Wheat thousand seed weight related gene TaMADS22-A haplotype molecular marker and application thereof

Abstract

The invention relates to the technical field of gene engineering, in particular to a haplotype molecular marker of a wheat thousand seed weight related gene TaMADS22-A and application of the haplotype molecular marker. The SNP site is located at the 553039901 bp position of a 6A chromosome, and the polymorphism is C / T. According to the invention, a haplotype related to the thousand seed weight of wheat grains is obtained through phenotypic difference analysis of an analysis grain type of a TaMADS22-A haplotype, and a corresponding KASP primer combination is designed for an SNP site in the haplotype. The KASP primer combination provided by the invention can accurately and quickly identify the thousand seed weight of wheat grains, and has important significance in breeding of high-yield wheat.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the molecular marker of the wheat thousand-grain weight-related gene TaMADS22-A and its application. Background Technology

[0002] Wheat is the staple food for approximately 20% of the global population, and its production directly impacts the dietary security of 3.5 billion people. The three key factors constituting wheat (Triticum aestivum L.) yield are the number of spikes per unit area, the number of grains per spike, and the thousand-grain weight, among which the thousand-grain weight exhibits a relatively stable genetic effect. While maintaining stable effective spike numbers and grain numbers per unit area, increasing the thousand-grain weight of wheat has a significant effect on increasing yield.

[0003] MADS-box is a family of proteins encoding transcription factors. Early research on MADS-box genes began with flower morphology mutants of snapdragons and Arabidopsis thaliana. The name originates from the Saccharomyces cerevisiae transcription factor MINICH ROMOSOMEMAINTENANCE 1 (MCM1), the Arabidopsis thaliana flower homeotype gene AGAMOUS (AG), the snapdragon flower homeotype gene DEFICIENS (DEF), and the human serum response factor SERUM RESPONSE FACTOR (SRF). The MADS-box gene family can be divided into type I and type II. Plant-specific MIKC genes and animal and fungal MEF2 genes belong to type II. Plant MIKC genes are named for the conserved MIKC structure of their encoded proteins, which includes four protein domains: MADS, Intervening, Keratin-like, and C-terminal. MADS-box family proteins play important roles in various aspects of plant growth and development, including organ development, flowering period control, and hormone signal transduction.

[0004] SNPs (Single Nucleotide Polymorphisms) refer to DNA sequence polymorphisms caused by variations in a single nucleotide. They have advantages such as wide genomic distribution, good genetic stability, and suitability for high-throughput analysis and detection. SNP microarrays, including 9K, 55K, 90K, and 660K, have been developed for wheat and used in genetic studies such as genetic diversity and high-density linkage map construction. However, microarray-based genotyping platforms can only be used for whole-genome scanning, and their cost is high for large-scale whole-genome scanning. KASP (Kompetitive Allele Specific PCR), a molecular marker developed based on SNP sites, has high stability, accuracy, and low cost, and has been widely used in high-throughput SNP genotyping, especially when the sample size is large and the number of SNP sites is small.

[0005] Using KASP as a molecular marker to screen for varieties with high thousand-grain weight will provide a scientific basis for high-yield breeding research.

[0006] Therefore, this application is hereby submitted. Summary of the Invention

[0007] To address the problems existing in the prior art, this invention provides a molecular marker for the wheat thousand-grain weight-related gene TaMADS22-A and its application.

[0008] In a first aspect, the present invention provides an SNP site located at base pair 553039901 on chromosome 6A, with a polymorphism of C or T.

[0009] Secondly, the present invention provides a KASP primer combination for amplifying SNP sites, including: 553039901-F1, 553039901-F2 and 553039901-R;

[0010] The nucleotide sequence of 553039901-F1 is shown in SEQ ID NO: 2;

[0011] The nucleotide sequence of 553039901-F2 is shown in SEQ ID NO: 3;

[0012] The nucleotide sequence of 553039901-R is shown in SEQ ID NO: 4.

[0013] Furthermore, in the KASP primer combination, 553039901-F1 and 553039901-F2 are linked to the fluorescently labeled sequences FAM and HEX, respectively. The nucleotide sequence of FAM is shown in SEQ ID NO: 5, and the nucleotide sequence of HEX is shown in SEQ ID NO: 6.

[0014] Thirdly, the present invention provides a kit comprising the SNP sites described above, or the KASP primer set described above.

