Gene OsARF1 for regulating and controlling ability of rice root system to penetrate through hard soil and application of gene OsARF1

Abstract

The invention discloses a gene OsARF1 for regulating and controlling the ability of a rice root system to penetrate through hard soil and application of the gene OsARF1. The amino acid sequence coded by the gene OsARF1 is as shown in SEQ ID No. 2. The nucleotide sequence of the gene OsARF1 is as shown in SEQ ID No. 1 (sequence identifier number 1). According to the invention, the OsARF1 gene is over-expressed in rice, so that the expression level of the OsARF1 gene in a rice variety is improved, and then a rice strain with enhanced root penetrating power in hard soil is obtained. The expression of the OsARF1 gene is up-regulated under the condition of hard soil, the expression of the downstream OsCESA6 gene is inhibited, the cellulose synthesis and cell wall thickening of a cortical cell wall are reduced, the thickening of a root system is promoted, and the ability of the root system penetrating through the hard soil is improved. The application of the invention can be used for cultivating a new rice variety suitable for growing in hard soil, and has important significance for improving rice planting under poor soil conditions such as saline-alkali soil.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, specifically relating to a gene OsARF1 that regulates the ability of rice roots to penetrate hard soil and its application. Background Technology

[0002] Rice is a major food crop in my country, and its yield and quality directly affect national food security. With the decrease in arable land and the intensification of soil degradation, improving rice's resistance to adverse conditions and improving rice varieties to adapt to growth in unfavorable soil conditions have become important directions in current rice breeding research. During rice growth, the root system, as the main organ for absorbing water and nutrients, directly affects the plant's growth and development. In hard soil conditions, the root system's ability to penetrate is particularly important, not only enabling the plant to absorb nutrients from deeper soil layers but also achieving the purpose of biological loosening of the soil, further improving soil structure and environment. However, our understanding of the molecular mechanisms regulating the ability of rice roots to penetrate hard soil is still limited, and there are few reports on the functions of genes related to the strength of root penetration, resulting in a lack of effective gene resources for breeding new rice varieties adapted to hard soil growth. Therefore, identifying and utilizing key genes that can improve the ability of rice roots to penetrate hard soil has significant theoretical and practical value for breeding new rice varieties tolerant to hard soil and improving rice cultivation in saline-alkali land and other unfavorable soil conditions. Summary of the Invention

[0003] In view of this, the present invention provides a gene OsARF1 that regulates the ability of rice roots to penetrate hard soil and its application, in order to solve the problem of the lack of effective ways to improve the ability of rice roots to penetrate hard soil in the prior art.

[0004] The objective of this invention is achieved through the following technical solution:

[0005] <First Aspect>

[0006] The application of the gene OsARF1 in regulating the ability of rice roots to penetrate hard soil, the amino acid sequence encoded by the gene OsARF1 is shown in SEQ ID No. 2.

[0007] The nucleotide sequence of the gene OsARF1 is shown in SEQ ID No. 1.

[0008] The application involves overexpressing the OsARF1 gene in rice varieties to obtain rice lines with enhanced root penetration ability in hard soil.

[0009] The rice variety in question is Wuyujing 7, a japonica rice variety.

[0010] <Second aspect>

[0011] The present invention also provides a recombinant expression vector comprising the gene OsARF1, wherein the amino acid sequence encoded by the gene OsARF1 is shown in SEQ ID No. 2;

[0012] And / or, the nucleotide sequence of the gene OsARF1 is as shown in SEQ ID No. 1.

[0013] <Third aspect>

[0014] A method for constructing a recombinant expression vector includes the following steps:

[0015] S1. Amplification of the OsARF1 gene sequence: Using rice root cDNA as a template, PCR amplification was performed to obtain the PCR product of the OsARF1 gene as shown in SEQ ID NO.2; the accession number of the rice root cDNA is: EU847008: LOC_Os01g13520.

[0016] S2, Enzyme digestion: The PCR product of the OsARF1 gene in step S1 is digested with enzymes to generate suitable sticky ends; the pTCK303 vector is digested with enzymes to give it sticky ends that match the PCR product.

[0017] S3. Using in-fusion enzyme, the fragments of the PCR product of the OsARF1 gene digested with enzyme and the fragments of the pTCK303 vector digested with enzyme were ligated together. After sequencing verification, the pTCK303-OsARF1 plasmid was obtained.

