Recombinant candida tropicalis and its use

Abstract

The application belongs to the technical field of 8-(2-hydroxybenzamido) octanoic acid sodium (SNAC) synthesis, and particularly relates to recombinant Candida tropicalis and application thereof. The preservation number of the recombinant Candida tropicalis is CCTCC NO: M 20253005. The application obtains a recombinant Candida tropicalis suitable for SNAC biosynthesis through screening and genetic modification, and introduces the recombinant Candida tropicalis into the synthesis of SNAC. In the synthesis route, the recombinant Candida tropicalis is used for biofermentation conversion of 2-hydroxy-N-octyl benzamide into 8-(2-hydroxybenzamido) octanoic acid, and the 8-(2-hydroxybenzamido) octanoic acid is salted at the same time of substrate conversion, so as to synthesize SNAC. The method provided by the application uses cheap and easily obtained raw materials, has mild and easy-to-control reaction conditions, high reaction selectivity and specificity, good biological safety, small environmental pollution, and has the potential for large-scale industrial application.

Description

Technical Field

[0001] This invention relates to the field of sodium 8-(2-hydroxybenzamido)octanoate synthesis technology, and particularly to a recombinant tropical Candida and its applications. Background Technology

[0002] Sodium 8-(2-hydroxybenzoamide)octanoate (SNAC), also known as N-(8-[2-hydroxybenzoyl]-amino)octanoate, is an N-acetylated amino acid derivative of salicylic acid. It was first identified as a highly efficient carrier molecule by Emisphere in the 1990s, selected from numerous penetration enhancers. It effectively overcomes the intestinal absorption barrier, enhances gastrointestinal epithelial permeability, promotes transcellular transport and absorption of large active drug molecules, and improves oral bioavailability. This significantly improves medication convenience and patient compliance, making it widely used as a delivery agent for oral drug formulations. It has significant application value and commercial potential in the oral delivery of peptide drugs such as heparin, insulin, and human growth hormone. SNAC not only promotes the oral absorption of protein drugs, but is also an effective means of treating gastrointestinal diseases. It has been proven that oral administration of sodium 8-(2-hydroxybenzamide)octanoate (2.5 mg / day) can effectively treat gastrointestinal diseases caused by malabsorption of diphosphate compounds, and is more effective and safer than previous drugs.

[0003] Currently, the synthesis of sodium 8-(2-hydroxybenzamido)octanoate is mainly carried out by chemical methods. However, the main chemical synthesis routes often rely on toxic raw materials such as N'N-carbonyldiimidazole, ethyl chloroformate, or oxalyl chloride, or require high-cost raw materials such as 8-aminooctanoic acid and its derivatives. Furthermore, some routes are lengthy, involving steps such as the synthesis of the intermediate Carsalam, nucleophilic substitution, hydrolysis, and salt formation, which can easily lead to significant yield losses of the target product SNAC. In the preliminary research of this invention, the synthesis and salt formation of 8-(2-hydroxybenzamido)octanoic acid were carried out simultaneously using a microbial cell factory fermentation substrate, greatly shortening the SNAC synthesis route and offering advantages such as low synthesis cost and simple, easily controllable reaction conditions. However, highly efficient SNAC biosynthetic microorganisms are still lacking. Existing microorganisms, such as Saccharomyces cerevisiae and Candida albicans, tend to over-oxidize 8-(2-hydroxybenzamido)octanoic acid (SNAC) through fatty acid β-oxidation when fermenting substrates, producing a large number of byproducts and reducing the accumulation of SNAC. Therefore, it is essential to develop novel SNAC biosynthetic microorganisms to improve the efficiency and / or specificity of SNAC biosynthesis. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention, through screening and genetic modification, obtained a recombinant Candida tropicalis strain suitable for SNAC biosynthesis and introduced it into the synthesis of SNAC. In this synthetic route, 2-hydroxy-N-octylbenzamide is converted to 8-(2-hydroxybenzamido)octanoic acid via biofermentation of the recombinant Candida tropicalis, and 8-(2-hydroxybenzamido)octanoic acid is salted simultaneously with substrate conversion to synthesize SNAC. The method provided by this invention uses inexpensive and readily available raw materials, has mild and easily controllable reaction conditions, high selectivity and specificity, good biosafety, and low environmental pollution, possessing the potential for large-scale industrial application. This invention is specifically achieved through the following technical solutions:

[0005] The first aspect of this invention provides a recombinant Candida tropicalis, with accession number CCTCC NO: M20253005.

[0006] The second aspect of the present invention provides the use of the recombinant tropical Candida as described above in the preparation of sodium 8-(2-hydroxybenzamido)octanoate.

[0007] A third aspect of this invention provides a method for preparing sodium 8-(2-hydroxybenzamido)octanoate, comprising the following steps:

[0008] The recombinant Candida tropicalis described above was inoculated into a fermentation medium, and 2-hydroxy-N-octylbenzamide and a salt-forming agent were added. The pH of the fermentation medium was controlled to be alkaline, and the recombinant Candida tropicalis was cultured to obtain sodium 8-(2-hydroxybenzamide)octanoate.

[0009] Furthermore, the fermentation medium also includes a co-solvent, which is selected from Triton X-100, Tween 80, Tween 60, nonylphenol polyoxyethylene ether-40, poloxamer 18, dimethyl sulfoxide, or cyclodextrin, and the amount of the co-solvent added is 1-5%. Even further, the co-solvent is selected from Triton X-100, Tween 80, or nonylphenol polyoxyethylene ether-40, and the amount added is 0.5%.

[0010] Furthermore, the salt-forming agent is selected from one of NaOH, Na2CO3, or NaHCO3.

[0011] Furthermore, the fermentation medium comprises 100 g / L glycerol, 13 g / L amino-free yeast nitrogen source, 6 g / L yeast extract, 3.64 g / L KH2PO4 and 3 g / L K2HPO4, with a pH value greater than 7 or less than or equal to 8.

[0012] Furthermore, the recombinant Candida tropicalis was cultured at 25℃-35℃ and 150-250 rpm for 60-96 h. Even further, the recombinant Candida tropicalis was cultured at 28℃-30℃ and 200-250 rpm for 72-84 h.

[0013] Furthermore, the inoculum size of the recombinant Candida tropicalis is 0.5-5%. Even further, the inoculum size is 1%.

[0014] Furthermore, the concentration of the 2-hydroxy-N-octylbenzamide is 10-40 mM.

[0015] Furthermore, the preparation method of the 2-hydroxy-N-octylbenzamide includes the following steps:

[0016] Methyl salicylate and n-octylamine were mixed evenly and subjected to an amidation reaction. The reaction mixture was collected and purified to obtain the 2-hydroxy-N-octylbenzamide.

