MsCCoAOMTc3 gene, recombinant vector and engineering bacterium thereof, and application of MsCCoAOMTc3 gene in improving drought tolerance of medicago sativa
By cloning and overexpressing the MsCCoAOMTc3 gene of alfalfa, the growth limitation of alfalfa under drought conditions was solved, its drought resistance and antioxidant capacity were significantly improved, and the plant's growth performance was enhanced.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NORTHWEST A & F UNIV
- Filing Date
- 2026-01-28
- Publication Date
- 2026-05-08
AI Technical Summary
Existing technologies have failed to effectively utilize the drought-resistant function of the CCoAOMT gene in alfalfa, resulting in limited growth and yield under drought conditions, and a lack of new alfalfa varieties with strong drought resistance.
The MsCCoAOMTc3 gene of alfalfa was cloned and expressed. The gene was overexpressed in alfalfa using recombinant vectors and engineered bacteria to enhance its drought resistance. The specific methods included PCR amplification, restriction endonuclease treatment, vector ligation, and Agrobacterium-mediated gene transformation.
It significantly improves the drought resistance of alfalfa, manifested by enhanced survival rate, reduced relative electrical conductivity and malondialdehyde content in leaves, enhanced antioxidant enzyme activity and lignin accumulation, and improved plant growth performance under drought conditions.
Smart Images

Figure CN121991985A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of genetic engineering and plant biotechnology, specifically involving the MsCCoAOMTc3 gene, its recombinant vector, engineered bacteria, and its use in improving the drought resistance of alfalfa. Background Technology
[0002] Alfalfa (Medicago sativa L.), as one of the world's most important high-quality legume forages, is known as the "King of Forages" due to its high crude protein content, stable yield, and strong adaptability. It not only provides crucial feed for livestock but also has ecological functions in soil and water conservation and improvement, making it an important component of sustainable agricultural systems. With the increasing demand for high-quality livestock products in my country, the strategic importance of the alfalfa industry is becoming increasingly prominent.
[0003] However, alfalfa production in my country faces severe challenges. On the one hand, major planting areas (Northwest, North China, and Northeast China) are plagued by drought stress year-round, and global climate change has led to a continuous increase in the frequency and intensity of droughts, directly restricting alfalfa growth and yield. On the other hand, to ensure food security, alfalfa production mostly utilizes low- to medium-yield fields or marginal lands, which inherently have poor moisture conditions. Furthermore, my country lacks domestically bred high-yield and stress-resistant alfalfa varieties. Therefore, cultivating new drought-resistant alfalfa varieties is not only crucial for overcoming industry bottlenecks but also an urgent need to respond to the national seed source development strategy and ensure self-sufficiency in the forage industry.
[0004] From a technical perspective, improving plant stress resistance through genetic engineering is a core direction of modern breeding. Lignin, as a key component of the cell wall, not only provides mechanical support but also plays a crucial role in plant resistance to abiotic stresses such as drought. Caffeoyl-CoA AO-methyltransferase (CCoAOMT) is a key enzyme in lignin monomer synthesis, and its function is closely related to plant drought resistance. Previous studies have shown that in peony (Paeonia ostii), drought-induced expression of the PoCCoAOMT gene enhances drought resistance by promoting lignin accumulation and reactive oxygen species (ROS) scavenging; overexpression of the elephant grass (Pennisetum purpureum) PpCCoAOMT gene in tobacco also improves drought resistance by increasing lignin and flavonoid content and enhancing antioxidant capacity. Conversely, the Arabidopsis ccoaomt1 mutant exhibits hypersensitivity to drought. These studies consistently demonstrate that the CCoAOMT gene has a conserved and important positive regulatory function in plant drought resistance.
[0005] Although the drought-resistant function of the CCoAOMT gene has been recognized in various plants, whether its specific homologous gene in alfalfa, an important forage crop, has a similar function has not yet been reported. Discovering and verifying the alfalfa-specific CCoAOMT gene will not only provide new clues for elucidating the molecular mechanism of alfalfa drought resistance, but is also a key gene resource urgently needed for breeding new drought-resistant alfalfa varieties with independent intellectual property rights. Summary of the Invention
[0006] The purpose of this invention is to address the problem that the specific sequences of CCoAOMT gene family members in alfalfa and their functions in drought resistance are not disclosed in the existing technology, and to provide the MsCCoAOMTc3 gene, its recombinant vector, engineered bacteria, and its use in improving the drought resistance of alfalfa.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A first aspect of the present invention provides an isolated nucleic acid molecule, said nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 1, and named MsCCoAOMTc3 gene.
[0008] The MsCCoAOMTc3 gene and its application provided by this invention can effectively improve the drought resistance of alfalfa. Specifically, transgenic alfalfa plants obtained from this gene ('Xinjiang Big Leaf') exhibit significantly higher survival rates than wild-type plants under drought stress and after rehydration; their leaf relative conductivity and malondialdehyde (MDA) content are significantly reduced; the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) are significantly enhanced, while the accumulation of reactive oxygen species (O2·⁻ and H2O2) is reduced; in addition, the lignin content of the roots, stems, leaves, and the whole plant is significantly increased. The experimental results fully demonstrate the positive effect of the MsCCoAOMTc3 gene in improving the drought resistance of alfalfa.
[0009] A second aspect of the present invention provides a recombinant vector comprising a nucleic acid molecule as described above and a plant expression regulatory element that drives its expression.
[0010] Furthermore, the recombinant vector is obtained by linking the aforementioned nucleic acid molecule with the overexpression vector pHELLSgate2.
[0011] A third aspect of the present invention provides a plant expression cassette comprising the above-described nucleic acid molecule, a CaMV 35S promoter attached to its 5' end, and a NOS terminator attached to its 3' end.
[0012] A fourth aspect of the present invention provides an engineered bacterium comprising the above-described recombinant vector or the above-described plant expression cassette; the engineered bacterium is Agrobacterium GV3101.