[0015] The present invention further provides the application of the SNP site, or the KASP primer combination, or the kit in identifying the thousand-grain weight of wheat grains.

[0016] The present invention further provides the application of the SNP site, or the KASP primer combination, or the kit in screening or cultivating high thousand-grain weight wheat grains.

[0017] Fourthly, the present invention provides a method for identifying the thousand-grain weight of plants, comprising:

[0018] Using the DNA of the plant sample to be tested as a template, PCR amplification was performed using the aforementioned KASP primer combination or the aforementioned kit; the thousand-grain weight of the wheat grains to be tested was determined based on the amplification results.

[0019] Furthermore, based on a total system volume of 10 μL, the PCR amplification system comprises:

[0020] KASP Mix (2X), 4–6 μL; Primer Mix, 0.12–0.16 μL; DNA, 25–35 ng; balance: water.

[0021] Furthermore, the PCR amplification reaction procedure includes:

[0022] 95℃ for 8–12 min; 95℃ for 15–25 s, 61℃ for 60 s, 8–12 cycles, with the annealing temperature decreasing by 0.5–0.7℃ per cycle; 95℃ for 15–25 s, 55℃ for 35–45 s, 32–36 cycles; 25℃ for 10–20 min.

[0023] Further, based on a total system volume of 100 μL, the Primer Mix comprises:

[0024] 553039901-F1, 100 μM, 10–14 μL; 553039901-F2, 100 μM, 10–14 μL; and 553039901-R, 100 μM, 10–14 μL, with the balance being water.

[0025] Furthermore, determining the thousand-grain weight of the wheat grains to be tested based on the amplification results includes:

[0026] The amplification results showed that wheat grains with the TT genotype identified by the SNP site had a higher thousand-grain weight compared to wheat grains with the CC genotype.

[0027] The present invention has the following beneficial effects:

[0028] Phenotypic difference analysis of the TaMADS22-A haplotype yielded a haplotype associated with the thousand-grain weight of wheat grains. Analysis of the SNP locus of this haplotype revealed a close correlation between this SNP locus and the thousand-grain weight phenotype. Detection of the polymorphism at this SNP locus allows for accurate and rapid identification of whether wheat grains possess a high thousand-grain weight. Markers targeting this locus offer advantages such as good genetic stability, high resolution, and suitability for high-throughput detection applications.

[0029] The SNP sites and corresponding KASP primer combinations provided by this invention can not only be used for the identification of wheat thousand-grain weight, but also have important application value in improving the selection efficiency of plant varieties, shortening the breeding cycle, and accelerating the development of high-yield wheat. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0031] Figure 1 This is the genotyping result of wheat at the 553039901 locus on chromosome 6A provided by the present invention; where Allele 1 represents C of 553039901, Allele 2 represents T of 553039901, and X represents no template control, that is, ultrapure water is used to replace sample DNA.

[0032] Figure 2 The grain lengths of different genotypes at the 553039901 locus on chromosome 6A provided by this invention are shown.

[0033] Figure 3 The particle widths of different genotypes at the 553039901 locus on chromosome 6A provided by this invention are shown.

[0034] Figure 4 The thousand-grain weights are for different genotypes at the 553039901 locus on chromosome 6A provided by this invention.

[0035] Figure 5 The grain thickness is the different genotypes at the 553039901 locus on chromosome 6A provided by this invention. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0037] Wheat materials: The wheat varieties (lines) involved in the following examples were all provided by our research group. The wheat was sown in Xinxiang, Henan (longitude: 113.78462, latitude: 35.133892), harvested after physiological maturity, naturally dried and used for subsequent analysis.

[0038] It should be noted that, as a professional agricultural research institution, the applicant has long preserved relevant germplasm materials, and the relevant wheat varieties are all publicly available in the market or in existing germplasm banks.

[0039] Example 1: Development of SNP molecular markers and design of KASP primers

[0040] 1. Obtain the thousand-grain weight, grain length, grain width, and grain thickness of different wheat grains.

[0041] To obtain the thousand-grain weight, grain length, grain width, and grain thickness of wheat grains, based on existing technology, the grain length, grain width, and thousand-grain weight of wheat grains were first determined using the Wanshen SG-C automatic seed copying instrument. Simultaneously, the grain thickness of wheat grains was measured using vernier calipers to preliminarily determine the phenotypic differences of wheat grains. Specific measurement results are shown in Table 1 below.