[0017] Furthermore, the conditions for the amidation reaction include stirring at 140°C for 16 hours.

[0018] The advantages and positive effects of this invention are as follows:

[0019] Unlike previous reports on the synthesis of sodium 8-(2-hydroxybenzamido)octanoate (SNAC), which all employed chemical methods, this invention utilizes screening and genetic modification through the knockout of endogenous POX2, POX4, and POX5 genes to obtain a recombinant Candida tropicalis strain AT522 with excellent catalytic synthesis capabilities for fatty acid compounds, suitable for the biosynthesis of SNAC. This invention first uses salicylic acid or its derivatives (such as methyl salicylate) and n-octylamine as substrates to chemically synthesize 2-hydroxy-N-octylbenzamide. Then, 8-(2-hydroxybenzamido)octanoate is synthesized via a multi-enzyme cascade catalysis in recombinant Candida tropicalis AT522. Simultaneously with substrate transformation, 8-(2-hydroxybenzamido)octanoate is salted to obtain SNAC. The provided method uses inexpensive and readily available raw materials such as salicylic acid or methyl salicylate and n-octylamine. The core reaction relies on biological fermentation, with mild and easily controllable reaction conditions, high selectivity and specificity, good biosafety, and low environmental pollution, possessing the potential for large-scale industrial application. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 This is a gas chromatogram of the recombinant Candida tropicalis transformed into an octane substrate in Example 2 of the present invention;

[0022] Figure 2 This is a gas chromatogram of the recombinant Candida tropicalis transformed with n-tetane substrate in Example 2 of the present invention;

[0023] Figure 3 This is a gas chromatogram of the recombinant Candida tropicalis transformed with n-heptadecane substrate in Example 2 of the present invention;

[0024] Figure 4 This is a thin-layer chromatography result of recombinant Candida tropicalis transforming 2-hydroxy-N-octylbenzamide substrate in Example 2 of the present invention;

[0025] Figure 5 This is a synthetic route diagram for the synthesis of sodium 8-(2-hydroxybenzamido)octanoate using recombinant Candida tropicalis as a cell factory in Example 3 of the present invention;

[0026] Figure 6 This is a thin-layer chromatography result of recombinant Candida tropicalis transforming 2-hydroxy-N-octylbenzamide substrate under different cosolvent conditions in Example 3 of the present invention;

[0027] Figure 7 This is a high-performance liquid chromatogram of the substrate 2-hydroxy-N-octylbenzamide transformed by recombinant Candida tropicalis in Example 3 of the present invention. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0029] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0030] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods. Furthermore, the terms "comprising," "including," "containing," "having," and similar words are non-limiting in meaning, allowing for the addition of other steps and components that do not affect the result.

[0031] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

[0032] In previous studies, this invention screened a class of microbial strains suitable for SNAC biosynthesis, including *Candida tropicalis* and *Yarrowia lipolytica*. However, in actual production, while these strains can synthesize SNAC through biofermentation, the generation of a large number of byproducts limits their application. Building upon the aforementioned research, this invention first screens yeast strains with highly efficient ω-oxidation capabilities (terminal alkyl oxidation) in nature. Specifically, a *Candida tropicalis* AT strain was isolated and screened from petroleum-contaminated soil. This strain can synthesize the SNAC free acid—8-(2-hydroxybenzamido)octanoic acid—through a multi-enzyme cascade (endogenous functional enzymes including cytochrome P450 oxidase (CYP), cytochrome P450 oxidoreductase (CPR), fatty alcohol oxidase (FAO), alcohol dehydrogenase (ADH), and aldehyde dehydrogenase (FALDH)), demonstrating good potential in SNAC biosynthesis. However, due to its β-oxidation ability, the accumulation of 8-(2-hydroxybenzamido)octanoic acid is limited. Therefore, this invention further uses Candida tropicalis AT as the starting strain and genetically modifies it to knock out three key genes POX2, POX4 and POX5 for fatty acid β-oxidation. The resulting recombinant Candida tropicalis AT522 has good catalytic synthesis ability of fatty acids. It can convert, synthesize and effectively accumulate 8-(2-hydroxybenzamido)octanoic acid in alkaline sodium hydroxide or sodium bicarbonate environment, and simultaneously carry out salt formation reaction to generate sodium 8-(2-hydroxybenzamido)octanoate (SNAC).

[0033] Therefore, this invention develops a SNAC synthesis route that mainly relies on bio-fermentation. It uses recombinant Candida tropicalis AT522 to convert 2-hydroxy-N-octylbenzamide substrate, enabling simultaneous selective oxidation and salt formation of the substrate. This significantly shortens the SNAC synthesis route. Moreover, the terminal alkyl oxidation exhibits high reactivity and selectivity, the conversion process is more environmentally friendly with fewer side reactions, and the reaction process is mild. The efficient conversion of the substrate can be achieved using conventional yeast fermentation conditions and culture processes, which helps control costs. In addition, the SNAC produced by this invention has advantages such as good biosafety and low environmental pollution, and has the potential for large-scale industrial application.

[0034] Based on this, one embodiment of the present invention provides a recombinant Candida tropicalis, with accession number CCTCC NO: M20253005, accession date December 25, 2025, deposited at the China Center for Type Culture Collection, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province (Wuhan University), culture name Candida tropicalis AT522, and taxonomic name Candida tropicalis AT522.

[0035] The recombinant Candida tropicalis described herein was derived from wild-type Candida tropicalis AT, with the endogenous URA3 gene knocked out as a selection marker. Additionally, the POX2, POX4, and POX5 genes were knocked out to obtain the modified microorganism AT ura3 / ura3 pox2 / pox2 pox4 / pox4 pox5 / pox5. Gene knockout was performed using conventional homologous recombination knockout methods.

[0036] Another embodiment of the present invention provides the use of the recombinant Candida tropicalis as described above in the preparation of sodium 8-(2-hydroxybenzamido)octanoate (SNAC).

[0037] The advantages of the recombinant Candida tropicalis in the preparation of SNAC are basically the same as the advantages of the recombinant Candida tropicalis over the prior art as described above, and will not be repeated here.

[0038] Another embodiment of the present invention provides a method for preparing sodium 8-(2-hydroxybenzamido)octanoate (SNAC), comprising the following steps:

[0039] The recombinant Candida tropicalis described above was inoculated into a fermentation medium, and 2-hydroxy-N-octylbenzamide and a salt-forming agent were added. The pH of the fermentation medium was controlled to be alkaline, and the recombinant Candida tropicalis was cultured to obtain sodium 8-(2-hydroxybenzamide)octanoate.

