed known in the art; specifically, they can include concentrated feeds, roughage, and / or specialty feeds. Furthermore, feed compositions can be prepared in the form of complete feeds (extruded pellets, EP feeds, dry feeds) or raw feeds (moist pellets, MP feeds, wet feeds), paste feeds, etc.

[0043] In this specification, feed additives may include substances added to feed for various purposes, such as supplementing nutrition and preventing weight loss, improving the digestibility of fiber in feed, improving milk quality, preventing reproductive diseases and improving conception rates, and preventing summer heat stress. Feed additives may refer to supplementary feeds under the Feed Management Act, and may include mineral preparations (such as sodium bicarbonate, bentonite, magnesium oxide, compound minerals, etc.), mineral preparations that are trace minerals (such as zinc, copper, cobalt, selenium, etc.), vitamin preparations (such as carotene, vitamin E, vitamins A, D, E, niacin, B complex vitamins, etc.), protected amino acid preparations such as (methionine, lysine, etc.), protected fatty acid preparations (such as calcium salt fatty acids, etc.), live cell and yeast preparations (such as probiotics (lactic acid bacteria preparations)), yeast cultures, mold fermentation products, etc.

[0044] In this specification, the term "feed composition" may be interpreted as including "feed additives".

[0045] The feed composition may also contain grains, such as milled or crushed wheat, oats, barley, corn and rice; plant protein feeds, such as feeds with soybeans and sunflowers as the main components; animal protein feeds, such as fish meal, blood meal, meat meal and / or bone meal; sugars and dairy products, such as dried components composed of various milk powders and whey powders. In addition, it may also contain nutritional supplements, digestion and absorption promoters, growth promoters, etc.

[0046] Feed compositions can be administered to animals alone or in combination with other feed additives in an edible carrier. Furthermore, feed compositions can be administered as top dressing, directly mixed into feed, or readily administered to animals as an oral formulation separate from feed. When the composition is administered separately from feed, it can be formulated into an immediate-release or sustained-release formulation by combining it with an edible carrier acceptable in the feed industry, as well as is known in the art. Edible carriers can be solid or liquid, such as corn starch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil, and propylene glycol. When using a solid carrier, the feed composition can be a tablet, capsule, powder, lozenge, or sugar-containing tablet, or a top dressing in microdispersed form. When using a liquid carrier, the feed composition can be a formulation of gelatin soft capsules, or a syrup or suspension, emulsion, or solution.

[0047] The feed composition may contain, for example, preservatives, stabilizers, humectants or emulsifiers, cryoprotectants, or excipients. Cryoprotectants may be at least one selected from the group consisting of glycerol, trehalose, maltodextrin, skim milk powder, and starch. Preservatives, stabilizers, or excipients may be included in the composition in an effective amount sufficient to reduce the spoilage of microalgae contained in the feed composition. Furthermore, when the composition is in a dry state, cryoprotectants may be included in the composition in an effective amount sufficient to reduce the spoilage of microalgae contained in the composition.

[0048] Feed compositions can be added to animal feed and used by soaking, spraying or mixing.

[0049] The feed composition can be used in the diets of many animals, including, but not limited to, mammals, birds, fish, crustaceans, cephalopods, reptiles, and amphibians. For example, mammals may include pigs, cattle, sheep, goats, laboratory rodents, or pets; birds may include poultry, such as chickens, turkeys, ducks, geese, pheasants, or quails, but are not limited to these. Crustaceans may include shrimp, barnacles, etc., but are not limited to these. Furthermore, the feed composition can also be used in the diets of zooplankton, such as rotifers, brine shrimp, and daphnia. Additionally, fish may include freshwater fish, saltwater fish, commercially farmed fish and their fry, and ornamental fish.

[0050] Feed composition for eels

[0051] One embodiment of this disclosure provides a feed composition for eels comprising the aforementioned biomass derived from Schizochytrium microalgae.

[0052] The Schizochytrium microalgae, the biomass and feed composition derived from the microalgae are the same as described above.

[0053] In this specification, the term "eel" refers to fish belonging to the genus *Anguilla* of the family Anguillidae, and may be used interchangeably with "freshwater eel" or "Japanese eel." In one embodiment, the eel may be at least one selected from the group consisting of *Anguilla japonica*, *Anguilla marmorata*, *Anguilla anguilla*, *Anguilla rostrata*, and *Anguilla bicolor*, more specifically, but not limited to *Anguilla japonica*.

[0054] As demonstrated in the examples described below, the feed composition containing the aforementioned microalgae biomass can promote eel growth.