[0018] In step S1, the primer sequences for PCR amplification are as described in OsARF1-F (SEQ ID NO.3) and OsARF1-R (SEQ ID NO.4).

[0019] In S2, BamHI was used to digest the PCR product of the OsARF1 gene and the pTCK303 vector.

[0020] <Fourth Aspect>

[0021] A method for regulating rice root morphology involves upregulating the expression of the OsARF1 gene and downregulating the expression of the OsCESA6 gene. This reduces cellulose synthesis in the cell walls of the rice root cortex, inhibits cell wall thickening, promotes root thickening, and enhances root penetration. This regulation is a positive regulation.

[0022] The amino acid sequence encoded by the OsARF1 gene is shown in SEQ ID No. 2;

[0023] And / or, the nucleotide sequence of the gene OsARF1 is as shown in SEQ ID No. 1.

[0024] <Fifth Aspect>

[0025] This invention also provides a method for screening rice varieties tolerant to hard soil, comprising the following steps: extracting RNA from the rice variety to be tested; detecting the expression level of the OsARF1 gene using real-time quantitative PCR; and selecting varieties with high OsARF1 gene expression levels as candidate varieties tolerant to hard soil.

[0026] Compared with existing research, this invention has the following beneficial effects:

[0027] 1. This invention discovered and identified a key gene, OsARF1, that regulates the ability of rice roots to penetrate hard soil, providing an important gene resource for breeding new rice varieties tolerant to hard soil. It revealed the molecular mechanism by which the OsARF1 gene regulates the ability of rice roots to penetrate hard soil, providing a new perspective for further research on the mechanisms by which plants adapt to adverse soil environments.

[0028] 2. The method provided by this invention can effectively improve the ability of rice roots to penetrate hard soil, which helps to improve rice cultivation under adverse soil conditions such as saline-alkali land, and has important application value.

[0029] 3. This invention utilizes the overexpression of the OsARF1 gene to participate in the regulation of rice root penetration, and breeds rice varieties with strong root penetration in hard soil, which plays a very important role in agricultural production. Attached Figure Description

[0030] Other features, objects, and advantages of the invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0031] Figure 1 This is a schematic diagram showing the phenotypes of arf1-1 mutant and OE-ARF1 overexpressing roots in loose and hard soils. (The diagram shows the phenotypes of these roots.) Figure 1 A is the arf1-1 mutant genotype, which inserts a T base into the second exon, causing a frameshift in amino acid translation and premature termination. Figure 1 B represents the root growth phenotype of wild-type, arf1-1 mutant, and OE-ARF1 overexpressing plants in loose (1.2BD) and hard (1.6BD) soils, as captured by CT scans.

[0032] Figure 2 Analysis of OsARF1 expression levels in rice roots grown in water (control group Mock), 1.2BD loose soil, and 1.6BD hard soil environments.

[0033] Figure 3Expression levels of downstream genes (OsCESA3, OsCESA5, and OsCESA6) in wild-type, arf1-1 mutant, and OE-ARF1 overexpressing roots were analyzed.

[0034] Figure 4 The phenotypes of root tip elongation zone diameter in wild-type, arf1-1 mutant, and OE-ARF1 overexpressing plants grown in 0.3% and 0.6% agar medium are shown. Detailed Implementation

[0035] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make several changes and improvements without departing from the concept of the present invention. These all fall within the protection scope of the present invention.

[0036] Experimental methods not specifically described in the following examples are generally performed under standard conditions, such as those described in Sambrook et al. Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0037] The amino acid sequence encoded by the OsARF1 gene is shown in SEQ ID NO.2.

[0038] The nucleotide sequence of the OsARF1 gene is shown in SEQ ID NO.1.