[0013] A fifth aspect of the present invention provides a method for preparing the above-mentioned recombinant vector, comprising the following steps: Using cDNA from alfalfa 'Xinjiang Big Leaf' as a template, PCR amplification was performed using the forward primer as shown in SEQ ID NO.2 and the reverse primer as shown in SEQ ID NO.3 to obtain the nucleic acid molecule described in claim 1; The overexpression vector pHELLSgate2 was double-digested with restriction endonucleases XbaI and XhoI to obtain a linearized vector. The PCR amplification product obtained in step (1) is ligated with the linearized vector obtained in step (2) to obtain the recombinant product; The recombinant product was transformed into competent E. coli cells, and the recombinant vector was obtained by screening.
[0014] Further, the PCR amplification reaction system described in step (1) is as follows: 1 μL of primer shown in SEQ ID NO.2, 1 μL of primer shown in SEQ ID NO.3, 7.5 μL of ddH2O, 2 μL of cDNA template, 12.5 μL of 2× Phanta Max Buffer, 0.5 μL of dNTP mixture, and 0.5 μL of Phanta Max Super-Fidelity DNA polymerase; the reaction program is as follows: 95℃ pre-denaturation for 5 minutes; 95℃ denaturation for 30 seconds, 57℃ annealing for 30 seconds, 72℃ extension for 80 seconds, for a total of 35 cycles; 72℃ final extension for 5 minutes.
[0015] A sixth aspect of the present invention provides a method for preparing alfalfa transformants with improved drought resistance, comprising the following steps: Provide a recombinant vector containing the above-mentioned nucleic acid molecules; (b) Infect mechanically scratched leaf explants of alfalfa “Xinjiang Big Leaf” with Agrobacterium GV3101 infection solution containing the recombinant vector; (c) Screen and culture the transformed cells to obtain transgenic plants.
[0016] A seventh aspect of the present invention provides a transgenic alfalfa plant, which is obtained by the method of claim 8, wherein the genome integrates the nucleic acid molecules as described above.
[0017] The eighth aspect of the present invention provides the use of the above-described nucleic acid molecule or the above-described recombinant vector or the above-described plant expression cassette in improving the drought resistance of alfalfa or in breeding drought-resistant varieties of alfalfa.
[0018] Furthermore, by reducing relative conductivity, inhibiting MDA accumulation, enhancing the activity of antioxidant enzymes such as CAT, SOD, and POD, and reducing the accumulation of reactive oxygen species (O2•⁻, H2O2), the damage of drought stress to alfalfa can be reduced.
[0019] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are: This invention provides the MsCCoAOMTc3 gene, its recombinant vector, engineered bacteria, and its use in improving the drought tolerance of alfalfa. For the first time, a nucleic acid molecule was cloned from alfalfa, exhibiting a significantly higher survival rate than wild-type plants after drought stress and rehydration; its leaf relative conductivity and malondialdehyde (MDA) content were significantly reduced; the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) were significantly enhanced, while the accumulation of reactive oxygen species (O2·⁻ and H2O2) decreased; furthermore, the lignin content of the roots, stems, leaves, and the whole plant was significantly increased. The experimental results fully demonstrate the positive effect of the MsCCoAOMTc3 gene in improving the drought tolerance of alfalfa. Attached Figure Description
[0020] Figure 1 This study analyzed the expression pattern and tissue-specific expression of MsCCoAOMTc3 under drought stress. Figure 1 In the analysis, A and B represent the expression patterns of MsCCoAOMTc3 in stems and leaves under drought stress. Figure 1 In this context, C indicates tissue-specific expression analysis.
[0021] Figure 2 A diagram illustrating the construction process of the pHELLSgate2-MsCCoAOMTc3 vector; where, Figure 2 In the figure, A represents the PCR amplification result of the MsCCoAOMTc3 gene sequence; Figure 2 In the image, B represents the detection results of E. coli using the pHELLSgate2-MsCCoAOMTc3 vector. Figure 2 The "C" in the figure represents the detection results of Agrobacterium-mediated recombinant plasmid of the pHELLSgate2-MsCCoAOMTc3 vector.
[0022] Figure 3 The image shows the results of obtaining and identifying MsCCoAOMTc3 gene overexpression lines; among them, Figure 3 In the figure, A represents the detection results of the pHELLSgate2-MsCCoAOMTc3 vector; Figure 3 In the figure, B represents the result of the detection of MsCCoAOMTc3 gene expression level.
[0023] Figure 4Phenotypic images of MsCCoAOMTc3 gene overexpressing plants before and after drought stress treatment and after rehydration.
[0024] Figure 5 The results show the drought tolerance of plants overexpressing the MsCCoAOMTc3 gene before and after drought treatment. Figure 5 In this context, A represents the survival rate of wild-type and MsCCoAOMTc3-overexpressing plants after rehydration following drought treatment. Figure 5 In the figure, B represents the results of the relative electrical conductivity measurement of plants before and after drought treatment; Figure 5 The C in the figure represents the results of malondialdehyde (MDA) content determination in plants before and after drought treatment. Figure 5 In this context, D represents NBT staining of plants before and after drought treatment; Figure 5 In this context, EG represents the results of SOD, POD, and CAT activity assays in plants before and after drought treatment. Figure 5 In the figure, H represents the DAB staining results of the plants before and after drought treatment.
[0025] Figure 6 The results show the lignin content of MsCCoAOMTc3 gene-overexpressing plants before and after drought treatment. Figure 6 The AD values show the results of lignin determination in the roots, stems, leaves, and whole plants of the plants before and after drought treatment. Detailed Implementation
[0026] The present invention will now be described in detail with reference to the accompanying drawings.
[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0028] The first aspect of this embodiment provides an isolated nucleic acid molecule, the nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 1, and its name being the MsCCoAOMTc3 gene.