[0055] In one embodiment, the feed composition for eels disclosed herein may comprise 2.25 wt% to 45 wt% of the aforementioned microalgae-derived biomass, more specifically, it may comprise 2.25 wt% to 45 wt%, 2.25 wt% to 30 wt%, 2.25 wt% to 25 wt%, 2.25 wt% to 22.5 wt%, 2.25 wt% to 20 wt%, 2.25 wt% to 17.5 wt%, 2.25 wt% to 15 wt%, 2.25 wt% to 13.3 wt%, 2.25 wt% to 12 wt%, 2.25 wt% to 10 wt%, 2.25 wt% to 8 wt%, 2.25 wt% to 7.5 wt%, 2.25 wt% to 7 wt%, 2.25 wt% to 6.6 wt%, 2.25 wt% to 6.5 wt%, 2.25 wt% to 6.5 wt%, 2.25 wt% to 6.6 wt%, 2.25 wt% to 6.5 wt%, 2.25 wt% to 45 wt%, 2.25 wt% to 30 wt%, 2.25 wt% to 25 ... wt% to 6 wt%, 2.25 wt% to 5 wt%, 2.25 wt% to 4 wt%, 2.25 wt% to 3.3 wt%, 3 wt% to 45 wt%, 3 wt% to 30 wt%, 3 wt% to 25 wt%, 3 wt% to 22.5 wt%, 3 wt% to 20 wt%, 3 wt% to 17.5 wt%, 3 wt% to 15 wt%, 3 wt% to 13.3 wt%, 3 wt% to 12 wt%, 3 wt% to 10 wt%, 3 wt% to 8 wt%, 3 wt% to 7.5 wt%, 3 wt% to 7 wt%, 3 wt% to 6.6 wt%, 3 wt% to 6.5 wt%, 3 wt% to 6 wt%, 3 wt% to 5 wt%, 3 wt% to 4 wt%, 3 wt% to 3.3 wt%, 4 wt% to 45 wt%. wt%, 4 wt% to 30 wt%, 4 wt% to 25 wt%, 4 wt% to 22.5 wt%, 4 wt% to 20 wt%, 4 wt% to 17.5 wt%, 4 wt% to 15 wt%, 4 wt% to 13.3 wt%, 4 wt% to 12 wt%, 4 wt% to 10 wt%, 4 wt% to 8 wt%, 4 wt% to 7.5 wt%, 4 wt% to 7 wt%, 4 wt% to 6.6 wt%, 4 wt% to 6.5 wt%, 4 wt% to 6 wt%, 4 wt% to 5 wt%, 5 wt% to 45 wt%, 5 wt% to 30 wt%, 5 wt% to 25 wt%, 5 wt% to 22.5 wt%, 5 wt% to 20 wt%, 5 wt% to 17.5 wt%, 5 wt% to 15 wt%, 5 wt% to 13.3 wt%, 5 wt% to 12 wt%, 5 wt% to 10 wt%, 5 wt% to 8 wt%, 5 wt% to 7 wt%.5 wt%, 5 wt% to 7 wt%, 5 wt% to 6.6 wt%, 5 wt% to 6.5 wt%, 5 wt% to 6 wt%, 6 wt% to 45 wt%, 6 wt% to 30 wt%, 6 wt% to 25 wt%, 6 wt% to 22.5 wt%, 6 wt% to 20 wt%, 6 wt% to 17.5 wt%, 6 wt% to 15 wt%, 6 wt% to 13.3 wt%, 6 wt% to 12 wt%, 6 wt% to 10 wt%, 6 wt% to 8 wt%, 6 wt% to 7.5 wt%, 6 wt% to 7 wt%, 6 wt% to 6.6 wt%, 6 wt% to 6.5 wt%, 6.5 wt% to 45 wt%, 6.5 wt% to 30 wt%, 6.5 wt% to 25 wt%, 6.5 wt% to 22.5 wt%. wt%, 6.5 wt% to 20 wt%, 6.5 wt% to 17.5 wt%, 6.5 wt% to 15 wt%, 6.5 wt% to 13.3 wt%, 6.5 wt% to 12 wt%, 6.5 wt% to 10 wt%, 6.5 wt% to 8 wt%, 6.5 wt% to 7.5 wt%, 6.5 wt% to 7 wt%, 6.5 wt% to 6.6 wt%, 6.6 wt% to 45 wt%, 6.6 wt% to 30 wt%, 6.6 wt% to 25 wt%, 6.6 wt% to 22.5 wt%, 6.6 wt% to 20 wt%, 6.6 wt% to 17.5 wt%, 6.6 wt% to 15 wt%, 6.6 wt% to 13.3 wt%, 6.6 wt% to 12 wt%, 6.6 wt% to 10 wt%, 6.6 wt% to 8 wt%, 6.6 wt% to 7.5 wt%, 6.6 wt% to 7 wt%, 7 wt% to 45 wt%, 7 wt% to 30 wt%, 7 wt% to 25 wt%, 7 wt% to 22.5 wt%, 7 wt% to 20 wt%, 7 wt% to 17.5 wt%, 7 wt% to 15 wt%, 7 wt% to 13.3 wt%, 7 wt% to 12 wt%, 7 wt% to 10 wt%, 7 wt% to 8 wt%, 7 wt% to 7.5 wt%, 7.5 wt% to 45 wt%, 7.5 wt% to 30 wt%, 7.5 wt% to 25 wt%, 7.5 wt% to 22.5 wt%, 7.5 wt% to 20 wt%, 7.5 wt% to 17.5 wt%, 7.5 wt% to 15wt%, 7.5 wt% to 13.3 wt%, 7.5 wt% to 12 wt%, 7.5 wt% to 10 wt%, 7.5 wt% to 8 wt%, 8 wt% to 45 wt%, 8 wt% to 30 wt%, 8 wt% to 25 wt%, 8 wt% to 22.5 wt%, 8 wt% to 20 wt%, 8 wt% to 17.5 wt%, 8 wt% to 15 wt%, 8 wt% to 13.3 wt%, 8 wt% to 12 wt%, 8 wt% to 10 wt%, 10 wt% to 45 wt%, 10 wt% to 30 wt%, 10 wt% to 25 wt%, 10 wt% to 22.5 wt%, 10 wt% to 20 wt%, 10 wt% to 17.5 wt%, 10 wt% to 15 wt%, 10 wt% to 13.3 wt%, 10 wt% to 12 wt%, 12 wt% to 45 wt%, 12 wt% to 30 wt%, 12 wt% to 25 wt%, 12 wt% to 22.5 wt%, 12 wt% to 20 wt%, 12 wt% to 17.5 wt%, 12 wt% to 15 wt%, 12 wt% to 13.3 wt%, 13.3 wt% to 45 wt%, 13.3 wt% to 30 wt%, 13.3 wt% to 25 wt%, 13.3 wt% to 22.5 wt%, 13.3 wt% to 20 wt%, 13.3 wt% to 17.5 wt%, 13.3 wt% to 15 wt%, 15 wt% to 45 wt%, 15 wt% to 30 wt%, 15 wt% to 25 wt%, 15 wt% to 22.5 wt%, 15 wt% to 20 wt%, 15 wt% to 17.5 wt%, 17.5 wt% to 45 wt%. wt%, 17.5 wt% to 30 wt%, 17.5 wt% to 25 wt%, 17.5 wt% to 22.5 wt%, 17.5 wt% to 20 wt%, 20 wt% to 45 wt%, 20 wt% to 30 wt%, 20 wt% to 25 wt%, or 20 wt% to 22.5 wt% of the aforementioned microalgae-derived biomass, but not limited thereto.

[0056] In one embodiment, the feed composition for eels may contain 21 to 30 parts by weight of palmitic acid, more specifically, may contain 21 to 30 parts by weight, 21 to 25 parts by weight, 21 to 23.75 parts by weight, 21 to 22.5 parts by weight, 21 to 21.25 parts by weight, 21.25 to 30 parts by weight, 21.25 to 25 parts by weight, 21.25 to 23.75 parts by weight, 21.25 to 22.5 parts by weight, 22.5 to 30 parts by weight, 22.5 to 25 parts by weight, 22.5 to 23.75 parts by weight, 23.75 to 30 parts by weight, 23.75 to 25 parts by weight, and 25 to 30 parts by weight of palmitic acid, based on 100 parts by weight of total fatty acids.