[0040] Optionally, the fermentation medium further includes a co-solvent, which includes, but is not limited to: Triton X-100, Tween 80, Tween 60, nonylphenol polyoxyethylene ether-40 (NP-40), poloxamer 188 (P188), dimethyl sulfoxide (DMSO), or cyclodextrin. Triton X-100, NP-40, or Tween 80 are preferred; Triton X-100 is more preferred.

[0041] Optionally, the amount of the co-solvent added is 1-5% (w / v or v / v); that is, when the co-solvent is solid (NP40 and P188), the amount of the co-solvent added accounts for 1-5% (w / v) of the fermentation medium by mass-volume ratio, and when it is liquid (Triton X-100, Tween 80), the amount of the co-solvent added accounts for 1-5% (v / v) of the total volume of the fermentation medium by volume ratio; preferably 0.5%.

[0042] Optionally, the salt-forming agent is selected from NaOH, Na2CO3, or NaHCO3. By adding the salt-forming agent and controlling the pH value to 7-8 during the reaction, a neutralization reaction occurs to generate the corresponding sodium salt SNAC.

[0043] The fermentation medium for culturing Candida tropicalis uses a conventional liquid culture medium in the art. In a preferred embodiment of the present invention, the fermentation medium comprises 100 g / L glycerol, 13 g / L amino-free yeast nitrogen source, 6 g / L yeast extract, 3.64 g / L KH2PO4 and 3 g / L K2HPO4, with a pH of 7-8 (excluding the endpoint 7, i.e., pH greater than 7 or less than or equal to 8).

[0044] The culture conditions are standard yeast culture conditions, such as 25℃-35℃ and 150-250 rpm. The culture time is adjusted adaptively according to cell activity, inoculum size, substrate concentration, and conversion rate, and is usually 60-96 h, preferably 72-84 h.

[0045] Preferably, the culture conditions are 28℃-30℃ and 200-250 rpm; more preferably, 30℃ and 250 rpm.

[0046] Optionally, the inoculation amount of the recombinant Candida tropicalis is 0.5-5%; preferably 1%.

[0047] Optionally, the concentration of the 2-hydroxy-N-octylbenzamide is 10-40 mM; preferably 20 mM.

[0048] The method for purifying SNAC from fermentation medium adopts conventional methods in the art, such as cooling the fermentation broth (0-4°C) to crystallize, filtering to obtain SNAC solid, washing with an alcohol solution (such as isopropanol), and recrystallizing to obtain high-purity SNAC. The present invention does not have any special limitations on these methods and steps.

[0049] 2-Hydroxy-N-octylbenzamide, used as a fermentation substrate for recombinant Candida tropicalis, can be synthesized using conventional methods in the art. For example, it can be generated by esterification of salicylic acid (CAS No.: 69-72-7) and n-octylamine (CAS No.: 111-86-4) as substrates; or by acylation of methyl salicylate (CAS No.: 119-36-8) or salicyl chloride (CAS No.: 1441-87-8) and n-octylamine (CAS No.: 111-86-4) as substrates. Esterification and amidation reactions are conventional techniques in the art and will not be described in detail here.

[0050] The method for synthesizing 2-hydroxy-N-octylbenzamide in this invention uses inexpensive, simple, and readily available raw materials, thus avoiding the use of expensive 8-aminooctanoic acid or its derivatives, as well as toxic raw materials such as ethyl chloroformate. The subsequent bio-fermentation conversion of 2-hydroxy-N-octylbenzamide is carried out under mild and easily controllable reaction conditions, and has the advantages of high atom economy and green production.

[0051] In a preferred embodiment, the preparation method of the 2-hydroxy-N-octylbenzamide includes the following steps:

[0052] Methyl salicylate and n-octylamine were mixed thoroughly and subjected to an amidation reaction. The reaction mixture was collected and purified to obtain the 2-hydroxy-N-octylbenzamide. The reaction equation for this step is as follows:

[0053] .

[0054] It is understood that each molecule of methyl salicylate and each molecule of n-octylamine undergoes an amidation reaction. Therefore, a molar ratio of methyl salicylate to n-octylamine of 1:1 is preferred to ensure sufficient reaction between the raw materials. Of course, to improve reaction efficiency, one of the raw materials can be appropriately in excess, such as a molar ratio of methyl salicylate to n-octylamine of 1:1.1.

[0055] Optionally, the conditions for the amidation reaction include stirring at 140°C for 16 hours.

[0056] Optionally, the method for purifying the 2-hydroxy-N-octylbenzamide includes: collecting the reaction mixture, cooling it to room temperature, diluting it with dichloromethane in a volume of 10-20 times that of the reaction mixture, washing it twice with 5% hydrochloric acid aqueous solution, then washing it once with distilled water, collecting the organic phase, drying it with anhydrous sodium sulfate, filtering it, concentrating it by rotary evaporation, and purifying it by silica gel column chromatography to obtain 2-hydroxy-N-octylbenzamide solid.

[0057] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0058] The formulations of the main culture media involved in the following examples are as follows:

[0059] (1) YPD medium: 10 g / L yeast extract, 20 g / L peptone and 20 g / L glucose;

[0060] (2) YPD-NTC medium: Add 0.2 g / L of norepinephrine to YPD medium;

[0061] (3) YPD-FOA medium: 2 g / L 5-fluoroorotic acid was added to YPD medium;

[0062] (4) YPM medium: 10 g / L yeast extract, 20 g / L peptone and 20 g / L maltose;

[0063] (5) MM medium: 6.7 g / L amino-free yeast nitrogen source and 20 g / L glucose;

[0064] (6) SM medium: 6.7 g / L amino-free yeast nitrogen source, 20 g / L glucose and 0.1 g / L uracil;

[0065] (7) Fermentation medium: 100 g / L glycerol, 13 g / L amino-free yeast nitrogen source, 6 g / L yeast extract, 3.64 g / L KH2PO4 and 3 g / L K2HPO4.

[0066] Add 20 g / L of agar to the solid culture medium.

[0067] Example 1: Isolation, screening and engineering modification of Candida tropicalis

[0068] 1.1 Isolation and screening of Candida tropicalis with terminal alkyl oxidation ability

[0069] *Candida tropicalis* is widely used in the industrial biosynthesis of dicarboxylic acids from alkanes, exhibiting excellent terminal alkyl oxidation capabilities, thus suggesting its potential for SNAC synthesis. This example uses petroleum-contaminated soil collected from the Guanghua Oilfield in Qianjiang as the test sample for isolating and screening *Candida tropicalis* strains. The collected soil sample was added to sterile water, shaken, and cultured to prepare a soil suspension. The suspension was then serially diluted, and the diluted solutions were spread on YPD solid medium and incubated at 30°C for 48 hours. Based on morphology and colony characteristics, strains suspected to be *Candida tropicalis* were initially isolated. These candidate strains were then streaked onto YPD solid medium for further purification.

