Use of mf-438 in the manufacture of a medicament for the treatment of a peripheral nerve adhesion-related disorder

Abstract

The application provides application of MF-438 in preparation of a drug for treating peripheral nerve adhesion diseases, relates to the field of biomedical technology, and the technical scheme provided in the application not only fills the technical blank of lacking a targeted small-molecule drug for treating peripheral nerve adhesion in clinical treatment, but also proves through verification experiments that MF-438 can significantly reduce the expression of IL-1alpha, IL-1beta, TNF-alpha and other proinflammatory factors, effectively inhibits excessive inflammatory reactions at a nerve adhesion site, and creates a stable local microenvironment for nerve repair; meanwhile, the compound can effectively protect sciatic nerve myelin sheath structures, increase myelin sheath thickness and maintain myelin sheath integrity, and directly plays a nerve protection and repair role; in addition, MF-438 itself has good cell permeability and oral bioavailability, has simple administration, clear action effect and good experimental safety, and therefore has high clinical transformation and industrialization potential, and provides a safe, efficient and clear mechanism new treatment strategy for peripheral nerve adhesion diseases.

Description

Technical Field

[0001] This application relates to the field of biomedical technology, and in particular to the application of MF-438 in the preparation of drugs for treating peripheral nerve adhesion diseases. Background Technology

[0002] Peripheral nerve adhesions are a common complication following clinical trauma, surgery, and inflammation repair, with sciatic nerve adhesions being the most frequent. Abnormal adhesions between the nerve and surrounding tissues can restrict nerve gliding, damage the myelin sheath, and obstruct nerve conduction, leading to serious consequences such as motor disorders, sensory abnormalities, and persistent pain, significantly impacting patients' limb function and quality of life. After nerve adhesions occur, the site of injury is often accompanied by a persistent and excessive inflammatory response and a large release of pro-inflammatory factors, further damaging the myelin sheath and inhibiting nerve repair, which is a core factor hindering the recovery of nerve function. Currently, clinical treatments for peripheral nerve adhesions are limited, mainly relying on physical isolation and surgical release, lacking effective drugs that can achieve targeted interventions at the levels of anti-inflammation, myelin sheath protection, and promotion of nerve repair.

[0003] Therefore, developing safe and effective small molecule drugs that can simultaneously inhibit local inflammation and protect and repair the myelin sheath of nerves is of great practical significance for the clinical treatment of peripheral nerve adhesions. Summary of the Invention

[0004] The purpose of this application is to address the technical problem of the lack of safe and effective drugs in the prior art that can simultaneously inhibit local inflammation and protect and repair the myelin sheath of nerves.

[0005] To achieve the above objectives, this application provides the following technical solution:

[0006] The use of 2-methyl-5-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazole (MF-438) in the preparation of drugs for treating peripheral nerve adhesions.

[0007] Preferably, the peripheral nerve adhesion disease includes sciatic nerve adhesion.

[0008] Preferably, the drug is used to improve motor dysfunction following peripheral nerve adhesions.

[0009] Preferably, the drug is also used to relieve pain abnormalities caused by peripheral nerve adhesions and to increase the latency of foot withdrawal.

[0010] Preferably, the drug can also reduce the expression of IL-1α, IL-1β, and TNF-α, and inhibit excessive local inflammatory response in the nerve.

[0011] Preferably, the drug is also used to reduce the expression of IL-1α, IL-1β, and TNF-α, and to inhibit excessive local inflammatory response in nerves.

[0012] This application also provides a drug for treating peripheral nerve adhesion diseases, wherein the active ingredient of the drug is MF-438.

[0013] Preferably, the drug also includes a medically acceptable carrier or adjuvant.

[0014] Preferably, the dosage form of the drug is an injection, a lyophilized powder for injection, or a sustained-release formulation.

[0015] Preferably, the drug is administered via intraperitoneal injection.

[0016] Compared with the prior art, this application has at least the following beneficial effects:

[0017] This invention discloses for the first time a novel application of MF-438 in the preparation of drugs for treating peripheral nerve adhesion diseases. It not only fills the technical gap in the clinical treatment of peripheral nerve adhesion by the lack of targeted small molecule drugs, but also plays a synergistic therapeutic role from multiple dimensions such as inflammation regulation, structural protection and functional recovery.

[0018] First, MF-438 can significantly reduce the expression of pro-inflammatory factors such as IL-1α, IL-1β, and TNF-α, effectively inhibiting excessive inflammatory response at nerve adhesion sites and creating a stable local microenvironment for nerve repair.

[0019] At the same time, this compound can effectively protect the myelin sheath structure of the sciatic nerve, increase the thickness of the myelin sheath and maintain the integrity of the myelin sheath, and directly play a role in neuroprotection and repair.