[0029] The MsCCoAOMTc3 gene and its application provided in this embodiment can effectively improve the drought resistance of alfalfa. Specifically, the transgenic alfalfa plants obtained from this gene ('Xinjiang Big Leaf') showed significantly higher survival rates than wild-type plants after drought stress and rewatering; their leaf relative conductivity and malondialdehyde (MDA) content were significantly reduced; the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) were significantly enhanced, while the accumulation of reactive oxygen species (O2·⁻ and H2O2) was reduced; in addition, the lignin content of the roots, stems, leaves, and the whole plant was significantly increased. The experimental results fully demonstrate the positive effect of the MsCCoAOMTc3 gene in improving the drought resistance of alfalfa.
[0030] A second aspect of this embodiment provides a recombinant vector comprising the nucleic acid molecule as described above and a plant expression regulatory element driving its expression. In some embodiments, the recombinant vector is obtained by linking the aforementioned nucleic acid molecule with the overexpression vector pHELLSgate2.
[0031] A third aspect of this embodiment provides a plant expression cassette comprising the aforementioned nucleic acid molecule, a CaMV 35S promoter attached to its 5' end, and a NOS terminator attached to its 3' end.
[0032] The fourth aspect of this embodiment provides an engineered bacterium, comprising the above-described recombinant vector or the above-described plant expression cassette; the engineered bacterium is Agrobacterium GV3101.
[0033] The fifth aspect of this embodiment provides a method for preparing the above-mentioned recombinant vector, comprising the following steps: Using cDNA from alfalfa 'Xinjiang Big Leaf' as a template, PCR amplification was performed using the forward primer as shown in SEQ ID NO.2 and the reverse primer as shown in SEQ ID NO.3 to obtain the nucleic acid molecule described in claim 1; The overexpression vector pHELLSgate2 was double-digested with restriction endonucleases XbaI and XhoI to obtain a linearized vector. The PCR amplification product obtained in step (1) is ligated with the linearized vector obtained in step (2) to obtain the recombinant product; The recombinant product was transformed into competent E. coli cells, and the recombinant vector was obtained by screening.
[0034] In some embodiments, the PCR amplification reaction system in step (1) is as follows: 1 μL of primer shown in SEQ ID NO.2, 1 μL of primer shown in SEQ ID NO.3, 7.5 μL of ddH2O, 2 μL of cDNA template, 12.5 μL of 2× Phanta Max Buffer, 0.5 μL of dNTP mixture, and 0.5 μL of Phanta Max Super-Fidelity DNA polymerase; the reaction program is as follows: 95℃ pre-denaturation for 5 minutes; 95℃ denaturation for 30 seconds, 57℃ annealing for 30 seconds, 72℃ extension for 80 seconds, for a total of 35 cycles; 72℃ final extension for 5 minutes.
[0035] The sixth aspect of this embodiment provides a method for preparing alfalfa transformants with improved drought resistance, comprising the following steps: Provide a recombinant vector containing the above-mentioned nucleic acid molecules; (b) Infect mechanically scratched leaf explants of alfalfa “Xinjiang Big Leaf” with Agrobacterium GV3101 infection solution containing the recombinant vector; (c) Screen and culture the transformed cells to obtain transgenic plants.
[0036] The seventh aspect of this embodiment provides a transgenic alfalfa plant, which is obtained by the method of claim 8, and whose genome integrates the nucleic acid molecules as described above.
[0037] The eighth aspect of this embodiment provides the use of the above-described nucleic acid molecule, recombinant vector, or plant expression cassette in improving the drought resistance of alfalfa or in breeding drought-resistant varieties of alfalfa.
[0038] In some embodiments, by reducing relative conductivity, inhibiting MDA accumulation, and enhancing the activity of antioxidant enzymes such as CAT, SOD, and POD, the accumulation of reactive oxygen species (O2•⁻, H2O2) is reduced, thereby reducing the damage of drought stress to alfalfa.
[0039] In this invention, the improved drought resistance or enhanced drought tolerance of alfalfa can be demonstrated by one or more of the following indicators: (a) after the same degree of drought stress and rehydration, the plant survival rate is significantly higher than that of the wild-type control; (b) under drought stress, the relative electrical conductivity and malondialdehyde (MDA) content of leaves are significantly lower than those of the wild-type control; (c) under drought stress, the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) in leaves are significantly higher than those of the wild-type control; (d) under drought stress, the lignin content of roots, stems, leaves, or the whole plant is significantly higher than that of the wild-type control.
[0040] To better understand the technical solutions of the above embodiments, the following more detailed experimental examples are provided to explain some of the embodiments.
[0041] Example 1 Construction of MsCCoAOMTc3 gene overexpression vector Plant materials: The alfalfa variety "Xinjiang Big Leaf" was provided by Shaanxi Yangling Sanjie Forage Research Institute Co., Ltd.
[0042] II. Construction of MsCCoAOMTc3 gene overexpression vector 1. RNA extraction RNA was extracted from the leaves of alfalfa 'Xinjiang Daye' using the NGzol Reagent Total RNA Rapid Extraction Kit (Huiling) according to the kit instructions, and stored at -80℃ for later use.
[0043] 2. Synthesis of the first strand of cDNA Reverse transcription was performed using RNA as a template, and the first strand of cDNA was synthesized using All-in-One First-Strand Synthesis MasterMix (with dsDNase) (Jiangsu Yugong Biotechnology, EG15133S). The specific procedure was as follows: 1 μg RNA, 1 μL dsDNase, 1 μL 10× dsDNase buffer, and 10 μL Nuclease-Free Water were gently pipetted and mixed, briefly incubated at 37°C for 2 min to remove genomic DNA contamination, and then incubated at 65°C for 2 min to obtain the reaction product, which was then stored on ice. Next, 10 μL of the reaction product, 4 μL All-in-One First-Strand Synthesis MasterMix, and 6 μL Nuclease-Free Water were gently pipetted and mixed, briefly incubated, and then incubated at 50°C for 15 min. After the reaction was complete, the reaction was terminated by incubating at 65°C for 5 min to obtain cDNA, which was then stored at -20°C.
[0044] 3. Gene expression analysis Based on the CDS sequence of MsCCoAOMTc3, quantitative qPCR primers were designed using Primer Premier 5.0. Using cDNA from roots, stems, leaves, and flowers of alfalfa 'Xinjiang Daye', as well as cDNA from drought-treated leaves and stems, as templates, gene expression analysis was performed using Novizan's ChamQ SYBR qPCR Master Mix reagent on a Bio-Rad CFX96TM real-time PCR instrument. Figure 1 As shown.