[0057] In one embodiment, the content of palmitic acid in the feed composition for eels can be increased as the content of microalgae-derived biomass in the feed composition for eels increases.

[0058] In one embodiment, the feed composition for eels may contain 15 to 27 parts by weight of docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenoic acid, DHA), and more specifically, may contain 15 to 27 parts by weight, 15 to 23 parts by weight, 15 to 20.25 parts by weight, 15 to 18 parts by weight, 15 to 16.25 parts by weight, 16.25 to 27 parts by weight, and 16.25 to 23 parts by weight. 16.25 to 20.25 parts by weight, 16.25 to 18 parts by weight, 18 to 27 parts by weight, 18 to 23 parts by weight, 18 to 20.25 parts by weight, 20.25 to 27 parts by weight, 20.25 to 23 parts by weight, or 23 to 27 parts by weight of docosahexaenoic acid ((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenoic acid, DHA), based on 100 parts by weight of total fatty acids, but not limited thereto.

[0059] In one embodiment, the content of docosahexaenoic acid (DHA) in the feed composition for eels can be increased as the content of microalgae-derived biomass in the feed composition for eels increases.

[0060] According to one embodiment of this disclosure, the feed composition for eels may also contain protein, carbohydrates, fat, yeast, starch, cellulose, vitamins, etc.

[0061] In one embodiment, the feed composition for eels disclosed herein may additionally contain fishmeal.

[0062] In one embodiment, the feed composition for eels disclosed herein may additionally comprise at least one selected from the group consisting of: yeast (e.g., live cells of yeast culture, mold fermentation products, yeast preparations), vitamins (e.g., vitamin preparations such as carotene, vitamin E, vitamin A, D, E, niacin, B complex vitamins, etc.), minerals (e.g., mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, complex minerals, etc., mineral preparations that are trace minerals (such as zinc, copper, cobalt, selenium, etc.)), and starch.

[0063] In one embodiment, the feed composition for eels can promote eel growth. Promoting eel growth can mean increasing the eel's weight gain rate (WGR), feed efficiency (FE), and / or specific growth rate (SGR). For example, when the feed composition for eels is fed to eels, the eel's weight gain rate (WGR), feed efficiency (FE), and / or specific growth rate (SGR) can be increased compared to feeding eels with a feed composition that does not contain biomass derived from microalgae.

[0064] As demonstrated in the embodiments described below, when eels consume a feed composition for eels containing biomass derived from microalgae, weight gain (WGR), feed efficiency (FE), and / or specific growth rate (SGR) increase, and thus, the feed composition for eels disclosed herein can be confirmed to have the effect of promoting eel growth.

[0065] By promoting eel growth, the aforementioned feed composition disclosed herein can be effectively used as a feed composition for eels.

[0066] Aquaculture methods for eels

[0067] According to another aspect of this disclosure, this disclosure provides a method for aquaculture of eels, which includes feeding eels a feed composition for eels comprising biomass derived from microalgae of the genus Schizochytrium.

[0068] The method may further include, prior to feeding, preparing the aforementioned feed composition for eels containing biomass derived from microalgae of the genus Schizochytrium.

[0069] In the method described, feeding can be carried out by any method of providing feed to the eels, for example, it can include providing or adding the aforementioned feed composition for eels containing biomass derived from Schizochytrium microalgae to the eels (which can be interpreted as including aquatic environments containing eels), but is not limited thereto.

[0070] In the method described above, the amount of feed in the aforementioned feed composition for eels containing biomass derived from *Schizochytrium* microalgae can be appropriately determined based on the type, size, condition, and feeding purpose of the eels to be fed. In one specific embodiment, the amount of feed in the aforementioned feed composition for eels containing biomass derived from *Schizochytrium* microalgae can be 1% (w / w) to 15% (w / w), more specifically, it can be 1% (w / w) to 15% (w / w), 1% (w / w) to 10% (w / w), 1% (w / w) to 8% (w / w), 1% (w / w) to 7% (w / w), 2 ...0% The percentages of eel weight are 15% to 15%, 2% to 10%, 2% to 8%, 2% to 7%, 3% to 15%, 3% to 10%, 3% to 8%, or 3% to 7%, based on, but not limited to, the eel weight.

[0071] The biomass derived from Schizochytrium microalgae, the feed composition for eels, and the methods for promoting eel growth are the same as described above.

[0072] According to another aspect of this disclosure, this disclosure provides a method for promoting eel growth, which includes feeding eels a feed composition for eels comprising biomass derived from Schizochytrium microalgae.

[0073] According to another aspect of this disclosure, this disclosure provides the use of the aforementioned biomass derived from Schizochytrium microalgae and / or feed compositions containing biomass derived from Schizochytrium microalgae for promoting eel growth.

[0074] The biomass derived from Schizochytrium microalgae, the feed composition for eels, and the methods for promoting eel growth are the same as described above.

[0075] [Beneficial Effects]

[0076] This disclosure relates to a feed composition for eels comprising biomass derived from microalgae of the genus Schizochytrium and a method for aquaculture of eels using the same. When the feed composition for eels comprising biomass derived from microalgae of the genus Schizochytrium of this disclosure is fed to eels, it promotes eel growth and therefore can be effectively used as a feed composition or feed additive for eels. Attached Figure Description

[0077] Figure 1 This is a graph showing the color differences resulting from pure isolation cultures of the genus *Schizochytrium* CD03-7004 mutant and the wild-type genus *Schizochytrium* CD01-5000.

[0078] Figure 2 This is a graph showing the size of the amplified DNA fragments in the wild-type CD01-5000 strain and the mutant CD03-7004 strain after PCR using primer sets. Compared to the wild-type CD01-5000 strain, the PCR amplified a DNA fragment containing the 15 bp sequence added in the mutant CD03-7004. Detailed Implementation

[0079] The present disclosure will be described in more detail below by way of embodiments. It will be apparent to those skilled in the art that these embodiments are intended only to describe the present disclosure in more detail, but the scope of the present disclosure is not limited to these embodiments based on the key points of the present disclosure.