[0039] AAM-AS liquid culture medium (1L): 100mL of 10×AA macroelements (1.7g / L KH2PO4, 3.7g / L MgSO4·7H2O, 4.4g / L CaCl2·2H2O), 100mL of 100×AA microelements I (1.69g / L MnSO4·H2O, 0.86g / L ZnSO4·7H2O, 0.62g / L H3BO3, 0.083g / L KI), 10mL of 100×AA microelements II (0.025g / L CuSO4·5H2O, 0.25g / L NaMoO4·2H2O, 0.025g / L KI). 1 mL of CoCl2·6H2O, 100 mL of 10×AA amino acids (8.77 g / L glutamine, 2.66 g / L aspartic acid, 2.88 g / L arginine, 0.75 g / L glycine), 5 mL of 200× iron salts (7.46 g / L Na2-EDTA, 5.56 g / L FeSO4·7H2O), 10 mL of 100×MS vitamins (0.05 g / L niacin, 0.1 g / L thiamine hydrochloride, 0.05 g / L pyridoxine hydrochloride), 2.94 g / L KCl, 0.5 g / L hydrolyzed casein, 68.5 g / L sucrose, 36 g / L glucose, 0.1 g / L inositol, adjust pH to 5.2, autoclave. Add AS (acetylsyleugenol) to a final concentration of 200 μM before use.

[0040] NBD2 medium (1L): 50mL of stock solution 1 (56.6g / L KNO3, 9.26g / L (NH4)2SO4, 8g / L KH2PO4); 25mL of stock solution 2 (6.64g / L CaCl2·2H2O); 25mL of stock solution 3 (7.4g / L MgSO4·7H2O); 10mL of trace element I (A: 0.781g / L MnSO4·H2O, 0.2g / L ZnSO4·7H2O dissolved in 400mL sterile water; B: 0.3g / L H3BO3, 0.075g / L KI dissolved in 400mL sterile water, then A and B are mixed and the volume is adjusted to 1L); 10mL of trace element II (0.25g / L Na2MoO4·2H2O, 0.025g / L MgSO4·7H2O, 0. ... 1 mL of CuSO4·5H2O (0.025 g / L CoCl2·6H2O); 10 mL of Vitamin B5 I (1 g / L thiamine hydrochloride, 0.1 g / L pyridoxine hydrochloride, 0.1 g / L niacin); 10 mL of Vitamin B5 II (0.2 g / L glycine); 5 mL of 2,4-D (0.2 g / L 2,4-D dissolved in 1 mL anhydrous ethanol, then diluted to 1 L); 5 mL of 200× iron salt (7.46 g / L Na2-EDTA, 5.56 g / L FeSO4·7H2O); 30 g / L sucrose; 0.1 g / L inositol; 0.5 g / L L-proline; 0.5 g / L L-glutamine; 0.5 g / L hydrolyzed casein; 3 g / L phytagel; autoclave at 121°C for 20 min.

[0041] NBD2-AS medium (1L): 50mL of stock solution 1 (56.6g / L KNO3, 9.26g / L (NH4)2SO4, 8g / L KH2PO4); 25mL of stock solution 2 (6.64g / L CaCl2·2H2O); 25mL of stock solution 3 (7.4g / L MgSO4·7H2O); 10mL of trace element I (A: 0.781g / L MnSO4·H2O, 0.2g / L ZnSO4·7H2O dissolved in 400mL sterile water; B: 0.3g / L H3BO3, 0.075g / L KI dissolved in 400mL sterile water, then A and B are mixed and the volume is adjusted to 1L); 10mL of trace element II (0.25g / L Na2MoO4·2H2O, 0.025g / L MgSO4·7H2O, 0. ... 1 mL of CuSO4·5H2O (0.025 g / L CoCl2·6H2O); 10 mL of Vitamin B5 I (1 g / L thiamine hydrochloride, 0.1 g / L pyridoxine hydrochloride, 0.1 g / L nicotinic acid); 10 mL of Vitamin B5 II (0.2 g / L glycine); 5 mL of 2,4-D (0.2 g / L 2,4-D dissolved in 1 mL anhydrous ethanol, then brought to a final volume of 1 L); 5 mL of 200× iron salt (7.46 g / L Na2-EDTA, 5.56 g / L FeSO4·7H2O); 1 g / L hydrolyzed casein; 0.1 g / L inositol; 30 g / L sucrose; 10 g / L glucose; adjust pH to 5.2; autoclave (solid culture medium with 0.2% phytagel). Add 100 μM AS (acetylsyleugenol) when pouring plates.

[0042] Selective culture medium: The above NBD2-AS medium, with hygromycin 50 mg / L added.