[0070] The purified strain was identified as *Candida tropicalis* by 18S rDNA sequencing (nucleotide sequence as shown in SEQ ID NO.8) and sequenced by blast sequence alignment in NCBI, and named *Candida tropicalis* AT.

[0071] 1.2 Genetic Engineering of Candida tropicalis

[0072] Although the isolated *Candida tropicalis* species possesses good terminal alkyl oxidation ability, capable of oxidizing terminal alkyl groups using short-chain and long-chain alkanes as substrates to generate fatty acid compounds, its strong β-oxidation ability leads to further oxidation of these fatty acid compounds. The vast majority of these compounds degrade into byproducts and cannot accumulate effectively. This makes it unsuitable for the biosynthesis of the free acid 8-(2-hydroxybenzamido)octanoic acid (SNAC). Therefore, this invention further engineered the species by knocking out the acyl-CoA oxidase genes POX2, POX4, and POX5 in its genome. Acyl-CoA oxidase is a key enzyme in fatty acid β-oxidation; gene knockout blocks β-oxidation, preventing the degradation of fatty acids such as 8-(2-hydroxybenzamido)octanoic acid. Furthermore, to facilitate the screening of engineered strains, the key gene URA3 for uracil synthesis is knocked out. Auxotrophic strains lacking the URA3 enzyme require uracil (U)-added media to grow. When the exogenous URA3 gene is successfully transformed into a URA3-deficient strain, its expression allows the recombinant strain to revert to the wild-type phenotype, enabling it to grow on uracil-free media. Untransformed or failed-transformed cells cannot grow, thus serving as a positive selection mechanism. This significantly improves the screening efficiency of positive transformants.

[0073] 1.2.1 Construction of Gene Knockout Kits

[0074] (1) Construction of basic carrier

[0075] FLP recombinase is a site-specific DNA recombinase derived from *Saccharomyces cerevisiae*, containing 423 amino acids. The FRT (FLP-recombinase target) is the recognition site for FLP, with a minimum length of 34 bp. When two FRTs are located on the same DNA strand and aligned, the FLP recombinase effectively deletes the sequence between the two FRTs and one FRT site. Based on this principle, a selection marker (the key gene for uracil synthesis, URA3) is placed between two FRT sites. This selection marker can be recovered during FLP expression, enabling repeated use of the selection marker in yeast gene editing. Maltose-inducible promoters P are placed upstream and downstream of the FLP site. MAL2 and Termination T TRP1 The FLP expression box was obtained. MAL2 The promoter is not expressed under normal circumstances, but after adding the inducer maltose, it is expressed efficiently and the recombinant selection tag is deleted.

[0076] pUC57-P MAL2 -FLP-T TRP1 Vector construction: Using the Candida tropicalis genome as a template, the endogenous maltose-inducible promoter P was obtained by PCR amplification. MAL2 and Termination T TRP1 The fragment, with amplification primer pair P MAL2 -F and P MAL2 -R (nucleotide sequence as shown in SEQ ID NO. 9-10) and T TRP1 -F and T TRP1 -R (nucleotide sequence as shown in SEQ ID NO. 11-12); using plasmid pUC57-FLP (synthesized by Wuhan Jinkairui Biotechnology Co., Ltd.) as the backbone, and employing YALEPIC... ® Universal Seamless Cloning and Recombination Kit (YALEPCI) ® The Universal Seamless Cloning Assemble Kit incorporates the endogenous maltose-inducible promoter P MAL2 and Termination T TRP1 The fragments were assembled into the N-terminus and C-terminus of the FLP recombinase gene using a one-step cloning method to obtain the vector pUC57-P. MAL2 -FLP-T TRP1 , where P MAL2 -FLP-T TRP1 The nucleotide sequence of the fusion fragment is shown in SEQ ID NO.1, where bp 1-598 is P. MAL2 The promoter, from 599 to 1870 bp is the FLP gene, and from 1871 to 2070 bp is the T gene. TRP1 Termination of contract.

[0077] pUC57-FRT-P MAL2 -FLP-T TRP1 Construction of the CmURA3-FRT vector: Using the genome of *C. maltosa* as a template, the CmURA3 expression cassette (nucleotide sequence as shown in SEQ ID NO. 13-14) and an FRT site (sequence gaagttcctattctctagaaagtataggaacttc) were amplified using primer pairs CmURA3-F and CmURA3-R (nucleotide sequences as shown in SEQ ID NO. 13-14). The plasmid pUC57-P constructed in step (1) was used to amplify the expression cassette (nucleotide sequence as shown in SEQ ID NO. 2) and an FRT site (sequence gaagttcctattctctagaaagtataggaacttc). MAL2 -FLP-T TRP1 As the plasmid backbone, YALEPIC was used. ® The kit loads the CmURA3-FRT fusion genome onto a plasmid backbone to obtain pUC57-P. MAL2 -FLP-T TRP1 -URA3-FRT. Then with pUC57-P MAL2 -FLP-T TRP1 -CmURA3-FRT is the template, accessed via P MAL2 The primer pairs (FRT)-F and PUC57(FRT)-R (nucleotide sequences shown in SEQ ID NO. 15-16) were reverse-amplified to introduce a second FRT site, yielding the recombinant plasmid pUC57-FRT-P. MAL2 -FLP-T TRP1 -CmURA3-FRT.

[0078] (2) Construction of CtURA3 gene knockout cassette

[0079] Using the Candida tropicalis genome as a template, the CtURA3 gene and homologous arms (approximately 1000 bp each) were amplified by PCR using primer pairs ctURA3-HL-F and ctURA3-HR-R (nucleotide sequences shown in SEQ ID NO. 17-18). These were named HL(CtURA3) and HR(CtURA3), respectively. The nucleotide sequence of the HL(CtURA3)-CtURA3-HR(CtURA3) fusion fragment is shown in SEQ ID NO. 3, where 1-889 bp is HL(CtURA3), 890-1696 bp is the CtURA3 gene, and 1697-2687 bp is HR(CtURA3). The aforementioned fragments were assembled into the pUC57 plasmid using a one-step cloning method to obtain the plasmid pUC57-HL(CtURA3)-CtURA3-HR(CtURA3).