[0080] Example

[0081] Throughout this instruction manual, the percentage used to indicate the concentration of a particular substance is (weight / weight)% for solid / solid, (weight / volume)% for solid / liquid, and (volume / volume)% for liquid / liquid, unless otherwise stated.

[0082] Example 1: Research Materials and Methods

[0083] 1-1. Test Fish and Husbandry Management

[0084] The water tanks used were 1-ton square tanks (60L working volume), with one set containing 3 rearing tanks and 2 filtration tanks. The testing method involved transferring 25 growing eels (freshwater eels, Japanese eels) (approximately 20g in size, currently being raised and managed at the Kofec Central Research Institute) to the various test tanks. After one week of acclimatization and rearing, they were fed prepared test samples twice daily (07:30, 14:30) at 3-7% (w / w) of their body weight and reared for 8 weeks. 20-30 minutes after feeding the test samples, any remaining feed was collected, freeze-dried, weighed, and excluded from each feed supply. Each test tank was maintained at a temperature of 29°C, DO of 6.5, and pH of 5.8 ± 0.5. NH3 and NO2 were collected daily from the filtration tanks of each test tank and measured using chemical analysis methods.

[0085] After the feeding test was completed, the full weight of all eel individuals in the tanks was measured, and based on this, growth performance was evaluated as follows.

[0086] Initial weight (IW) (g), Initial weight (g / fish)

[0087] Final weight (FW) (g), Final weight (g / fish)

[0088] Weight gain (WG) (g), Weight gain = Final weight - Initial weight

[0089] Total dry feed intake (DFI) (g), Total dry feed intake

[0090] Feed efficiency (FE) (%), Feed efficiency = (Wet weight / Dry feed intake) x 100

[0091] Weight gain rate (WGR) (%), Weight gain rate = (Final weight - Initial weight) x 100 / Initial weight

[0092] Specific growth rate (SGR) (%), Specific growth rate (% / day) = (log final weight - log initial weight) / number of days x 100

[0093] Survival rate (SR) (%), Survival rate = (Number of fish at the end of the experiment / Number of fish at the beginning of the experiment) x 100

[0094] 1-2. Preparation of a novel Schizochytrium CD03-7004 mutant strain

[0095] 1-2-1. Development of a novel Schizochytrium CD03-7004 mutant strain using gamma ray irradiation.

[0096] The isolated wild-type *Schizochytrium* strain CD01-5000 (accession number KCTC 14344BP) was cultured in a modified GYEP medium (10 g / L glucose, 1 g / L yeast extract, 1 g / L peptone, 2 g / L MgSO4·7H2O, 5.0 mg / L H3BO3, 3.0 mg / L MnCl2, 0.2 mg / L CuSO4, 0.05 mg / L NaMo4·2H2O, 0.05 mg / L CoSO4, 0.7 mg / L ZnSO4·7H2O) containing 30 g / L glucose for approximately 24 hours or longer to reach the early exponential phase. The culture sample was then centrifuged to harvest the microbial cells. The harvested cells were resuspended in 0.1 M phosphate buffer containing 1.0% NaCl to a cell count of approximately 102. 9 Cells / mL, and used for gamma ray irradiation.

[0097] The gamma-ray irradiation experiments were conducted at the Advanced Radiation Technology Institute of the Korea Atomic Energy Research Institute, with irradiation doses ranging from 2000 to 5000 GY. Microalgae culture samples irradiated with gamma rays underwent an O / N recovery process in a darkroom, were then plated onto GYEP medium containing 20 g / L agar, and incubated for approximately 5 days. The number of colonies was then counted to measure the mortality rate per gamma-ray dose.

[0098] [Calculation Formula 1]

[0099] Mortality rate (%) = [{(colony count in untreated group) - (colony count in treated group)} / (colony count in untreated group)] x 100

[0100] [Table 1]

[0101]

[0102] The results, as shown in Table 1, confirmed the colony counts based on the gamma-ray irradiation dose and the appropriate doses to reduce the CFU value of viable cells by 95% or more. Specifically, gamma-ray irradiation doses of 2.0, 3.0, 4.0, 4.5, and 5.0 kGY resulted in 0%, 90.8%, 98.2%, 100%, and 100% cell killing, respectively. At gamma-ray irradiation doses of 4.5 GY or higher, all cells were killed, therefore obtaining microalgae colonies could not be guaranteed; the 4.0 kGY gamma-ray dose condition, which showed a 98.2% mortality rate, was selected.

[0103] After irradiating the novel microalgae strain CD01-5000 with 4.0 kGY of gamma rays using the same method, it was cultured in GYEP medium. During growth, viable colonies were selected and subcultured under the same medium and environmental conditions. Morphologically red colonies were selected between subcultures, purified, and cultured as single cell lines. The photographic results are then presented. Figure 1 The Schizochytrium strain was named Schizochytrium CD03-7004 and deposited on June 20, 2022, at the Korean Center for Type Culture Collection (KCTC) of the Korea Institute of Bioscience and Biotechnology, with accession number KCTC15006BP.

[0104] 1-2-2. Derive the differentiating markers between the CD03-7004 mutant strain and the wild-type CD01-5000 strain.

[0105] By comparing the whole genome sequences of the wild-type Schizochytrium CD01-5000 strain and the mutant Schizochytrium CD03-7004 strain, the mutant sequences in CD03-7004 were identified and PCR markers were generated.

[0106] Specifically, when compared with the genome of the wild-type CD01-5000 strain, it was confirmed that the mutant CD03-7004 strain has an added portion of 15 base pairs in its genome (the bold portion of the sequence in SEQ ID NO: 1 below, SEQ ID NO: 5).