[0020] In addition, MF-438 can significantly prolong the time the model mouse stays on the rotarod, accelerate the nerve conduction speed, improve the abnormal state of pain sensitivity, and fully restore the motor and sensory functions after peripheral nerve adhesion.

[0021] In addition, MF-438 itself has good cell permeability and oral bioavailability, simple administration method, clear effect and good experimental safety. Therefore, it has high potential for clinical translation and industrialization, and provides a safe, efficient and mechanism-clear new treatment strategy for peripheral nerve adhesion diseases. Attached Figure Description

[0022] Figure 1 A diagram demonstrating that MF-438 effectively promotes the motor function of mice;

[0023] Figure 2 A diagram demonstrating that MF-438 effectively increases the sciatic nerve conduction rate in mice;

[0024] Figure 3 A diagram demonstrating that MF-438 effectively enhances pain sensitivity in mice;

[0025] Figure 4 MF-438 accelerates the repair and regeneration process of damaged sciatic nerves in mice;

[0026] Figure 5 A diagram demonstrating that MF-438 promotes the integrity of nerve myelin sheaths and has a significant neuroprotective effect;

[0027] Figure 6 This diagram serves as evidence that MF-438 promotes the development and repair of the myelin sheath in the sciatic nerve of mice.

[0028] Figure 7 A diagram demonstrating that MF-438 promotes the expression of myelin-related factors;

[0029] Figure 8 This diagram demonstrates that MF-438 inhibits the expression of inflammatory factors and has a significant anti-inflammatory effect.

[0030] Figure 9 Figure demonstrating the significant anti-inflammatory effect of MF-438 in inhibiting the formation of the inflammasome NLRP3. Detailed Implementation

[0031] This application provides the use of 2-methyl-5-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazole (MF-438) in the preparation of a drug for treating peripheral nerve adhesions.

[0032] The CAS number of MF-438 is 921605-87-0, and its molecular formula is C. 19 H 18 F3N5OS, chemical structural formula is shown below:

[0033] .

[0034] In one embodiment, the peripheral nerve adhesion disease is sciatic nerve adhesion.

[0035] The drug is used to improve motor dysfunction following peripheral nerve adhesions. In one embodiment, the drug is also used to relieve pain abnormalities caused by peripheral nerve adhesions and increase the foot withdrawal latency.

[0036] In one embodiment, the drug is used to protect the myelin sheath structure of the sciatic nerve, increase the myelin sheath thickness, and maintain the integrity of the myelin sheath.

[0037] The drug can also reduce the expression of IL-1α, IL-1β, and TNF-α, and inhibit excessive local inflammatory response in nerves.

[0038] Based on the above applications, this application also provides a medicament for treating peripheral nerve adhesions, wherein the active ingredient of the medicament is MF-438, and in one embodiment, the medicament further includes a medically acceptable carrier or excipient.

[0039] The drug is available in the form of an injection, a lyophilized powder for injection, or a sustained-release formulation.

[0040] The following set of specific verification experiments illustrates the above content:

[0041] I. Experimental Materials:

[0042] 1. Experimental reagents

[0043] 2-Methyl-5-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazole (MF-438, CAS: 921605-87-0, molecular formula: C 19 H 18 F3N5OS), bovine serum albumin, glutaraldehyde, and DMSO were purchased from Sigma-Aldrich; real-time quantitative PCR dyes were purchased from Roche Biotechnology; and primers were from Shanghai Sangon Biotech Co., Ltd.

[0044] 2. Construction of a sciatic nerve adhesion model

[0045] Eight-week-old ICR mice were purchased from the Experimental Animal Center of Nantong University. The sciatic nerve adhesion model was established as follows: Mice were anesthetized by subcutaneous injection of 3% sodium pentobarbital (1 ml / kg). The skin below the buttocks was incised, and the muscles were bluntly incised using fine surgical scissors and forceps to expose the right sciatic nerve in the middle of the thigh. 20 μL of an adhesive (45% bovine serum albumin + 12% glutaraldehyde) was dripped between the sciatic nerve and the muscles to construct the sciatic nerve adhesion model. The experimental group received intraperitoneal injections of 30 µg / kg MF-438 for 7 consecutive days; the control group received intraperitoneal injections of 30 µL DMSO for 7 consecutive days. All animal experimental protocols were approved by the Animal Protection and Utilization Committee of Nantong University and the Jiangsu Provincial Animal Protection Ethics Committee. The establishment of the mouse sciatic nerve adhesion model was conducted according to the approved guidelines.