[0045] 4. Construction of overexpression vectors (1) Obtaining PCR products: Primers MsCCoAOMTc3F and MsCCoAOMTc3R were designed using Primer Premier 5.0 software. Using the cDNA obtained in step 2 as a template, PCR amplification was performed using a high-fidelity enzyme (Phanta Max SuperFidelity DNA Polymerase, Vazyme) to obtain the target gene MsCCoAOMTc3 product. The PCR products were then detected by agarose gel electrophoresis (e.g., Figure 2 As shown in Figure A, the target gene MsCCoAOMTc3 has a clear band at 744 bp, and the PCR product was recovered using a purification and recovery kit (Huiling, Shanghai).
[0046] PCR reaction conditions: 95℃ for 5 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 80 s, 35 cycles; 72℃ for 5 min.
[0047] The PCR reaction system, totaling 25 μL, consisted of: MsCCoAOMTc3F 1 μL, MsCCoAOMTc3R 1 μL, ddH2O 7.5 μL, cDNA 2 μL, 2 x Phanta Max Buffer 12.5 μL, dNTP mix 0.5 μL, and Phanta Max Super-Fidelity DNA Polymerase 0.5 μL.
[0048] (2) Linearize the pHELLSgate2 vector with XhoI and XbaI restriction endonucleases.
[0049] (3) Use homologous recombination to ligate the target gene fragment and the linearized vector (or use the T4 DNA ligase conventional in this field for enzyme digestion-ligation reaction).
[0050] Reaction system: 3 μL MsCCoAOMTc3 gene target fragment, 2 μL linearized pHELLSgate2 Vector, 5 μL LightNing DNA Assembly Mix Plus.
[0051] Reaction conditions: 50℃ for 60 min.
[0052] (4) The pHELLSgate2-MsCCoAOMTc3 ligation product was transformed into Escherichia coli by heat shock. The specific operation was as follows: 100 μL of competent E. coli cells (DH5α) were taken from 80℃ and placed on ice to thaw naturally; after the competent E. coli cells thawed, 10 μL of the recombinant product was added to 100 μL of competent E. coli cells, the test tube was gently tapped to mix it evenly, and the mixture was placed on ice for 30 min; after heat shock at 42℃ for 90 s, the mixture was quickly placed on ice for 5 min; then 600 μL of LB liquid medium without any antibiotics was added, and the mixture was cultured in a shaker at 37℃ for 200 rpm / min for 1 h to obtain the bacterial culture; the bacterial culture was centrifuged at 5000 rpm for 5 min, the supernatant was discarded, and then 50 μL of LB liquid medium without any antibiotics was added. The bacterial culture was resuspended in μL of sterile water; the resuspended culture was spread onto solid LB medium containing 50 mg / mL spectinomycin (spec) using a spreader, and incubated upside down at 37°C. Single colonies were then picked; the picked single colonies were resuspended in water, and PCR detection was performed using 35S-F and MsCCoAOMTc3-R primers. The PCR results are shown below. Figure 2 The product of type B was 800 bp in length. After PCR detection, the recombinant plasmid was extracted after overnight incubation in liquid LB medium containing 50 mg / mL spec at 37°C. Using 35S-F primers, the plasmid was sent to a sequencing company for sequencing. The correctly sequenced plasmid was named pHELLSgate2-MsCCoAOMTc3.
[0053] (5) Transform Agrobacterium with the correctly sequenced plasmid pHELLSgate2-MsCCoAOMTc3 into Agrobacterium using the heat shock method. The specific operation is as follows: Take 100 μL of Agrobacterium competent cells GV3101 (Weidi Bio, Shanghai) from 80℃ and place them on ice to thaw naturally; after the Agrobacterium competent cells GV3101 thaw, in a clean bench, take 5 μL of recombinant plasmid pHELLSgate2-MsCCoAOMTc3 and add it to the Agrobacterium competent cells GV3101, gently tap the test tube to mix it evenly, let it stand on ice for 30 min, then in liquid nitrogen for 5 min, in a 28℃ water bath for 5 min, and then quickly place it on ice for 5 min; then add 600 μL of antibiotic-free LB liquid medium, shake on a shaker at 28℃ for 200 rpm / min for 3 h; centrifuge the bacterial solution at 5000 rpm for 5 min, discard the supernatant, and resuspend the bacterial solution with 100 μL of sterile water; spread the resuspended bacterial solution on a plate containing 50 μL of sterile water. Solid LB medium containing 50 mg / mL kana and 50 mg / mL rifampin was incubated upside down at 28°C. Single colonies from the solid LB medium were picked and cultured in LB liquid medium containing 50 mg / mL kana and 50 mg / mL rifampin. Then, using this medium as a template, PCR detection was performed using primers 35S-F and MsCCoAOMTc3-R. The results are as follows: Figure 2 The product, with a length of 800 bp, was obtained by successfully producing an Agrobacterium tumefaciens culture containing the recombinant plasmid pHELLSgate2-MsCCoAOMTc3. The obtained Agrobacterium tumefaciens culture was then preserved at 80°C with 50% glycerol for later use.