[0107] [Amplified DNA fragment sequence of the mutant CD03-7004 strain (SEQ ID NO: 1)]

[0108] tttcagactgctttttgctttttgcttgcttgctttttgcttgcttgcttttggcttgctttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag

[0109] [Amplified DNA fragment sequence of wild-type CD01-5000 strain (SEQ ID NO:2)]

[0110] tttcagactgctttttgctttttgcttgcttgcttttggcttgctttctttttgcttcttcctgcttgatccggtgaagaagaacggagcgaactaaaagaaaagagtcaatccgaagagag

[0111] Primers A: 5'-TTTCAGACTGCTTTTTGCTTTTTG-3' (SEQ ID NO: 3) and primer B: 5'-CTCTCTTCGGATTGACTCTTTTCT-3' (SEQ ID NO: 4) were selected for amplification of this portion, and PCR amplification was performed using them. PCR was performed using a reaction solution containing Taq polymerase following the steps of denaturation at 95°C for 5 minutes, repeated 35 times with denaturation at 95°C for 10 seconds, annealing at 50°C for 10 seconds, and polymerization at 72°C for 15 seconds, followed by polymerization at 72°C for 5 minutes. The amplified reaction solution was electrophoresed on a 1.7% agarose gel to determine the size of the amplified DNA, such as... Figure 2 As shown.

[0112] As a result, Figure 2The results show that the amplified DNA fragment from the mutant CD03-7004 strain is approximately 140 bp in size, thus confirming the difference from the wild-type CD01-5000 strain, where the amplified DNA fragment is approximately 120 bp in size.

[0113] Therefore, based on this result, it can be seen that primer A: 5'-TTTCAGACTGCTTTTTGCTTTTTG-3' (SEQ ID NO: 3) and primer B: 5'-CTCTCTTCGGATTGACTCTTTTCT-3' (SEQ ID NO: 4) can be used to select the mutant CD03-7004 strain.

[0114] 1-2-3. Preparation of dried microalgal biomass powder (Schizochytrium powder)

[0115] The following method was used to prepare dried microalgae biomass powder for the experiment using the genus Schizochytrium CD03-7004 (KCTC15006BP).

[0116] For the pre-culture prior to the 30 L major culture, each cell line was inoculated into 500 ml flasks containing 50 ml working volume of GYEP medium and 30 g / L glucose, and cultured in a shaking incubator at 30 °C and 180 rpm for approximately 20 hours. Under the same conditions, the pre-culture was inoculated into a 30 L fermenter containing medium, and fermented and cultured with a total working volume of 20 L. Glucose corresponding to 20% of the working volume was continuously added for cell culture at 30 °C, 500 rpm, 0.5–1 vvm, and pH 5–7, maintaining a glucose concentration of 20 g / L. The culture was terminated when the glucose (provided carbon source) was completely consumed. The culture medium was dried using a desiccator to a moisture content of approximately 5–8%.

[0117] 1-3. Test Feed Preparation

[0118] For the preparation of test diets, fishmeal powder from Kofec feed formulations (Glumar Co., Chille) and Schizochytrium powder prepared in Examples 1-2-3 (CJ Co., Korea) were used as protein sources. Yeast (Biolife Co., Brazil), vitamins (Seoul vet Pharm Co., Korea), minerals (Seoul vet Pharm Co., Korea), and starch (Asai Co., Thailand) were used. A control diet (CTL) containing 100% fishmeal as the protein source was prepared, along with test diets (substitute diets) T1, T2, T3, T4, and T5 in which 5%, 10%, 15%, 20%, and 30% of the fishmeal were replaced with Schizochytrium powder, respectively. On the other hand, all protein sources were ground to approximately 100 mesh using a grinder owned by the Kofec Institute. The composition of the control and test diets is described later in Table 8 below.

[0119] 1-4. Assessment of biological (hepatic) indices

[0120] After the experiment, 10 animals were randomly selected from each test group to measure the hepatic body index (HSI) and intestinal body index (ISI). The body weight and the weight of the liver and intestines removed after dissection were checked using an electronic scale, and the hepatic body index [(liver weight / body weight)×100] and intestinal body index [(intestinal weight / body weight)×100] were calculated.

[0121] 1-5. Analysis of research materials and basic components of fish bodies

[0122] Moisture, fat, protein, and ash content were analyzed in the research materials and fish carcasses. Fish meal powder (Glumar Co., Chile) and Schizochytrium powder were used as research materials. For the fish carcasses, five eels of similar weight were randomly collected from each test group and finely ground in a grinder. Moisture, fat, protein, and ash content were then analyzed. Considering the characteristics of Schizochytrium powder, the analytical method was based on food coding standards, and crude fat was analyzed using an acid decomposition method.

[0123] 1-6. Amino acid and fatty acid analysis, and Ca and P analysis

[0124] The amino acid, fatty acid, and calcium (Ca) and phosphorus (P) contents of fishmeal powder, Schizochytrium powder, and fish carcasses (these were the research materials) were evaluated. In the case of fish carcasses, the amino acid, fatty acid, Ca, and P contents were evaluated using freeze-dried powder of ground meat from five animals randomly collected from each test group. Analysis was requested from the Feed Testing Certification Center of Agricultural Science Research Institute of Chungnam National University (https: / / agro.cnu.ac.kr / agro / index.do).

[0125] 1-6-1. Amino Acid Analysis Methods

[0126] Constituent amino acid content analysis was performed using a modified AOAC method (2005) with ion-exchange chromatography and ninhydrin post-column reaction. For 16 constitutive amino acid components, 0.2 g of sample was placed in a decomposition tube, 10 mL of 6N HCl was added, and nitrogen was injected. The mixture was then hydrolyzed at 110 °C for 24 hours. The filtrate was concentrated using a vacuum concentrator, and the volume was adjusted to 50 mL with 0.2 M sodium citrate buffer. The filtrate, filtered through a 0.20 μm cellulose acetate syringe filter, was used as the analytical sample. The sulfur-containing amino acids methionine and cysteine ​​were analyzed using performic acid oxidation, and tryptophan was analyzed using alkaline hydrolysis. Analytical conditions are shown in Tables 2 and 3.