[0080] Using the commercially available plasmid pCT-tRNA (purchased from Biobw, catalog number bio-134685) as a template, the norovirus resistance gene expression cassette CdTEFp-SAT1-MgPGK1t was amplified by PCR using the primer pair CdTEF1p-F and MgPGK1t-R (nucleotide sequence shown in SEQ ID NO.19-20). The nucleotide sequence is shown in SEQ ID NO.4. This fragment was assembled into pUC57-HL(CtURA3)-CtURA3-HR(CtURA3) to obtain the plasmid pUC57-HL(CtURA3)-CdTEFp-SAT1-MgPGK1t-HR(CtURA3). Then, using it as a template, the recombinant fragment HL(CtURA3)-CdTEFp-SAT1-MgPGK1t-HR(CtURA3) for knocking out CtURA3 was obtained by PCR amplification using CtURA3-HL-F and CtURA3-HR-R primer pairs.

[0081] (3) Construction of the POX2 gene knockout cassette

[0082] Using the Candida tropicalis genome as a template, the POX2 gene and a fragment containing approximately 500 bp upstream and downstream HL(POX2) and HR(POX2) fragments were amplified by PCR using the primer pairs CtPOX2-HL-F and CtPOX2-HR-R (nucleotide sequences shown in SEQ ID NO. 21-22). The nucleotide sequence of the HL(POX2)-POX2-HR(POX2) fusion fragment is shown in SEQ ID NO. 5, where 1-533 bp is HL(POX2), 544-2711 bp is the POX2 gene, and 2712-3272 bp is HR(POX2). The aforementioned fragments were assembled into the pUC57 plasmid using a one-step cloning method to obtain the plasmid pUC57-HL(POX2)-POX2-HR(POX2).

[0083] pUC57-FRT-P MAL2 -FLP-T TRP1 -CmURA3-FRT is the template, via FRT1-P MAL2 Primer pair -F and CmURA3t-R (nucleotide sequence as shown in SEQ ID NO. 23-24) were used for PCR amplification to obtain fragment FRT-P. MAL2 -FLP-T TRP1 -CmURA3 was assembled into plasmid pUC57-HL(POX2)-POX2-HR(POX2) to obtain plasmid pUC57-HL(POX2-FRT-P MAL2 -FLP-T TRP1-CmURA3-HR(POX2), and then reverse amplified using primer pairs FRT2-POX2HR-F and FRT2-CmURA3-R (nucleotide sequences shown in SEQ ID NO. 25-26) to introduce the second FRT site, obtaining the recombinant plasmid pUC57-HL(POX2)-FRT-P. MAL2 -FLP-T TRP1 -CmURA3-FRT-HR(POX2). Then, using it as a template, PCR amplification was performed using CtPOX2-HL-F and CtPOX2-HR-R primer pairs to obtain the recombinant fragment HL(POX2)-FRT-P for knocking out the POX2 gene. MAL2 -FLP-T TRP1 -CmURA3-FRT-HR(POX2).

[0084] (4) Construction of the POX4 gene knockout cassette

[0085] Using the Candida tropicalis genome as a template, the POX4 gene and fragments containing approximately 500 bp upstream and downstream HL(POX4) and HR(POX4) were amplified by PCR using primer pairs CtPOX4-HL-F and CtPOX4-HR-R (nucleotide sequences shown in SEQ ID NO. 27-28). The nucleotide sequence of the HL(POX4)-POX4-HR(POX4) fusion fragment is shown in SEQ ID NO. 6, where 1-521 bp is HL(POX4), 522-2651 bp is the POX4 gene, and 2652-3182 bp is HR(POX4). The aforementioned fragments were assembled into the pUC57 plasmid using a one-step cloning method to obtain the plasmid pUC57-HL(POX4)-POX4-HR(POX4).

[0086] The PCR-amplified fragment FRT-P MAL2 -FLP-T TRP1 -CmURA3 was assembled into plasmid pUC57-HL(POX4)-POX4-HR(POX4) to obtain plasmid pUC57-HL(POX4-FRT-P MAL2 -FLP-T TRP1 -CmURA3-HR(POX4), and then reverse amplified using the primer pair FRT2-POX4HR-F (nucleotide sequence shown in SEQ ID NO.29) and FRT2-CmURA3-R to introduce the second FRT site, obtaining the recombinant plasmid pUC57-HL(POX4)-FRT-P. MAL2 -FLP-T TRP1-CmURA3-FRT-HR(POX4). Then, using it as a template, PCR amplification was performed using CtPOX4-HL-F and CtPOX4-HR-R primer pairs to obtain the recombinant fragment HL(POX4)-FRT-P for knocking out the POX4 gene. MAL2 -FLP-T TRP1 -CmURA3-FRT-HR(POX4).

[0087] (5) Construction of the POX5 gene knockout cassette

[0088] Using the Candida tropicalis genome as a template, the POX5 gene and fragments containing approximately 500 bp upstream and downstream HL(POX5) and HR(POX5) were amplified by PCR using primer pairs ctPOX5-HL-F and ctPOX5-HR-R (nucleotide sequences shown in SEQ ID NO. 30-31). The nucleotide sequence of the HL(POX5)-POX5-HR(POX5) fusion fragment is shown in SEQ ID NO. 7, where 1-522 bp is HL(POX5), 523-2511 bp is the POX5 gene, and 2512-3084 bp is HR(POX5). The aforementioned fragments were assembled into the pUC57 plasmid using a one-step cloning method to obtain the plasmid pUC57-HL(POX5)-POX5-HR(POX5).

[0089] The PCR-amplified fragment FRT-P MAL2 -FLP-T TRP1 -CmURA3 was assembled into plasmid pUC57-HL(POX5)-POX5-HR(POX5) to obtain plasmid pUC57-HL(POX5-FRT-P. MAL2 -FLP-T TRP1 -CmURA3-HR(POX5), and then reverse amplified using the primer pair FRT2-POX5HR-F (nucleotide sequence shown in SEQ ID NO.32) and FRT2-CmURA3-R to introduce the second FRT site, obtaining the recombinant plasmid pUC57-HL(POX5)-FRT-P. MAL2 -FLP-T TRP1 -CmURA3-FRT-HR(POX5). Then, using it as a template, PCR amplification was performed using ctPOX5-HL-F and ctPOX5-HR-R primer pairs to obtain the recombinant fragment HL(POX5)-FRT-P for knocking out the POX5 gene. MAL2 -FLP-T TRP1 -CmURA3-FRT-HR(POX5).