[0043] Differentiation medium: 50 mL of stock solution 1 (76 g / L KNO3, 66 g / L NH4NO3, 14.8 g / L MgSO4·7H2O); 50 mL of stock solution 2 (8.8 g / L CaCl2·2H2O); 50 mL of stock solution 3 (3.4 g / L KH2PO4); 50 mL of stock solution 4 (2.23 g / L MnSO4·4H2O, 0.86 g / L ZnSO4·7H2O, 0.62 g / L H3BO3, 0.083 g / L KI, 0.025 g / L Na2MoO4·2H2O, 0.0025 g / L CuSO4·5H2O, 0.0025 g / L... 10 mL of CoCl2·6H2O; 5 mL of mother liquor 5 (0.4 g / L glycine, 0.08 g / L thiamine hydrochloride, 0.1 g / L pyridoxine hydrochloride, 0.1 g / L nicotinic acid, 20 g / L inositol); 5 mL of mother liquor 6 (7.64 g / L Na2-EDTA, 5.56 g / L FeSO4·7H2O).

[0044] Example 1: Cloning of the OsARF1 gene

[0045] The sequence information of the OsARF1 gene was obtained from the rice genome database. Specific primers RT-OsARF1-F (SEQ ID NO. 5) and RT-OsARF1-R (SEQ ID NO. 6) were designed, and the coding sequence of the OsARF1 gene was amplified from rice cDNA (EU847008: LOC_Os01g13520) using RT-PCR. The amplified sequence was cloned into the pMD18-T vector (purchased from SinoBiological, Canada), and sequenced for verification using standard methods in the art to obtain the full-length cDNA sequence of the OsARF1 gene (e.g., SEQ ID NO. 1; EU847008).

[0046] Example 2: Obtaining the OsARF1 loss-of-function mutant arf1-1

[0047] 1. Construction of the OsARF1 loss-of-function mutant arf1-1

[0048] To conduct applied research on the OsARF1 protein, a CRISPR / Cas9 knockout vector for the OsARF1 gene was constructed and transformed into conventional japonica rice variety Wuyujing 7 (also known as 9522) plants, thereby knocking out or reducing the expression of OsARF1 and achieving the goal of altering the root penetration ability of rice.

[0049] Using the method described in the reference (Xie et al. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc. Natl. Acad. Sci. 112, 3570-3575 (2015)), two sequences (fragment 1 and fragment 2; where fragment 1 is SEQ ID NO. 17 and fragment 2 is SEQ ID NO. 18) were amplified using plasmid pGTR (Xie et al., 2014) as a template.

[0050] The two primer pairs are as follows:

[0051] L5AD5-F:5'CGGGTCTCAGGCAGGATGGGCAGTCTGGGCAACAAAG CACCAGTGG 3'(SEQ IDNO.7)

[0052] L5AD5-R:5'TAGGTCTCCAAACGGATGAGCGACAGCAAACAAAA AAAAAAGCACCGACTCG 3'(SEQ ID NO.10)

[0053] OsARF1-CRI-R:5'CGGGTCTCACGCTGCGGCACCtgcaccagccggg (SEQ ID NO.8)

[0054] OsARF1-CRI-F:5'TAGGTCTCCAGCGGGACGAGCgttttagagctagaa (SEQ ID NO.9)

[0055] Fragment 1 and Fragment 2 were mixed and ligated simultaneously using restriction endonuclease Bsa1 and T7 ligase (Beyotime Biotechnology). The product was used as a template to amplify the tRNA-gRNA ligation fragment (Fragment 3, sequence as shown in SEQ ID NO. 19) using primers such as SEQ ID NO. 11 and SEQ ID NO. 12.

[0056] The BsaI restriction site recognition sequence is 5'-GGTCTC(N)1^-3';

[0057] S5AD5-F:5'CGGGTCTCAGGCAGGATGGGGCAGTCTGGGCA 3'(SEQ ID NO.11)

[0058] S5AD5-R:5'TAGGTCTCCAAACGGATGAGCGACAGAAAC 3'(SEQ ID NO.12)

[0059] After treating fragment 3 with Fok1 restriction endonuclease (the recognition site of FokI restriction endonuclease is usually "GGATG……CCTAC", where "..." represents any nucleotide sequence), the fragment was inserted into the Bsa1-treated pRGEB32 vector (Xie et al., 2014). 5 μL of the ligation product was transformed into *E. coli* DH5α competent cells by heat shock at 42°C. 500 μL of LB medium was added to the transformed *E. coli*, and the cells were incubated at 37°C for 1 hour at 180 rpm. The cells were then plated onto LB solid medium containing 25 mg / L kanamycin and cultured overnight. Positive clones were obtained, and single colonies were picked and propagated in LB liquid medium containing 25 mg / L kanamycin. Recombinant plasmid DNA was extracted using a standard plasmid extraction kit (Fuji Universal Plasmid Mini-Extraction Kit), and the recombinant expression vector was confirmed by sequencing. After sequencing verification (Xie et al., 2014), the pRGEB32-OsARF1 plasmid was successfully constructed.