[0054] Table 1. MsCCoAOMTc3 sequence and detection primers Name Sequence Number MsCCoAOMTc3 ATGGCAACCAACGAAGATCAAAAGCAAACTGAATCTGGAAGACATCAAGAAGTTGGTCACAAGAGTCTTCTACAAAGTGATGCCCTTTACCAGTATATTCTAGAGACCAGTGTCTTCCCAAGAGAACATGAAGCTATGAAAGAGTTGAGAGAGGTCACAGCAAAACACCCATGGAACATCATGACAACCTCTGCAGATGAAGGACAATTTTTGAGCATGCTCCTTAAACTTATCAATGCTAAGAATACCATGGAAATTGGTGTCTACACTGGCTACTCCCTCCTTGCCACTGCCCTAGCTATTCCTGAAGATGGAAAGATTTTGGCTATGGACATTAACAAAGAAAATTACGAATTGGGTCTACCTGTAATTAAAAAAGCTGGTGTTGATCACAAAATTGATTTCAGAGAAGGTCCAGCTCTTCCAGTTCTTGATGAAATGATCAAAGACGAAAAGAATCATGGTAGCTACGATTTCATTTTTGTGGATGCTGACAAAGACAATTACCTCAACTACCATAAGAGGTTAATCGATCTTGTTAAAGTGGGAGGTGTGATCGGCTACGACAACACCTTATGGAATGGATCTGTGGTTGCACCCCCTGATGCTCCATTGAGGAAGTATGTTAGGTACTATAGAGATTTTGTTTTGGAGCTTAACAAGGCTTTGGCTGTGGACCCTAGGATTGAAATATGTATGCTTCCTGTTGGTGATGGAATCACTATCTGCCGTAGGATCAAGTAA SEQ ID NO: 1 MsCCoAOMTc3-F 5'-CATTTGGAGAGGACACGCTCGAGATGGCAACCAACGAAGATCAA -3' SEQ ID NO:2 MsCCoAOMTc3-R 5'-TCTCATTAAAGCAGGACTCTAGATTACTTGATCCTACGGCAGATAGTG -3' SEQ ID NO:3 35S-F 5'-GACGCACAATCCCACTATCC-3' SEQ ID NO: 4 Note: The underlined areas in the figure represent the homologous sequences at the ends of the upstream and downstream vectors.
[0055] Example 2 Obtaining MsCCoAOMTc3 gene overexpression plants I. Preparation of Aseptic Seedlings of Alfalfa 'Xinjiang Large Leaf' Selection of alfalfa stem explants: Select young stem segments from vigorous alfalfa cuttings and cut them into small sections using a "flat top, slanted bottom" cutting method (remove leaves). Soak the young stem segments in 1 / 1000 Tween 20 solution and shake for 10 minutes, then rinse with water until no foam remains. Disinfect the stem explants with 75% alcohol for 10 seconds; then transfer them to a 15% NaClO solution and quickly transfer them to sterile tissue culture bottles. Disinfect them in a laminar flow hood by shaking for 12 minutes, then rinse 5 times with sterile water. Insert the sterilized explants into 1 / 2 MS + 0.2 mg / L IBA induction medium to induce rooting and obtain sterile seedlings. Culture them in an artificial climate chamber at 25℃ / 22℃ with 16 h / 8 h light.
[0056] The 1 / 2MS induction medium formula is as follows: Weigh 2.22 g MS powder (Phytotech, M519), dissolve it in 800 mL of ultrapure water, add 15 g sucrose and 200 μL IBA (1 mg / mL), and bring the volume to 1000 mL. Adjust the pH to 5.8. Add 7.5 g Agar and autoclave at 121℃ for 21 min.
[0057] II. Preparation of explants Take fully expanded leaves in a clean bench, cut the compound leaves into single leaves with a tissue culture scalpel, and make wounds (in some embodiments, use a sterile scalpel to gently make 3-5 fine cuts on both sides of the main vein on the back of the leaf, the depth of which should be just enough to break the lower epidermis, so as to facilitate Agrobacterium infection), and place the obtained explants on SM4 co-culture medium and culture at 25°C in the dark for 1 day.
[0058] SM4 co-culture medium: Weigh 4.43 g MS powder (Phytotech, M519), dissolve in 800 mL ultrapure water, add 30 g sucrose, 4 mL 2,4-D, and 0.2 mL 6-BAP, and bring the volume to 1000 mL. Adjust the pH to 5.8 and add 7.5 g Agar. Autoclave at 121℃ for 21 min, cool to 50℃, and add 1 mL cephalosporin.
[0059] III. Explant Infection 1. Agrobacterium GV3101 containing pHELLSgate2-MsCCoAOMTc3 was streaked onto LB solid medium containing 50 mg / L Rif and 50 mg / L Kan to activate it.
[0060] 2. Pick a single colony and add it to 15 mL of LB liquid medium containing 50 mg / L Rif and 50 mg / L Kan. Incubate at 28°C with shaking until OD reaches 100%. 600 = Around 0.8.
[0061] 3. Centrifuge at 5000 rpm for 5 min to collect bacteria, remove the supernatant, add an equal volume of Agrobacterium suspension, and infect alfalfa explants.
[0062] The LB liquid medium consisted of 5 g / L yeast extract, 5 g / L tryptone, and 10 g / L sodium chloride; the LB solid medium consisted of 5 g / L yeast extract, 5 g / L tryptone, 10 g / L sodium chloride, and 15 g / L agar.
[0063] Agrobacterium suspension: Weigh 4.43 g MS powder, dissolve in 800 mL ultrapure water, add 30 g sucrose, 4 mL 2,4-D, and 0.2 mL 6-BAP, and bring the volume to 1000 mL. Adjust the pH to 5.8 and autoclave at 121℃ for 15 min.
[0064] IV. Screening and Rooting Culture After infection, the surface of the explants was dried by aspirating Agrobacterium and cultured in the dark on SM4 co-culture medium for two days. Then, the explants were transferred to SM4 selection medium for subculture and placed in the dark. The selection medium was changed every two weeks. When the resistant callus was large enough, it was transferred to MSBK regeneration medium containing the corresponding antibiotic to promote shoot differentiation and elongation.
[0065] MSBK selective medium: Weigh 4.43 g MS powder, dissolve in 800 mL ultrapure water, add 30 g sucrose, 1 mL kinetin, and 0.5 mL 6-BAP, and bring the volume to 1000 mL. Adjust the pH to 5.8 and add 7.5 g Agar. Autoclave at 121°C for 15 min, cool to 50°C, and add 1 mL cephalosporin, 1 mL termethin, and 50 mg / L kanamycin.