[0090] 1.2.2 Construction of recombinant Candida tropicalis

[0091] (1) Construction of Candida tropicalis AT ura3 / ura3

[0092] URA3 is a key gene for uracil synthesis in *Candida tropicalis*. Knocking out URA3 prevents cells from synthesizing uracil, leading to stunted growth. Only the exogenous introduction of the URA3 gene or the supplementation of uracil can restore cell growth. In yeast genetic transformation, the choice of selection tags is crucial. Due to the poor stability of antibiotics and their susceptibility to high temperatures, auxotrophic selection tags such as URA3 are a better choice than resistance tags. To obtain a uracil-deficient strain by knocking out the endogenous CtURA3 gene in the allotrophic *Candida tropicalis* AT522, SAT1 was used as the selection tag. The recombinant fragment HL(CtURA3)-CdTEFp-SAT1-MgPGK1t-HR(CtURA3) used to knock out the CtURA3 gene was electroporated into the starting strain AT522. An appropriate amount of bacterial culture was plated on a YPD-NTC solid culture base and incubated at 28°C for 2-3 days.

[0093] The electroporation procedure for Candida tropicalis is as follows: Candida tropicalis is inoculated into YPD medium and cultured; when OD... 600 When the cells reach approximately 5-10, centrifuge at 700×g for 5 minutes, collect and resuspend in an aqueous solution containing 100 mM LiOAc, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 10 mM DTT, and incubate at room temperature for 1 h. Wash the resuspended cells twice with ice water, then wash once with ice-cold 1M sorbitol, and resuspend in the remaining sorbitol, aliquoting 50 μL as electrocompetent cells. Mix 50 μL of the obtained electrocompetent cells with the recombinant DNA fragment, transfer to a 2 cm electroporation cuvette, and perform electroporation using a Bio-Rad PulserXCell Electroporator with a 1.8 kV pulse. Immediately after electroporation, add 1 mL of ice-cold 1M sorbitol to the cuvette, centrifuge in a 1.5 mL centrifuge tube, resuspend in 1 mL of YPD medium, and revive for 4 h. Then, take an appropriate amount of bacterial suspension and spread it on YPD-NTC selection medium.

[0094] Positive transformants grown on YPD-NTC solid medium were incubated at 30°C for 2-3 days, and then single colonies were picked for colony PCR verification. The same strain was streaked on MM and SM media. The strain that could not grow on MM medium but could grow on SM medium (MM + 0.1 g / L uracil) was the uracil auxotrophic strain AT522 ura3::CdTEFp-SAT1-MgPGK1t / ura3::CdTEFp-SAT1-MgPGK1t, abbreviated as AT ura3 / ura3.

[0095] (2) Construction of Candida tropicalis ATura3 / ura3 pox2 / pox2

[0096] Tropical Candida is typically diploid, requiring complete knockout of both POX2 genes. In practice, it has been found difficult to knock out both alleles through homologous recombination in a single genetic transformation; the vast majority of transformants are single-knockout strains. Therefore, in this embodiment, POX2, 4, and 5 are transformed twice to ensure complete knockout of the diploid alleles.

[0097] Using CmURA3 as a selection marker, the recombinant fragment HL(POX2)-FRT-P, used to knock out the POX2 gene, was selected. MAL2 -FLP-T TRP1 CmURA3-FRT-HR(POX2) was transformed into the starting strain AT ura3 / ura3 via electroporation. An appropriate amount of bacterial culture was spread onto MM solid medium and incubated at 28°C for 2-3 days. After transformants emerged, a portion of the transformants were selected for genomic verification via PCR. Correct transformants were cultured overnight in YPM liquid medium to induce FLP expression, thereby deleting the CmURA3 selection marker between HL and HR in the transformants. The culture was diluted and spread onto YPD solid medium containing 2 g / L 5-FOA, and incubated at 28°C for 2-3 days. Single colonies were picked and PCR was performed to confirm the recovery of the CmURA3 selection tag before a second transformation. The second transformation used AT ura3 / ura3 pox2 / POX2, which was POX2 knocked out, as the starting strain. Following the same method as knocking out the first POX2, the second POX2 was knocked out and the CmURA3 tag was recovered to obtain AT ura3 / ura3 pox2 / pox2 (POX2 double knockout). The strain was preserved and used for subsequent experiments.

[0098] (3) Construction of Candida tropicalis AT ura3 / ura3 pox2 / pox2 pox4 / pox4

[0099] Starting with AT ura3 / ura3 pox2 / pox2 strains, the recombinant fragment HL(POX4)-FRT-P, used to knock out the POX4 gene, was... MAL2 -FLP-T TRP1 Following the procedure described above for knocking out two POX2 genes, the two POX4 genes were knocked out and the CmURA3 tag was recovered to obtain AT ura3 / ura3 pox2 / pox2 pox4 / pox4. The strain was preserved and used for subsequent experiments.

[0100] (4) Construction of Candida tropicalis AT ura3 / ura3 pox2 / pox2 pox4 / pox4 pox5 / pox5

[0101] Starting with AT ura3 / ura3 pox2 / pox2 pox4 / pox4 as the starting strain, the recombinant fragment HL(POX5)-FRT-P used to knock out the POX5 gene was... MAL2 -FLP-T TRP1 Following the procedure described above for knocking out two POX2 genes and POX4, two POX5 genes were knocked out to obtain AT ura3 / ura3 pox2 / pox2 pox4 / pox4 pox5 / pox5::CmURA3, which was named AT522. The strain was preserved and used for subsequent experiments.

[0102] The recombinant strain AT522 was deposited at the China Center for Type Culture Collection (CCTCC) on December 25, 2025, with accession number CCTCC NO: M 20253005. The deposit address is No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province (Wuhan University). The culture classification name is Candida tropicalis AT522.

[0103] The gene involved in the above embodiments of the present invention: P MAL2 -FLP-T TRP1 The nucleotide sequences of the fusion fragments, CmURA3 expression cassettes, HL(CtURA3)-CtURA3-HR(CtURA3) fusion fragments, CdTEFp-SAT1-MgPGK1t expression cassettes, HL(POX2)-POX2-HR(POX2) fusion fragments, HL(POX4)-POX4-HR(POX4) fusion fragments, and HL(POX5)-POX5-HR(POX5) fusion fragments are shown in SEQ ID NO. 1-7, respectively; the nucleotide sequence of the 18S rDNA of Candida tropicalis AT is shown in SEQ ID NO. 8; and the primer sequences used are shown in Table 1.