[0127] [Table 2]

[0128] Determination conditions for an automated amino acid analyzer used for total amino acids

[0129]

[0130] [Table 3]

[0131] HPLC analysis conditions for tryptophan

[0132]

[0133] 1-6-2. Methods for Fatty Acid Composition Analysis

[0134] For the fatty acid composition, the extract was prepared according to the method of Folch et al. (1957) by adding approximately 10 g of ground sample to a mixture of approximately 100 mL of chloroform and methanol (2:1) and extracting at room temperature for 24 hours, followed by concentration under reduced pressure. After methylation with 14% BF3-MeOH (Sigma, St Louis, Mo, USA) solution, the extract was analyzed by gas chromatography (HP 6890, Heslett Packard Ltd., USA). An HP-88 column (100 m × 0.25 mm i.d., 0.20 μm film thickness, Agilent, USA) was used. The column oven temperature was maintained at 140 °C for 5 minutes, then increased by 4 °C every 1 minute, and maintained at 240 °C for 20 minutes. The inlet temperature was 260 °C, the detector FID temperature was set to 270 °C, and N2 was used as the carrier gas at a flow rate of 1 mL / min with a split ratio adjusted to 1 / 50. The analytical conditions for gas chromatography were as shown in Table 4 below. Each fatty acid was identified by comparing its peak to the retention time of the methyl ester of a standard fatty acid. For the fatty acid composition, the area ratio of each identified peak was shown as a percentage after calculating its area.

[0135] [Table 4]

[0136] Gas chromatography analysis conditions for fatty acids

[0137]

[0138] 1-6-3. Mineral Analysis Methods

[0139] For mineral content, calcium (Ca) was measured using an atomic absorption spectrophotometer (GBC Scientific Equipment, SavantAA, Australia) after preparing sample solutions by dissolving the residue from dry ashing in hydrochloric acid solution (1:1, v / v), and phosphorus (P) was measured at 470 nm using a spectrophotometer (UV-2450, Shimadzu Co., Japan) according to the molybdenum blue colorimetric method. All reagents used for mineral analysis and distilled water were employed.

[0140] 1-7. Blood chemical elemental analysis

[0141] After the experiment, 10 animals were randomly collected from each test group. Plasma for blood analysis was collected from the tail vein into a heparin tube using a disposable syringe and centrifuged (2000 rpm, 15 min, 4℃). The plasma was then measured using a blood analyzer (NX500i, FUJI FILM, Japan) for glutamate-oxaloacetate transaminase (GOT), cholesterol (CHO), triglycerides (TG), alkaline phosphatase (ALP), and total protein (TP).

[0142] 1-8. Non-specific immunoassays

[0143] To measure lysozyme activity, after the experiment, 50 μL of serum isolated from the tail veins of 10 eels in each test group and 1 mL of a solution containing *Micrococcus lysodeikticus* (0.2 mg / mL) suspended in 0.05 M sodium phosphate buffer (Sigma, USA, pH 6.2) were mixed in a 96-well plate. The reaction was measured at 0.5 min and 5 min at absorbance of 530 nm using a spectrophotometer (Molecular Device, USA) at 20 °C. The unit of lysozyme activity was defined as the amount of enzyme exhibiting a decrease in absorbance of 0.001 μL per minute.

[0144] To measure the phagocytic activity of neutrophils, after the experiment, serum isolated from the tail veins of 10 eels in each test group was mixed with NBT solution (Sigma, USA) at a 1:1 ratio of 50 μL each. The mixture was then transferred to glass tubes after reacting at 25°C for 30 minutes. 1 mL of dimethylformamide (Sigma, USA) was added to each tube to reduce formazan formation. The supernatant was then collected by centrifugation at 2,000 × g for 5 minutes, and the reduction in NBT was measured at 540 nm using a spectrophotometer (Molecular Device, USA). For the blank, dimethylformamide (Sigma, USA) was used.

[0145] 1-9. Analysis of cholecystokinin and superoxide dismutase

[0146] To analyze the activities of the digestive enzyme cholecystokinin and the antioxidant enzyme superoxide dismutase (SOD), blood was collected from 10 eels in each test group. Serum was separated by centrifugation at 2,000 × g at 4°C and then stored at -70°C. Serum ELISA analysis was performed using a kit capable of measuring cholecystokinin (CUSABIO, USA) and SOD (CUSABIO, USA), with three replicates using 50 µL of plasma per well, according to the manufacturer's protocol. Activity levels were measured at 450 nm using a spectrophotometer (MolecularDevice, USA), and results were calculated in ng / ml (SOD) or pg / mL (cholecystokinin) based on a standard curve.

[0147] Example 2: Analysis of research materials (fish meal powder and Schizochytrium microalgae powder)

[0148] 2-1. Main Components

[0149] The major components of the protein-derived fishmeal powder and Schizochytrium microalgae powder (Schizochytrium powder) used in this study were evaluated and are shown in Table 5 below.

[0150] [Table 5]

[0151]

[0152] As shown in Table 5, it can be confirmed that Schizochytrium powder has lower moisture and ash content compared to fishmeal, and higher crude protein and crude lipid content compared to fishmeal powder.

[0153] 2-2. Amino acids

[0154] The constitutive amino acid composition of fish meal powder and Schizochytrium powder (the two protein powders used in this study) is expressed as g / 100g of total amino acids and is shown in Table 6.

[0155] [Table 6]

[0156]

[0157] *Essential amino acids

[0158] As shown in Table 6, most amino acids are present in high amounts in fishmeal powder, but the glutamic acid content in Schizochytrium powder is about four times that of fishmeal powder, and the content of the essential amino acid arginine in Schizochytrium powder is also higher than that in fishmeal powder.

[0159] 2-3. Fatty acids

[0160] The fatty acid composition of the fat contained in the two protein powders used in this study is expressed as g / 100g of total fatty acids and is shown in Table 7.

[0161] [Table 7]

[0162]

[0163] The content ratios of certain fatty acids differ significantly between the two protein source materials. The fatty acids showing the main differences were myristic acid (C14:0, FP, 5.60; SP, 1.70), palmitic acid (C16:0, FP, 19.96; SP, 36.70), stearic acid (C18:0, FP, 6.68; SP, 1.51), palmitoleic acid (C16:1, FP, 5.99; SP, 0.11), oleic acid (C18:1n9, FP, 18.87; SP, 0.51), linoleic acid (C18:2n6, FP, 2.37; SP, 0.37), linolenic acid (C18:3n3, FP, 0.64; SP, 0.25), eicosadienoic acid (C20:1n9, FP, 1.89; SP, 0.01), and arachidonic acid (C20:4n6, The content of FP (2.84; SP (0.12)), EPA (eicosapentaenoic acid) (C16:0, FP, 9.63; SP, 0.72), nervonic acid (C24:1n9, FP, 3.25; SP, 0.40), and DHA (docosahexaenoic acid) (C22:6n3, FP, 15.09; SP, 45.12) in Schizochytrium powder tends to be lower than in fishmeal powder, but on the other hand, the proportions of palmitic acid and DHA in Schizochytrium powder are very high compared to fishmeal powder.