[0042] 2. Development of SNP molecular markers

[0043] The MADS22 gene belongs to the MADS-box protein family and has a typical MIKC structure. It may be involved in wheat organ development, flowering time control, and hormone signal transduction. During haplotype analysis of wheat MADS22, the inventors of this invention discovered significant differences in grain traits among different haplotypes. Therefore, we will develop markers targeting SNPs to provide excellent genetic resources for high-yield breeding.

[0044] Based on the phenotypic data of 245 grains obtained in step 1, variation detection was performed on the 245 microcore germplasm materials. The data was compared using a wheat reference genome, and the obtained variant sites were filtered and screened. Figure 1As shown, a SNP marker was found in the TaMADS22 gene on chromosome 6A of the wheat genome, and a significant locus affecting the thousand-grain weight of wheat (6A: 553039901bp) was identified. The SNP variation at this locus...

[0045] The thousand-grain weight, grain length, grain width, and grain thickness of wheat grains were significantly increased. Due to the long 6A chromosome nucleotide sequence, this application provides the sequence of 100 bp before and after this SNP site (i.e., the nucleotide sequence of 553039801-553040001 bp) as shown in SEQ ID NO: 1.

[0046] The sequence of SEQ ID NO: 1 is:

[0047] AGTACATACTTGGTTCCTTAGTTTCATGTTCTCCTCTGCCAGTTGTGAACTCTGTGGTACAATATGCAAGTGGTACAACATTTATTAGTTTTACAACTTACTCTACAGACAAGGGTACTTCAAAACAATAAATCGACATTCTACCGTTCATCTAATTCTCTATGTGTTTAACTTCCAACAGCTTTCAAGCAGTAAGTGCA

[0048] Using the filtered SNP markers, haplotype analysis of TaMADS22 was performed among natural populations. Two haplotypes were obtained at the SNP locus (CC>TT) on chromosome 6A 553039901, and these two haplotypes showed significant differences in wheat grain length, grain width, thousand-grain weight, and grain thickness.

[0049] Based on the above sequence differences and the KASP principle, a primer set for PCR amplification of the wheat molecular marker was further developed and designed using Higeno2xProbe Mix (catalog number: AQP-003A) from Beijing Jiacheng Biotechnology Co., Ltd. The specific design is as follows:

[0050] In one specific embodiment of the present invention, the nucleotide sequence of 553039901-F1 linked with the FAM marker sequence is as follows:

[0051] 5'-GAAGGTGACCAAGTTCATGCTAAGATCCATTTATCTCAATG-3'; where the 5' end "GAAGGTGACCAAGTTCATGCT" sequence is a FAM marker sequence.

[0052] The nucleotide sequence of 553039901-F2 linked with the HEX marker sequence is: 5'-GAAGGTCGGAGTCAACGGATTAAGATCCATTTATCTCAATA-3'. Among them, the 5' end "GAAGGTCGGAGT CAACGGATT" part is the HEX marker sequence.

[0053] The nucleotide sequence of 553039901-R is 5'-CAATGAACCTACGAGC-3' (SEQ ID NO: 4).

[0054] When using primer pairs 553039901-F1 and 553039901-R, they are used to amplify the C-base sequence at the 553039901 site on chromosome 6A of wheat molecular markers;

[0055] When using primer pairs 553039901-F2 and 553039901-R, the sequence with a base of T at the 553039901 site on chromosome 6A of wheat molecular markers is amplified.

[0056] Example 2

[0057] 1. Based on the primer pair design of Example 1, the genotypes of 159 wheat materials (15 CC / 8 TT) were detected, and the association between genotype and total protein content phenotype was identified. The specific process is as follows.

[0058] First, genomic DNA was extracted from each wheat variety.

[0059] Then, using the primers designed in Example 1 and the extracted DNA as a template, different wheat samples were analyzed by PCR (using a Quant Studio 1 real-time PCR instrument).

[0060] For specific PCR amplification, the 10μL amplification system was designed as follows:

[0061] KASP Mix (2X), 5 μL;

[0062] Primer Mix, 0.14 μL;

[0063] DNA, 30 ng;

[0064] Add ddH2O to a final volume of 10 μL;

[0065] The Primer Mix, per 100 μL:

[0066] 553039901-F1, 100μM, 12μL;

[0067] 553039901-F2, 100μM, 12μL;

[0068] 553039901-R, 100μM, 30μL;

[0069] Double-distilled water (ddH2O), 46 μL;

[0070] The PCR reaction procedure is as follows (which can be adjusted according to the amplification results):

[0071] 95℃ for 10 min; 95℃ for 20 s, 61℃ for 60 s (10 cycles, each cycle decreasing by 0.6℃); 95℃ for 20 s, 55℃ for 40 s, 34 cycles; 25℃ for 15 min.