[0104] Table 1 Primer sequences of embodiments of the present invention

[0105]

[0106] Example 2: Study on the terminal alkyl oxidation ability of recombinant Candida tropicalis AT522

[0107] Seed culture: Wild-type Candida tropicalis strain AT or the recombinant Candida tropicalis strain AT522 constructed in Example 1 was streaked onto YPD solid medium for activation and incubated at 28°C for 2 days. A single colony was then picked and inoculated into a test tube containing 2 mL of YPD liquid medium. After overnight incubation, 1% of the inoculum was inoculated into a 100 mL shake flask containing 20 mL of YPD liquid medium. After 1.5 days of incubation, the colonies were collected by centrifugation.

[0108] Yeast transformation experiment: The cell pellet was resuspended in 20 mL of fermentation medium, and substrate and 0.5% (v / v) Triton X-100 co-solvent were added. The reaction was carried out at 30℃ and 250 rpm for 4 days, and the pH was adjusted to 8.0 with NaOH solution during the reaction.

[0109] Fermentation experiments were conducted using n-octane, n-tetrazane, and n-heptadecane, which have significantly different carbon chain lengths, at a concentration of 2.5% (v / v, mL / mL). After the reaction, samples were taken, prepared, and analyzed by gas chromatography (GC). The sample preparation procedure for GC analysis of alkane fermentation products was as follows: A clean 1.5 mL EP tube was used, and 500 μL of fermentation sample and 500 μL of ethyl acetate were added. Then, 50 μL of 4M HCl was added for acidification. The mixture was thoroughly vortexed and centrifuged at 12000 rpm for 2 min. 200 μL of the supernatant was collected and added to another clean EP tube. After complete evaporation, 60 μL of pyridine and 30 μL of derivatization reagent (N-methyl-N-(trimethylsilyl)trifluoroacetamide) were added. The mixture was incubated at 65°C for 1 h for derivatization. After derivatization, 90 μL of ethyl acetate containing the internal standard (4 mM undecane) was added. After mixing, the sample was injected for GC analysis.

[0110] GC analysis method: Samples were analyzed using a GC-SH-Rtx-5 column. The temperature program for analyzing octanoic acid and tridecanoic acid was as follows: hold at 80 °C for 5 min, increase from 80 °C to 230 °C at a rate of 30 °C / min, increase from 230 °C to 280 °C at a rate of 10 °C / min and hold for 1 min. The analysis time for a single sample was 16 min. The temperature program for analyzing heptadecanedioic acid was as follows: hold at 80 °C for 5 min, increase from 80 °C to 300 °C at a rate of 20 °C / min and hold for 2 min. The analysis time for a single sample was 18 min.

[0111] The fermentation results of n-octane, n-tridecane and n-heptadecane substrates are as follows: Figure 1-3 As shown, the top layer curve represents the detection curve after adding the corresponding standard to the initial fermentation broth sample; the middle curve represents the detection curve after fermentation by the recombinant strain AT522; and the bottom layer curve represents the detection curve after fermentation by the wild-type strain AT. The results indicate that for substrates of different chain lengths, the strain AT522 constructed in this invention can yield the corresponding dicarboxylic acid products. However, due to its own β-oxidation, the wild-type strain *Candida tropicalis* AT degrades the dicarboxylic acid products, resulting in virtually no detectable accumulation of dicarboxylic acid.

[0112] The intermediate compound of SNAC, 2-hydroxy-N-octylbenzamide, was used as the substrate at a concentration of 20 mM. After the reaction, samples were taken and analyzed by thin-layer chromatography (TLC). The TLC procedure for SNAC detection was as follows: 500 μL of sample was taken, and an equal volume of ethyl acetate and 50 μL of 4 M HCl were added. The mixture was thoroughly shaken and centrifuged at 12000 rpm for 2 min. The supernatant was transferred to another clean 1.5 mL EP tube, and the sample was spotted onto a silica gel plate using a capillary tube. The developing solvent was PE / EA = 2:1 (v:v), and 5% formic acid was added.

[0113] TLC results are as follows Figure 4 As shown in the figure. The results indicate that strain AT522 of this invention can completely consume 20 mM 2-hydroxy-N-octylbenzamide substrate and convert it entirely into the free acid of SNAC, which further forms a salt in an alkaline environment to generate sodium SNAC. In contrast, the original strain AT not only had a small amount of 2-hydroxy-N-octylbenzamide substrate remaining, but also, due to the β-oxidation ability of the original strain, produced very little SNAC, with the vast majority degrading into byproducts. These results show that the recombinant strain of this invention is suitable for the terminal alkyl oxidation of 2-hydroxy-N-octylbenzamide and has good application prospects in the synthesis of SNAC.

[0114] Example 3: Constructing a reaction system for the biosynthesis of SNAC from recombinant Candida tropicalis AT522

[0115] This embodiment utilizes the terminal alkyl oxidation capability of recombinant Candida tropicalis. First, 2-hydroxy-N-octylbenzamide is chemically synthesized via amidation using methyl salicylate and n-octylamine as substrates. Then, 8-(2-hydroxybenzamido)octanoic acid is synthesized through a multi-enzyme cascade in Candida tropicalis (endogenous functional enzymes including cytochrome P450 oxidase (CYP), cytochrome P450 oxidoreductase (CPR), fatty alcohol oxidase (FAO), alcohol dehydrogenase (ADH), and aldehyde dehydrogenase (FALDH)). Finally, sodium 8-(2-hydroxybenzamido)octanoate (SNAC) is formed by a salting reaction with sodium hydroxide. The synthetic route is shown in the figure. Figure 5 As shown.

[0116] (1) Synthesis of 2-hydroxy-N-octylbenzamide

[0117] 1.29 mL of methyl salicylate (10 mmol, 1.0 eq.) and 1.65 mL of n-octylamine (10 mmol, 1.0 eq.) were added to a 50 mL single-necked reaction flask. The reaction mixture was stirred at 140°C for 16 hours. TLC analysis showed complete consumption of methyl salicylate, with a developing solvent ratio of PE / EA = 15 / 1. After the reaction, the reaction mixture was cooled to room temperature and diluted with 50 mL of dichloromethane. The solution was washed with 5% hydrochloric acid aqueous solution (2 × 10 mL) and then with distilled water (10 mL). The organic phase was dried over anhydrous sodium sulfate (Na₂SO₄), filtered, concentrated by rotary evaporation, and purified by silica gel column chromatography (PE / EA = 30 / 1 to 20 / 1) to give 1.99 g of 2-hydroxy-N-octylbenzamide as a white solid.