[0066] Regenerated shoots were transferred to MSS shoot elongation medium until they grew large, and then the shoots / tissue culture seedlings were transferred to MSR medium. After rooting, wild-type and transgenic plants with similar growth were selected and transferred to vermiculite to obtain alfalfa seedlings for subsequent experiments.
[0067] Bud elongation medium (MSS): Weigh 2.22 g MS powder, dissolve in 800 mL ultrapure water, add 15 g sucrose, and bring the volume to 1000 mL. Adjust the pH to 5.8 and add 7.5 g Agar. Autoclave at 121℃ for 15 min, cool to 50℃, and add 1 mL cephalosporin, 1 mL termethin, and 50 mg / L kanamycin.
[0068] Rooting medium (MSR): Weigh 2.22 g MS powder, dissolve in 800 mL ultrapure water, add 15 g sucrose, and bring the volume to 1000 mL. Adjust the pH to 5.8 and add 7.5 g agar. Autoclave at 121°C for 15 min, cool to 50°C, and add 1 mL IAA.
[0069] V. Identification of Transgenic Plants 1. DNA was extracted from the leaves of transgenic alfalfa plants and wild-type alfalfa (WT) plants using the CTAB method. The specific procedure was as follows: (1) Take fresh leaves and place them in a 2 mL centrifuge tube containing steel balls. After being quickly frozen with liquid nitrogen, grind them into powder evenly.
[0070] (2) Add 600 μL of CTAB extract, shake to mix, and incubate in a water bath at 65°C for 30 min.
[0071] (3) Add 600 μL of chloroform to the fume hood, shake to mix, and centrifuge at 12000 rpm for 10 min.
[0072] (4) Carefully aspirate 400 μL of supernatant with a 1 mL pipette, transfer it to a new centrifuge tube, add an equal volume of isopropanol, mix well, and place in a -20℃ refrigerator for 1 h to settle.
[0073] (5) Centrifuge at 12000 rpm for 10 min and discard the supernatant.
[0074] (6) Add 1 mL of 75% ethanol by volume, shake to mix, centrifuge at 12000 rpm for 5 min, discard the supernatant, and place in a fume hood to evaporate the ethanol.
[0075] (7) Finally, add 100 μL of Tris-HCl solution, mix thoroughly, and store the DNA sample in a -20℃ freezer. Tris-HCl: 10 mM, pH 8.0.
[0076] 2. The extracted DNA was detected by PCR using primers 35SF and MsCCoAOMTc3-R as shown in Table 1. The results are as follows: Figure 3 As shown in A in the table, positive alfalfa seedlings were successfully obtained. Subsequently, using primers MsCCoAOMTc3RTF and MsCCoAOMTc3RTR from Table 2, with MsACTIN as an internal reference gene, the expression level of the MsCCoAOMTc3 gene in the leaves of 11 positive alfalfa seedlings and wild-type alfalfa plants was detected by qRTPCR. The expression levels of OE8 and OE12 were significantly higher than those of the wild type, and these were selected for subsequent drought tolerance analysis. Figure 3 (B in the middle).
[0077] Table 2 Quantitative Primers name sequence serial number MsCCoAOMTc3RTF 5'AATCTGGAAGACATCAAGAAGTTG3' SEQ ID NO: 5 MsCCoAOMTc3RTR 5'CAGTGGCAAGGAGGGAGTAG3' SEQ ID NO: 6 MsACTIN-RT-F 5'-GACAATGGAACTGGAATGG-3' SEQ ID NO: 7 MsACTIN RT-R 5'-CAATACCGTGCTCAATGG-3' SEQ ID NO: 8 Example 3 Drought resistance analysis of the MsCCoAOMTc3 gene in alfalfa All quantitative experimental data in this invention were independently replicated at least three times, and the results are expressed as mean ± standard deviation.
[0078] 1. Select wild-type alfalfa plants WT and transgenic alfalfa plants MsCCoAOMTc3 OE8 and MsCCoAOMTc3 OE12 with uniform growth for drought treatment.
[0079] The specific procedures are as follows: Wild-type alfalfa plants (WT) and transgenic alfalfa plants (MsCCoAOMTc3 OE8 and MsCCoAOMTc3 OE12) that have been cultured for 30 days were thoroughly watered. After the plants had absorbed enough water, the excess water was drained, and watering was stopped to allow them to dry naturally. Wild-type alfalfa plants (WT) and transgenic alfalfa plants (MsCCoAOMTc3 OE8 and MsCCoAOMTc3 OE12) that were not subjected to drought treatment (normal water supply) served as controls (CK).
[0080] The results are as follows Figure 4 As shown, on day 7 of drought treatment, the leaves of wild-type alfalfa plant WT showed significant wilting, while the transgenic alfalfa plants MsCCoAOMTc3 OE8 and MsCCoAOMTc3 OE12 showed less wilting. On day 18 of drought treatment, wild-type alfalfa plant WT was completely wilted, while the leaves of transgenic alfalfa plants MsCCoAOMTc3 OE8 and MsCCoAOMTc3 OE12 still showed less wilting than wild-type alfalfa plant WT. After 7 days of rehydration, wild-type alfalfa plant WT failed to survive, while transgenic alfalfa plants MsCCoAOMTc3 OE8 and MsCCoAOMTc3 OE12 survived normally.
[0081] 2. The relative conductivity, malondialdehyde (MDA) content, superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) activities, as well as the levels of 3,3'-diaminobenzidine (DAB) and nitrotetrazole blue (NBT) in the leaves of wild-type alfalfa plants (WT), transgenic alfalfa plants MsCCoAOMTc3 OE8 and MsCCoAOMTc3 OE12 under drought treatment and control were measured. Specific procedures are as follows: (1) Determination of relative conductivity: 10 mL of ultrapure water was added to a 15 mL centrifuge tube, and then 6 blades with a diameter of 0.5 cm were added to the centrifuge tube. The centrifuge tube was placed in a shaker at 28℃ and shaken for 2 h to measure the initial conductivity (EC1). Subsequently, the sample was boiled in water for 30 min, and after naturally cooling to room temperature, the final conductivity (EC2) was measured. The formula for calculating relative conductivity (REL) is REL = EC1 / EC2 × 100%.