[0164] 2-4. Preparation of control and test diets

[0165] The following Table 8 shows the composition of a control diet (control, CTL) containing 100% fishmeal powder as a protein source and test diets (alternative diets) T1, T2, T3, T4 and T5 in which 5%, 10%, 15%, 20% and 30% of the fishmeal powder were replaced with Schizochytrium powder, respectively.

[0166] [Table 8]

[0167]

[0168] a, Glumar Co., Chile

[0169] b, CJ Co., South Korea

[0170] c, Biolife Co., Brazil

[0171] d, Asai Co., Thailand

[0172] e, Nelson-Jameson, Inc., USA

[0173] f, Seoul Vet Pharma Co., South Korea

[0174] 2-5. Testing the main components of the feed

[0175] The basic components of the control diet (CTL) and test diets (alternative diets) T1 to T5 used in this experiment were evaluated and are shown in Table 9.

[0176] [Table 9]

[0177]

[0178] As shown in Table 9, it can be confirmed that there are no differences in moisture, crude protein content, crude fat content, and ash content, and the crude carbohydrate content is also assessed to be comparable, and there are no differences in calories between the feeds.

[0179] 2-6. Analysis of fatty acid content in feed

[0180] The fatty acid composition ratios (overview) of the control diet (CTL) and test diets (alternative diets) T1 to T5 used in this experiment were evaluated and expressed as g / 100g total fatty acids, as shown in Table 10.

[0181] [Table 10]

[0182]

[0183] As shown in Table 10 above, the differences in fatty acid composition in the test feed, where fishmeal powder and Schizochytrium powder were mixed in a certain proportion, were confirmed to be proportional to the mixing ratio. It was confirmed that the content of palmitic acid and DHA increased with the increase of the Schizochytrium powder mixing ratio.

[0184] Example 3: Growth Performance Assessment

[0185] For growing freshwater eels (Japanese eels, approximately 20g in size), control and test diets T1 to T5 were provided twice daily for 8 weeks each, and growth performance was assessed, as shown in Table 11 below.

[0186] [Table 11]

[0187]

[0188] a IW (g), Initial weight (g / fish)

[0189] b FW (g), Final weight (g / fish)

[0190] c WG (g), Weight gain = Final weight - Initial weight

[0191] d DFI (g), Total Dry Feed Intake

[0192] e FE (%), Feed Efficiency = (Wet Weight / Dry Feed Intake) x 100

[0193] f WGR (%), Weight Gain Rate = (Final Weight - Initial Weight) x 100 / Initial Weight

[0194] g SGR (%), Specific Growth Rate (% / day) = (log final weight - log initial weight) / number of days x 100

[0195] h SR (%), Survival rate = (Number of fish at the end of the experiment / Number of fish at the beginning of the experiment) x 100

[0196] As shown in Table 11 above, the weight gain rate (WGR) was as follows: T2 (196.25±13.47) > control diet (188.59±4.84) ​​> T1 (182.87±4.77) > T3 (182.07±4.47) > T4 (176.52±8.32) > T5 (175.99±6.99). The feed efficiency (FE) was as follows: T2 (90.86±5.0) > control diet (87.09±2.16) > T1 (85.55±1.52) > T3 (84.53±1.89) > T4 (81.54±3.54) > T5 (81.45±2.97). The specific growth rate (SGR) was also as follows: T2 (1.94±0.08) > Control diet (1.89±0.03) n The order of growth rates was: T1 (1.86±0.03) > T3 (1.85±0.03) > T4 (1.82±0.05) > T5 (1.81±0.05). Therefore, it can be confirmed that the best weight gain, feed efficiency, and specific growth rate were observed in test feed T2. The survival rate (SR) of the test groups was between 97.72% and 100%, with no significant difference.

[0197] Similarly, it can be confirmed that when Schizochytrium powder is used instead of fishmeal powder in the mixing ratio of test feed T2, it promotes the growth of eels and can be effectively used as a feed composition for eels.

[0198] Example 4: Biometrics Assessment

[0199] Biological characteristics such as hepatic body index (HIS) and intestinal body index (ISI) are generally known to vary depending on the fish's dietary nutritional status or habitat environmental conditions and stress. The results of the assessment of hepatic body index and intestinal body index of eel groups fed with control diet and test diets T1-T5 are shown in Table 12 below.

[0200] [Table 12]

[0201]

[0202] a Liver weight (g) / body weight (g) x 100

[0203] b Intestine weight (g) / body weight (g) x 100

[0204] As shown in Table 12, there were no significant differences in hepatosome index and intestinal index between the eel groups fed the control diet and the test diet (T1 to T5). Therefore, it can be confirmed that fishmeal powder can be safely replaced by Schizochytrium powder within the content ratio of the test diet.

[0205] Example 5: Blood Chemical Elemental Analysis

[0206] Chemical tests on fish blood have long been used as indicators of health diagnosis because they can diagnose various diseases or changes in physiological conditions, such as organ damage and stress levels. Ten fish each were randomly collected from control and test diets for eight weeks. Blood levels of glutamate-oxaloacetate transaminase (GOT), triglycerides (TG), cholesterol (CHO), alkaline phosphatase (ALP), and total protein (TP) were measured, as shown in Table 13.

[0207] [Table 13]

[0208]

[0209] As shown in Table 13, all eel groups fed with control diets and those fed with test diets (T1–T5) exhibited similar levels of blood concentrations of GOT (blood liver damage index) (GOT is also known as aspartate aminotransferase (AST)), cholesterol (CHO), alkaline phosphatase (ALO) (the main enzyme in the liver), and total protein (TP). In test diets T1–T5, blood triglycerides (TG) showed a decreasing trend compared to the control diet group with increasing fishmeal replacement ratio, but the difference was not statistically significant.

[0210] Therefore, it can be confirmed that fishmeal powder can be safely replaced by Schizochytrium powder within the content ratio of the tested feed.