[0046] II. Verification Experiment

[0047] 1. Animal behavioral testing:

[0048] To clarify the effect of MF-438 on motor recovery in mice with sciatic nerve adhesions, this application conducted rotarod experiments, electrophysiological experiments, and thermal pain detection. The specific experimental steps are as follows:

[0049] Rotating bar experiment:

[0050] The experiment used an accelerating rotating rod device (LE8500, Pan Laboratory). Before the experiment, mice were acclimatized to the laboratory for 30 minutes. The mice were gently placed on the rotating rod by gently swinging it, and trained for 3 days at 3-5 minute intervals in accelerated mode (4-40 rpm). Training was repeated at a constant speed (16 rpm) until the mice could remain on the rod for at least 300 seconds. For the formal experiment, the mice were placed on the rotating drum, and the rod was set to accelerated mode, accelerating at 4-40 rpm for 5 minutes. The time spent moving on the rotating rod was recorded before measuring the fall.

[0051] Electrophysiological experiments:

[0052] In this study, mice were anesthetized with a compound anesthetic. Conduction velocity (NCV) was then measured using an electromyography (EMG) device (Neuropack S1MEB-9402, Nihon-Kohden, Tokyo, Japan). A needle electrode was inserted into the gastrocnemius muscle of the mouse, with a ground electrode clipped to the exposed skin. The stimulation intensity was gradually increased from 0.1 mA to 3.0 mA, triggering a waveform. Stimulation was performed at a frequency of 1 Hz for 1 ms. Data were recorded for further analysis. Throughout the experiment, the mice's body temperature was maintained at 37℃ ± 0.5℃ using a heating lamp.

[0053] Thermal pain detection:

[0054] The peripheral nerve adhesion repair capacity of mice was assessed using a radiative thermal stimulation method by measuring the thermal withdrawal latency (TWL) after controlled radiative thermal stimulation of the mouse paw. Before establishing the model, mice in different groups underwent thermal pain screening to ensure consistent pain perception across all mice. Mice with sciatic nerve adhesions were tested using a plantar thermal pain measurement instrument (IITC Life Science). A glass heat beam from the instrument was projected onto the sole of each model mouse's paw. Stimulation was stopped and the reaction time was timed when the mouse exhibited actions such as paw lifting and withdrawal. Each mouse was measured three times, and the average value was taken as the thermal pain measurement.

[0055] 2. Electron microscopic observation of sciatic nerve tissue

[0056] Three mice with sciatic nerve adhesions for 6 weeks were randomly selected from different groups (MF-438 treatment group and control group). Under deep anesthesia, sciatic nerve tissue from the adhesion site was harvested and cut into electron microscopy specimens (1.2 mm x 1 mm x 1 mm). The specimens were fixed in 4% glutaraldehyde solution, then fixed again with 1% osmium tetroxide, stained with uranium acetate, dehydrated with graded ethanol, embedded in epoxy resin, semi-thin sections for localization, and ultrathin sections counterstained with lead citrate. Selected sections were observed under a transmission electron microscope. The obtained images were analyzed using the instrument's built-in image analysis system to measure the myelinated nerve diameter and axon diameter. The myelin sheath thickness was measured using the axon diameter / myelinated nerve diameter ratio (g-ratio) to infer the protective effect of MF-438 on damaged nerves.

[0057] 3. Total RNA extraction and immune factor expression detection from sciatic nerve tissue

[0058] Sciatic nerve tissue was finely minced using microscissors, then thoroughly ground with 1 mL of Trizol reagent (Invitrogen). Total RNA was extracted from the sciatic nerve tissue to express IL-1α, IL-1β, and TNF-α, inhibiting excessive local inflammation. First-strand cDNA was then synthesized using a Roche reverse transcription kit. Gene expression analysis was performed using Roche's SYBR Green Supermix on a Bio-Rad iQ5 Multicolor Real-Time PCR Detection System. Results were analyzed using 2... -△△Ct mRNA levels were calculated using a method that calibrates mRNA levels using the 18S housekeeping gene. The primer sequences used are as follows:

[0059] 18S rRNA forward primer: AGCTCCAATAGCGTATATTAAAG

[0060] 18S rRNA negative primer: CGGTCCTATTCCATTATTCCTA

[0061] IL1α forward primer: GTGTTGCTGAAGGAGTTG

[0062] IL1α negative primer: ATCTGGAAGTCTGTCATAGAG

[0063] TNF-α forward primer: CTACTGAACTTCGGGGTGAT

[0064] TNF-α negative primer: CAGGCTTGTCACTCGAATT

[0065] IL1β forward primer: GCAACCACTTACCTATTTATTTATG

[0066] IL1β negative primer: TTCATACTCATCAAAGCAATGT

[0067] Pmp22 forward primer: ATCTCAAAGCCTTCGTCACTCC

[0068] Pmp22 negative primer: GGCCAATACAAGTCATCGCTAG

[0069] Mpz forward primer: GGATAAGAAATAGCGGTTAGC

[0070] Mpz negative primer: TTGAGGCTGGTTCTACTG

[0071] 4. Tissue immunofluorescence detection

[0072] Sciatic nerve tissue from mice in each group was fixed overnight in 4% paraformaldehyde. It was then dehydrated in 20% and 30% sucrose solutions, incubated overnight at 4°C, and then embedded in OCT (Sakura; Cat#: 4583) and frozen at -80°C. The frozen sciatic nerve tissue was cut into 12-micrometer thick slices and dried at 37°C. After drying, slides were blocked for 1 hour at room temperature in phosphate-buffered saline (PBS) containing 0.5% Triton X-100 and 10% goat serum. Subsequently, the slides were incubated overnight at 4°C with NF and NLRP3 antibodies, respectively. After three washes, the slides were then incubated with fluorescently conjugated secondary antibody (1:1000; Jackson) at room temperature for 1 hour. Finally, the samples were observed under a fluorescence microscope (Zeiss, Axio Image M2, Germany).

[0073] III. Experimental Results

[0074] The peripheral nervous system is widely distributed throughout the body and plays a crucial role in signal transmission between target organs and the central nervous system. Peripheral nerve injury and adhesions are common clinical symptoms, especially those caused by accidental trauma such as traffic accidents, war, and earthquakes, where nerves and muscles adhere at the site of injury, preventing nerve impulse transmission. The balance of the immune microenvironment at the site of nerve injury and adhesions is fundamental to the executive function of the nervous system; abnormal expression of immune factors can slow the recovery of nerve adhesions. The sciatic nerve is the most important and directly observable material for studying peripheral nerve adhesions. Therefore, this application uses the sciatic nerve for subsequent experiments.

[0075] MF-438 is a cell-permeable, orally bioavailable fatty acid metabolism enzyme inhibitor. It is poorly soluble in water but readily soluble in ethanol, polyethylene glycol 400, DMSO, etc. MF-438 influences multiple physiological processes, including cellular metabolism, apoptosis, and inflammatory homeostasis, by regulating fatty acid metabolism. Reports indicate that MF-438 plays an important role in myelin lipid synthesis and maintenance, and in inhibiting inflammatory storms. It is well known that persistent neuroinflammation caused by nerve adhesions is a key factor affecting the treatment of peripheral nerve adhesions, and MF-438 participates in myelin synthesis and has excellent anti-inflammatory effects.

[0076] To investigate whether MF-438 can improve the degree of peripheral nerve adhesion in vivo, this application established a sciatic nerve adhesion model using ICR mice. Differences in motor behavior, nerve conduction velocity, and pain perception were detected between the experimental and control groups. Motor behavior analysis revealed changes in balance and nerve conduction velocity in mice treated with MF-438. Results showed that mice treated with MF-438 exhibited better recovery of balance, faster nerve conduction velocity, more sensitive pain response, and faster nerve repair. Figure 1-4 ).

[0077] To further clarify the protective effect of MF-438 on adherent sciatic nerve tissue, this application used transmission electron microscopy to observe the myelin sheath tissue of the sciatic nerve in different groups of mice. The results showed that the myelin sheath structure of the adherent nerve was more intact, the newly formed myelin sheath was thicker, and the expression of myelin-related genes was higher after drug treatment. Figure 5-7 ).

[0078] Imbalanced immune homeostasis in adhesion tissues and excessive expression of neuroinflammatory factors are important factors affecting the recovery of nerve adhesions. This application analyzed the effect of the drug on the expression of inflammatory factors. The results showed that the drug effectively regulated the immune microenvironment, reduced the expression of pro-inflammatory factors and the inflammasome NLRP3, significantly inhibited the occurrence and development of inflammation, and was beneficial to nerve recovery. Figure 8-9 ).

[0079] Based on the above description, this application demonstrates that MF-438 can effectively promote the motor balance and nerve conduction rate of mice, promote the recovery of adherent nerves, and has a positive therapeutic effect on peripheral nerve adhesion diseases.

Claims

1. The application of MF-438 in the preparation of drugs for treating peripheral nerve adhesions, characterized in that: MF-438 is 2-methyl-5-(6-(4-(2-(trifluoromethyl)phenoxy)piperidin-1-yl)pyridazin-3-yl)-1,3,4-thiadiazole, and the peripheral nerve adhesion disease is sciatic nerve adhesion.

2. The use of MF-438 according to claim 1 in the preparation of a drug for treating peripheral nerve adhesion diseases, characterized in that: The drug is used to improve motor dysfunction following peripheral nerve adhesions.

3. The use of MF-438 according to claim 1 in the preparation of a drug for treating peripheral nerve adhesion diseases, characterized in that: The drug is also used to relieve pain abnormalities caused by peripheral nerve adhesions.

4. The use of MF-438 according to claim 1 in the preparation of a drug for treating peripheral nerve adhesion diseases, characterized in that: The drug can also reduce the expression of IL-1α, IL-1β, and TNF-α, and inhibit excessive local inflammatory response in nerves.

Images