[0118] The obtained 2-hydroxy-N-octylbenzamide white solid was analyzed by 1H and 1C NMR spectroscopy. Spectra were recorded on a Bruker AV-400 spectrometer using deuterated chloroform (CDCl3) as solvent. For 1H NMR spectra, chemical shifts were reported in ppm, with the internal standard chloroform signal at 7.26 ppm as the standard. For 13C NMR spectra, chemical shifts were reported in ppm, with the internal standard chloroform signal at 77.16 ppm as the standard. Data reporting: s = singlet, d = doublet, t = triplet, q = quartet, dd = doublet, td = three sets of doublets, m = multipeak or unresolved, coupling constant in Hz, integral.

[0119] The 1H NMR spectrum of 2-hydroxy-N-octylbenzamide is as follows: 1¹H NMR (400 MHz, CDCl₃) δ 12.40 (s, 1H), 7.41 – 7.36 (m, 1H), 7.33 (dd, J = 7.9, 1.6 Hz, 1H), 6.98 (dd, J = 8.4, 1.2 Hz, 1H), 6.86 – 6.81 (m, 1H), 6.31 (s, 1H), 3.44 (td, J = 7.2, 5.7 Hz, 2H), 1.67 – 1.57 (m, 2H), 1.43 – 1.20 (m, 10H), 0.88 (t, J = 7.1 Hz, 3H). The carbon NMR spectrum is as follows: 13 C NMR (101 MHz, CDCl3) δ 170.0, 161.7, 134.2, 125.3,118.8, 118.7, 114.5, 39.9, 31.9, 29.6, 29.4, 29.3, 27.1, 22.8, 14.2.

[0120] (2) 2-Hydroxy-N-octylbenzamide is converted to SNAC

[0121] Seed culture: The recombinant Candida tropicalis strain AT522 constructed in Experiment 1 was streaked onto YPD solid medium for activation and incubated at 28°C for 2 days. A single colony was then picked and inoculated into a test tube containing 2 mL of YPD liquid medium. After overnight incubation, 1% of the colony was inoculated into a 100 mL shake flask containing 20 mL of YPD liquid medium. After 1.5 days of incubation, the colonies were collected by centrifugation.

[0122] Biotransformation: The bacterial precipitate was resuspended in 20 mL of fermentation medium, and 20 mM 2-hydroxy-N-octylbenzamide substrate and co-solvent were added. The reaction was carried out at 30 °C and 250 rpm for 75 h. During the reaction, the pH was adjusted to 8.0 with NaOH or NaHCO3 solution. After the reaction, samples were taken and analyzed by TLC thin-layer chromatography.

[0123] To investigate the effect of cosolvents on the biosynthetic process, different cosolvents (isopropyl myristate, Triton X-100, NP40, or Tween 80) were added to the reaction system, resulting in a total of 8 experiments. The results are as follows: Figure 6 As shown, the addition of cosolvents such as 0.5% (v / v) Triton X-100, 0.5% (w / v) NP-40, or 0.5% (v / v) Tween 80 is beneficial to the synthesis of SNAC, while the addition of 10% (v / v) isopropyl myristate is detrimental to the synthesis of SNAC.

[0124] In addition, experimental group 8 ( Figure 6 The sample in lane 8 was analyzed by high-performance liquid chromatography (HPLC). The HPLC procedure was as follows: 500 μL of sample was taken, and an equal volume of ethyl acetate and 50 μL of 4M HCl were added. After thorough mixing, the mixture was centrifuged at 12000 rpm for 2 min. 200 μL of the supernatant was evaporated completely. After complete evaporation, 350 μL of HPLC-grade methanol was added, and the mixture was thoroughly mixed and dissolved before being injected through a membrane. HPLC analytical parameters: HPLC-C18 column was used; mobile phase: 85% methanol, 15% ultrapure water containing 0.1% formic acid; flow rate: 1 mL / min; isocratic elution; column temperature: 45°C.

[0125] HPLC analysis of 8 samples and SNAC standard in experimental group yielded the following results: Figure 7 As shown in the figure. The results indicate that 20 mM substrate 2-hydroxy-N-octylbenzamide can be completely converted to SNAC, and as can be seen from the figure, apart from the SNAC peak, there are basically no impurity peaks, indicating high product purity. Figure 6 The results only show the SNAC product band and substrate band, indicating that the SNAC synthesis by fermentation in a Candida tropicalis cell factory has fewer side reactions and higher product selectivity and specificity.

[0126] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of recombinant Candida tropicalis in the biosynthesis of sodium 8-(2-hydroxybenzamido)octanoate, characterized in that, The preservation number of the recombinant Candida tropicalis is CCTCC NO: M 20253005.

2. A method for preparing sodium 8-(2-hydroxybenzamido)octanoate, characterized in that, Includes the following steps: Recombinant Candida tropicalis was inoculated into a fermentation medium, and 2-hydroxy-N-octylbenzamide, a solubilizer and a salt-forming agent were added. The pH of the fermentation medium was controlled to be alkaline, and the recombinant Candida tropicalis was cultured to obtain sodium 8-(2-hydroxybenzamide)octanoate. The recombinant Candida tropicalis has the preservation number CCTCC NO: M 20253005, and the cosolvent is selected from Triton X-100, Tween 80 or nonylphenol polyoxyethylene ether-40, with an addition amount of 0.5%.

3. The method for preparing sodium 8-(2-hydroxybenzamido)octanoate according to claim 2, characterized in that, The salt-forming agent is selected from one of NaOH, Na2CO3 or NaHCO3; The fermentation medium comprises 100 g / L glycerol, 13 g / L amino-free yeast nitrogen source, 6 g / L yeast extract, 3.64 g / L KH2PO4 and 3 g / L K2HPO4, with a pH value greater than 7 and less than or equal to 8.

4. The method for preparing sodium 8-(2-hydroxybenzamido)octanoate according to claim 2, characterized in that, The inoculum size of the recombinant Candida tropicalis is 0.5-5%; The recombinant tropical Candida was cultured at 25℃-35℃ and 150-250rpm for 60-96h.

5. The method for preparing sodium 8-(2-hydroxybenzamido)octanoate according to claim 2, characterized in that, The concentration of the 2-hydroxy-N-octylbenzamide is 10-40 mM.

6. The method for preparing sodium 8-(2-hydroxybenzamido)octanoate according to claim 2, characterized in that, The preparation method of the 2-hydroxy-N-octylbenzamide includes the following steps: Methyl salicylate and n-octylamine were mixed evenly and subjected to an amidation reaction. The reaction mixture was collected and purified to obtain the 2-hydroxy-N-octylbenzamide.

7. The method for preparing sodium 8-(2-hydroxybenzamido)octanoate according to claim 6, characterized in that, The conditions for the amidation reaction included stirring at 140°C for 16 hours.

Images