[0211] Example 6: Non-specific immunoassay, cholecystokinin and superoxide dismutase analysis

[0212] Fish, as vertebrates, also possess immune defense systems based on non-specific and specific immunity, and their immune activity is known to be highly sensitive to changes in food and aquatic environments. The effects on non-specific immunity were assessed between the control diet (CTL)-fed eel group and the test diets T1–T5-fed eel groups by evaluating the activity of lysozyme (a humoral immune factor) and the phagocytic activity of neutrophils (a cellular immune factor) (Table 14).

[0213] In addition, digestive function was assessed by evaluating cholecystokinin (a hormone that promotes gallbladder contraction and pancreatic enzyme secretion), and the activity of superoxide dismutase (SOD) (an antioxidant enzyme in the blood) was assessed to compare antioxidant activity in the blood (Table 14).

[0214] [Table 14]

[0215]

[0216] As shown in Table 14, all of the lysozyme activity, phagocytic cell activity, cholecystokinin activity, and superoxide dismutase activity showed similar levels between the control and test diets for the eel groups. Therefore, it can be confirmed that fishmeal powder can be safely replaced with Schizochytrium powder within the content ratio of the test diet.

[0217] Example 7: Whole Body Analysis

[0218] 7-1. Main Components

[0219] After grinding and mixing five whole bodies, the moisture content was measured. For the dried ground powder, the contents of the basic components (crude protein, crude fat, ash) as well as Ca and P were measured. The results are shown in Table 15.

[0220] [Table 15]

[0221]

[0222] As shown in Table 15, the levels of water content, crude protein, crude fat, ash, Ca, and P in the whole body were similar between the control diet (CTL) and the test diet (T1-T5) fed eel groups. Therefore, it can be confirmed that fishmeal powder can be safely replaced with Schizochytrium powder within the content ratio range of the test diet.

[0223] 7-2. Constitutive Amino Acids

[0224] The results of the evaluation of the amino acid composition of the eel group fed with control diet (CTL) and the eel group fed with test diets (T1~T5) are shown in Table 16 below.

[0225] [Table 16]

[0226]

[0227] *Essential amino acids

[0228] As shown in Table 16, the constitutive amino acid composition of the whole body showed similar levels between the control diet (CTL) and the test diets (T1–T5) fed to eels. Similarly, the proportions of amino acids, including essential amino acids, showed significant differences between fishmeal powder and Schizochytrium powder (Table 6). However, as shown in Table 16, it was determined that the effect on the constitutive protein composition of the whole body of eels fed with the test diet in which Schizochytrium powder replaced fishmeal powder was minimal. Therefore, it can be confirmed that fishmeal powder can be safely replaced with Schizochytrium powder within the content proportions of the test diet.

[0229] 7-3. Fatty acids

[0230] The results of the assessment of fatty acid composition of the eel group fed with control diet (CTL) and the eel group fed with test diet (T1~T5) are shown in Table 17 below.

[0231] [Table 17]

[0232]

[0233] As shown in Table 17, it can be confirmed that some polyunsaturated fatty acids, such as linoleic acid (CTL, 1.12 > T1, 1.16 > T2, 1.05 > T3, 0.91 > T4, 0.96 > T5, 0.92), EPA (CTL, 2.05 > T1, 2.01 > T2, 2.00 > T3, 1.82 > T4, 1.76 > T5, 1.55), DHA (CTL, 5.36 < T1, 5.75 < T2, 6.33 < T3, 6.82 < T4, 7.95 < T5, 8.27), etc., show content differences proportional to the substitution ratio of Schizochytrium powder. This is consistent with the result that there are large differences in the composition ratios of some fatty acids between the two raw materials in the fatty acid composition ratios of fish meal powder and Schizochytrium powder used for test evaluation (Table 7), and even in the control feed (CTL) and test feeds T1 to T5, it shows differences depending on the mixing ratio of Schizochytrium powder (Table 10). Similarly, it can be confirmed that there are significant differences in the fatty acid compositions of fish meal powder and Schizochytrium powder, and among them, the compositional differences of some essential polyunsaturated fatty acids also affect the differences in the fatty acid composition of fish bodies after feed supply.

[0234] [Deposit Number]

[0235] Name of the depositary institution: Korea Research Institute of Bioscience and Biotechnology, Korean Collection for Type Cultures (KCTC)

[0236] Deposit Number: KCTC15006BP

[0237] Date of deposit: 20220620

[0238]

Claims

1. A feed composition for eels comprising 2.25 wt% to 45 wt% of biomass derived from Schizochytrium microalgae.

2. The feed composition for eels according to claim 1, wherein the biomass derived from microalgae comprises at least one selected from the group consisting of microalgae, cultures of the microalgae, dried products of the cultures, and pyrolytes of the dried products.

3. The feed composition for eels according to claim 1, comprising 4 wt% to 8 wt% of biomass derived from microalgae.

4. The feed composition for eels according to claim 1, wherein the microalgae-derived biomass comprises 40 wt% to 95 wt% protein.

5. The feed composition for eels according to claim 1, wherein the microalgae-derived biomass comprises 3 wt% to 30 wt% fat.

6. The feed composition for eels according to claim 1, wherein the Schizochytrium microalgae is selected from at least one of the group consisting of Schizochytrium aggregates, Schizochytrium slugii, and Schizochytrium microsporum.

7. The feed composition for eels according to claim 1, wherein the eel is at least one selected from the group consisting of Japanese eel, spotted eel, European eel, American eel and bicolor eel.

8. The feed composition for eels according to claim 1, which promotes eel growth.

9. The feed composition for eels according to claim 8, wherein promoting eel growth is increasing the weight gain rate (WGR) of the eels.

10. The feed composition for eels according to claim 8, wherein promoting eel growth is increasing feed efficiency (FE) of the eels.

11. The feed composition for eels according to claim 8, wherein promoting eel growth is increasing the specific growth rate (SGR) of the eels.

12. A method of aquaculture comprising feeding eels the feed composition for eels according to any one of claims 1 to 11.

13. A method for promoting eel growth, comprising feeding eels the feed composition for eels according to any one of claims 1 to 11.

14. Use of the feed composition for eels according to any one of claims 1 to 11 for promoting eel growth.

Citation Information

Patent Citations

  • Feed for cultured fish comprising green tea for development of fleshiness and resistance of fishes disease

    KR1020110026232A

  • Methods for delivering medium-chain triglycerides with controlled pharmacokinetic, safety, and tolerability profiles

    KR1020230086717A