[0082] (2) Determination of malondialdehyde content and SOD, POD and CAT enzyme activities: 1) Enzyme extraction: Weigh 0.1–0.2 g of alfalfa leaves using a 0.01 g balance and place them in a pre-cooled mortar. Transfer the homogenate to a centrifuge tube, bring the volume to 1 mL with phosphate buffer, and then place the centrifuge tube in an ice box. Centrifuge at 12,000 rpm for 20 min at 4 °C. The supernatant is the enzyme solution. After centrifugation, keep the solution in an ice box and immediately measure the activity of antioxidant and other enzymes.
[0083] 2) Determination of malondialdehyde content 0.5% TBA (volume percentage): Weigh 5 g of trichloroacetic acid and dissolve it in 100 mL of water. Then weigh 0.5 g of TBA, dissolve it in 10 mL of 1 M NaOH, and finally dilute to 100 mL with the freshly prepared 5% trichloroacetic acid solution.
[0084] The method for preparing NaOH is to dissolve 4 g in 100 mL of water.
[0085] This reagent should be prepared and used immediately, stored at room temperature and protected from light. Add 300 μL of 0.5% TBA and 150 μL of enzyme solution sequentially to a 1.5 mL centrifuge tube, mix well, and incubate in a boiling water bath at 100°C for 20 min. After 20 min, immediately place the tube in an ice-water bath to cool to room temperature. After cooling, centrifuge at 3000 rpm for 10 min, collect the supernatant, and measure the absorbance at 532 nm, 600 nm, and 450 nm using a UV spectrophotometer.
[0086] The calculation formula is: MDA concentration (μmol / L) = 6.45 (OD532 nm − OD600 nm) − 0.56 × OD450 nm.
[0087] MDA content (μmol / g Fw) = MDA concentration (μmol / L) × extraction liquid volume (mL) / fresh weight of plant tissue (g).
[0088] 3) Determination of POD activity Prepare 50 mM (pH 7.0) phosphate buffer; add 1021 μL of 100 mM H2O2 (30% v / v) to a final volume of 100 mL, store at 4°C protected from light, and use immediately; add 0.4 mL of 100 mM guaiacol to a final volume of 100 mL, and store at 4°C. Initiate the reaction by adding 230 μL of 50 mM (pH 7.0) phosphate buffer, 30 μL of 100 mM guaiacol, 15 μL of enzyme solution, and 30 μL of 100 mM H2O2 sequentially. Measure the reaction at 470 nm using kinetic curves.
[0089] The calculation formula is: POD activity (μmol g) -1 s -1 =(ΔA470 nm×1) / (0.015×FW×26.8×60×3)=(absorbance value×extraction volume) / (enzyme solution volume used in the determination×sample fresh weight×extinction coefficient×time).
[0090] 4) Determination of SOD activity The sample tubes were sequentially supplemented with 160 μL of 0.05 mol / L phosphate buffer (pH 7.8), 30 μL of 130 mmol / L methionine (Met) solution, 30 μL of 750 μmol / L nitroblue tetrazolium (NBT) solution, 30 μL of 100 μmol / L EDTA-Na2 solution, 20 μL of enzyme solution, and 30 μL of 20 μmol / L riboflavin solution. The control tubes, without enzyme solution, were sequentially supplemented with 180 μL of 0.05 mol / L phosphate buffer (pH 7.8), 30 μL of 130 mmol / L methionine (Met) solution, 30 μL of 750 μmol / L nitroblue tetrazolium (NBT) solution, 30 μL of 100 μmol / L EDTA-Na2 solution, and 30 μL of 20 μmol / L riboflavin solution. The absorbance was measured at 560 nm.
[0091] The formula for calculating SOD activity is: SOD activity (U / g Fw) = ((absorbance of control tube - absorbance of sample tube) × volume of extract) / (absorbance of control tube × 0.5 × fresh weight of sample × amount of enzyme solution used in the determination).
[0092] 5) Determination of CAT activity 50 mmol / L phosphate buffer, pH 7.8, 50 mM H2O2: Pipette 510.5 μL of 30% H2O2 and dilute to 100 mL with water.
[0093] 234 μL of 50 mM PBS (pH 7.8), 6 μL of enzyme solution, and 60 μL of 50 mM H2O2 were added to a UV plate at a wavelength of 240 nm. The reaction started immediately after the addition of H2O2, and data were read every 3 minutes.
[0094] CAT activity (umol g⁻¹ s⁻¹) = (absorbance * extraction volume) / (enzyme solution volume used in the assay * sample fresh weight * extinction coefficient * time) = (ΔA240nm * 0.8) / (0.06 * FW * 39.4 * 60 * 3) 6) NBT staining and DAB tissue staining NBT staining method (1) Preparation of NBT staining solution: Weigh an appropriate amount of NBT powder and dissolve it in 10mM potassium phosphate buffer (pH 7.8) until the NBT concentration is 0.5 mg / ml. It is best to prepare the solution fresh each time you use it.
[0095] (2) Staining: Place the plant material into a tube containing NBT staining solution (0.5 mg / ml) and stain in the dark at 28°C for 1 h. (3) Decolorization: Remove the staining solution from the tube, add 90% ethanol, boil in a water bath for more than 10 minutes until the green color of the leaves is completely removed, and then take a picture.
[0096] DAB tissue staining (1) Preparation of DAB staining solution: First, weigh an appropriate amount of DAB dry powder, add 50mM Tris-HCl (pH 3.8) to dilute to 1 mg / ml, so that the drug is completely dissolved.
[0097] (2) Staining: Place the plant material into a tube containing DAB staining solution (1 mg / ml) and store at 28°C in the dark for 14 h.
[0098] (3) Decolorization: Remove the staining solution from the tube, add 70% ethanol, boil in a water bath for more than 10 minutes until the green color of the leaves is completely removed, and then take a picture.