[0072] The specific genotypes and statistical results of total wheat protein content are shown in Table 1 below. Figures 2-5 As shown.

[0073] Table 1. Correspondence between different wheat varietal genotypes and their grain length, width, thousand-grain weight, and thickness.

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087] Based on the above statistical results, it can be seen that the average grain length, grain width, thousand-grain weight, and grain thickness of CC genotype wheat are 10.71 mm, 5.20 mm, 41.08 g, and 2.99 mm, respectively; while the average grain length, grain width, thousand-grain weight, and grain thickness of TT genotype wheat are 11.03 mm, 5.35 mm, 43.70 g, and 3.08 mm, respectively. The grain length, grain width, thousand-grain weight, and grain thickness of TT genotype wheat are significantly higher than those of CC genotype wheat, showing a significant difference at the p<0.05 level. In other words, the grain length, grain width, thousand-grain weight, and grain thickness of TT genotype wheat grains are significantly higher than those of CC genotype wheat grains.

[0088] By designing primers and detecting specific sites (based on the results above), this invention can accurately determine the thousand-grain weight characteristics of wheat, thus laying the foundation for the application of molecular breeding technology. Simultaneously, based on this site, this invention can provide technical and theoretical support for breeding new wheat varieties with different thousand-grain weight characteristics, which is of significant technical importance for improving the processing performance of wheat.

[0089] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The TaMADS22-A haplotype SNP locus, a gene associated with 1,000 grain weight in wheat, is characterized by: The SNP site is located at 553039901 bp on chromosome 6A, and its polymorphism is C or T.

2. A KASP primer combination for amplifying SNP sites, characterized in that, Including 553039901-F1, 553039901-F2 and 553039901-R; The nucleotide sequence of 553039901-F1 is shown in SEQ ID NO: 2; The nucleotide sequence of 553039901-F2 is shown in SEQ ID NO: 3; The nucleotide sequence of 553039901-R is shown in SEQ ID NO:

4.

3. The KASP primer combination according to claim 2, characterized in that, In the KASP primer combination, 553039901-F1 and 553039901-F2 are linked to the fluorescently labeled sequences FAM and HEX, respectively. The nucleotide sequence of FAM is shown in SEQ ID NO: 5, and the nucleotide sequence of HEX is shown in SEQ ID NO:

6.

4. A reagent kit, characterized in that, The kit includes the SNP site as described in claim 1, or the KASP primer set as described in claim 2.

5. The application of the SNP molecular marker of claim 1, the KASP primer combination of claim 2, or the kit of claim 3 in the identification, screening, or cultivation of wheat grain thousand-grain weight.

6. A method for determining the thousand-grain weight of plants, characterized in that, include: Using the DNA of the plant sample to be tested as a template, PCR amplification was performed using the KASP primer combination described in claim 2 or the kit described in claim 4; The thousand-grain weight of the plant to be tested is determined based on the amplification results.

7. The method according to claim 6, characterized in that, The plant to be tested is one or more of wheat, corn, or rice.

8. The method according to claim 6, characterized in that, Based on a total volume of 10 μL, the PCR amplification system comprises: KASP Mix (2X), 4–6 μL; Primer Mix, 0.12–0.16 μL; DNA, 25–35 ng; balance: water.

9. The method according to claim 6, characterized in that, The PCR amplification reaction procedure includes: 95℃ for 8–12 min; 95℃ for 15–25 s, 61℃ for 60 s, 8–12 cycles, with the annealing temperature decreasing by 0.5–0.7℃ per cycle; 95℃ for 15–25 s, 55℃ for 35–45 s, 32–36 cycles; 25℃ for 10–20 min.

10. The method according to any one of claims 6-9, characterized in that, The determination of the thousand-grain weight, grain length, grain width, and grain thickness of the wheat grains to be tested based on the amplification results includes: The amplification results showed that plants with the TT genotype identified by the SNP site had higher thousand-grain weight, grain length, grain width, and grain thickness compared to plants with the CC genotype.

Images