[0099] 7) Determination of lignin content The lignin content determination referenced the lignin content kit (LE-2-373, Hefei Lier Biotechnology). Specifically, the sample was dried at 80℃ to constant weight, pulverized, and passed through a 40-mesh sieve. Approximately 5 mg was weighed into a 10 mL glass tube. A blank control of 1000 μL of Reagent I and 40 μL of perchloric acid were added. For the test tube, 5 mg of the sample, 1000 μL of Reagent I, and 40 μL of perchloric acid were added to a 10 mL glass tube. The tube was sealed with sealing film, thoroughly mixed, and incubated in an 80℃ water bath for 40 min, shaking every 10 min. After natural cooling, 1000 μL of Reagent II was added and thoroughly mixed. 40 μL of the supernatant was collected, and 1960 μL of Reagent III was added. 1 mL of the supernatant was transferred to a quartz cuvette, and the absorbance (A) at 280 nm was measured. The samples are labeled A (blank tube) and A (test tube), respectively. ΔA = A (test tube) - A (blank tube). Standard curve: y = 0.0694x + 0.0068, R² = 0.9889. Lignin (mg / g dry weight) = (ΔA - 0.0068) ÷ 0.0694 × Vtotal × 10-3 ÷ W × T = 0.0294 × (ΔA - 0.0068) ÷ W × T. Vtotal: total reaction volume: 2.04 mL; W: sample mass, g; T: dilution factor.
[0100] The results showed that after rehydration, the survival rates of transgenic alfalfa lines MsCCoAOMTc3 OE8 and MsCCoAOMTc3 OE12 were significantly higher than those of the wild type. Figure 5 (A) After drought treatment, the relative electrical conductivity and MDA content of the leaves of transgenic plants were significantly lower than those of wild-type plants. Figure 5 The activity of B–C in the wild type was significantly higher than that of the wild type (B–C). Figure 5 E–G in the sample). Furthermore, DAB and NBT staining showed that transgenic leaves stained significantly lighter than wild-type leaves, indicating a significant reduction in the accumulation of reactive oxygen species (O2•⁻ and H2O2) under drought stress. Figure 5 The D and H in the text are not included. Meanwhile, the determination of lignin content in various parts of the plant before and after drought treatment showed that drought treatment significantly increased the lignin content in roots, stems, leaves, and the whole plant in both wild-type and transgenic plants. However, before and after drought treatment, the lignin content in all parts and the whole plant of the MsCCoAOMTc3 transgenic plant was significantly higher than that of the wild-type (…). Figure 6 (A~D in the original text). In summary, overexpression of the MsCCoAOMTc3 gene can mitigate drought damage to alfalfa by increasing SOD, POD, and CAT activities, inhibiting MDA accumulation, reducing ion leakage and reactive oxygen species accumulation, and maintaining a high lignin content. These results indicate that overexpression of the MsCCoAOMTc3 gene can enhance alfalfa's resistance to drought stress.
[0101] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. An isolated nucleic acid molecule, characterized in that, The nucleic acid molecule is a nucleotide sequence as shown in SEQ ID NO: 1, and its name is the MsCCoAOMTc3 gene.
2. A recombinant vector, characterized in that, The invention comprises the nucleic acid molecule of claim 1 and a plant expression regulatory element that drives its expression, wherein the plant expression regulatory element comprises a CaMV 35S promoter at the 5' end and a NOS terminator at the 3' end.
3. The recombinant vector according to claim 2, characterized in that, The recombinant vector is obtained by linking the nucleic acid molecule of claim 1 with the overexpression vector pHELLSgate2.
4. A plant expression kit, characterized in that, It comprises the nucleic acid molecule of claim 1, and a CaMV 35S promoter attached to its 5' end and a NOS terminator attached to its 3' end.
5. An engineered bacterium, characterized in that, It comprises the recombinant vector of claim 2 or 3 or the plant expression cassette of claim 4; the engineered bacteria is Agrobacterium GV3101.
6. A method for preparing the recombinant vector according to claim 3, characterized in that, The procedure includes the following steps: (1) Using cDNA of alfalfa "Xinjiang Big Leaf" as a template, PCR amplification is performed using a forward primer with the sequence shown in SEQ ID NO.2 and a reverse primer with the sequence shown in SEQ ID NO.3 to obtain the nucleic acid molecule described in claim 1; (2) The overexpression vector pHELLSgate2 is double-digested with restriction endonucleases XbaI and XhoI to obtain a linearized vector; (3) The PCR amplification product obtained in step (1) is ligated with the linearized vector obtained in step (2) to obtain a recombinant product; (4) The recombinant product is transformed into competent Escherichia coli cells and the recombinant vector is obtained by screening.
7. The method according to claim 6, characterized in that, The PCR amplification reaction system described in step (1) is as follows: 1 μL of primer shown in SEQ ID NO.2, 1 μL of primer shown in SEQ ID NO.3, 7.5 μL of ddH2O, 2 μL of cDNA template, 12.5 μL of 2×Phanta Max Buffer, 0.5 μL of dNTP mixture, and 0.5 μL of Phanta Max Super-Fidelity DNA polymerase; the reaction program is as follows: 95℃ pre-denaturation for 5 minutes; 95℃ denaturation for 30 seconds, 57℃ annealing for 30 seconds, 72℃ extension for 80 seconds, for a total of 35 cycles; 72℃ final extension for 5 minutes.
8. A method for preparing alfalfa transformants with improved drought resistance, characterized in that, Includes the following steps: (a) Providing a recombinant vector comprising the nucleic acid molecule of claim 1; (b) Infecting mechanically scratched leaf explants of alfalfa 'Xinjiang Big Leaf' with Agrobacterium GV3101 infection solution containing the recombinant vector; (c) Screening and culturing the transformed cells to obtain transgenic plants.
9. A transgenic alfalfa plant, characterized in that, The plant is obtained by the method of claim 8, and its genome integrates the nucleic acid molecules of claim 1.
10. The use of the nucleic acid molecule of claim 1, or the recombinant vector of claim 2 or 3, or the plant expression cassette of claim 4 in improving the drought resistance of alfalfa or in breeding drought-resistant varieties of alfalfa.