[0060] The pRGEB32-OsARF1 plasmid was transformed into Agrobacterium tumefaciens EHA105, and the specific steps are as follows:

[0061] 200 ng of pRGEB32-OsARF1 plasmid was added to 50 μL of Agrobacterium EHA105 competent cells. The cells were incubated on ice for 5 min, in liquid nitrogen for 5 min, at 37℃ for 5 min, at 200 rpm, and at 28℃ for 2 hours. The resulting cells were then spread onto LB solid medium containing 25 mg / L kanamycin and 25 mg / L rifampin to obtain Agrobacterium carrying the recombinant expression plasmid, which was named GV3101-pRGEB32-OsARF1.

[0062] GV3101-pRGEB32-OsARF1 was inoculated into 3 ml of YEB liquid medium containing (Kan and Rif) antibiotics and cultured overnight at 28°C with shaking. On the second day, it was transferred to 50 ml of YEB liquid medium containing antibiotics at a 1% inoculation rate and cultured with shaking at 200 rpm until OD. 600 When the concentration of Agrobacterium is approximately 0.3 to 0.6, the fresh Agrobacterium culture is centrifuged at 5000 rpm for 5 minutes, collected, and resuspended in 1 / 3 volume of AAM-AS liquid medium to obtain the Agrobacterium infection solution (OD). 600 The value is between 0.6 and 0.8; in this embodiment, OD is used. 600 (If the value is 0.8), it can be used to transform various receptor materials in rice.

[0063] This embodiment uses conventional Agrobacterium-mediated transformation methods to transform young panicle callus of rice 9522. Spikes approximately 3-5 cm in length after panicle differentiation were used for induction. Callus tissue was induced on NBD2 medium and cultured at 26±1℃ in the dark. Subculture was performed after 15 days, and the callus was ready for transformation after 8 days of culture. The callus was then immersed in Agrobacterium-mediated transformation solution (OD200). 600 The OD value ranges from 0.6 to 0.8. 600The rice material was shaken occasionally in a medium containing 0.8 g of bacterial solution. After 20 minutes, the material was removed, excess bacterial solution was blotted off on sterile filter paper, and then transferred to NBD2-AS medium for co-culturing at 26°C for 3 days. During co-culturing, acetylsyleugenol was added to the NBD2-AS medium at a concentration of 100 μM / L. After 3 days, callus tissue was removed from the co-culture medium, the embryo was cut off, and the tissue was transferred to a selection medium containing 50 mg / L hygromycin and termethin for selection culture. After 12 days, resistant callus tissue was transferred to a selection medium containing 50 mg / L hygromycin and termethin for further selection. After 12 days, the vigorously growing resistant callus tissue was transferred to differentiation medium and cultured for about two weeks (24-hour light). After the emergence of green shoots, the medium was replaced with a new differentiation medium and the differentiation culture continued until shoots emerged. The regenerated seedlings were rooted and vigorous on 1 / 2M medium and then transferred to a nutrient solution culture chamber.

[0064] Total DNA was extracted from leaves of positive plants, and sequencing was performed using identification primers (test-ARF1-F: SEQ ID NO.13 and test-ARF1-R: SEQ ID NO.14) to identify the transgenic plant arf1-1, which successfully knocked out OsARF1. This caused a mutation in the nucleotide sequence shown in SEQ ID NO.2 of a conventional rice variety to SEQ ID NO.15, and a frameshift and premature termination of the amino acid sequence shown in SEQ ID NO.1 of a conventional rice variety to SEQ ID NO.16, thus obtaining the arf1-1 mutant male-sterile rice line. arf1-1 inserts a T base in the third exon, causing a frameshift and premature termination of protein translation. Figure 1 A).

[0065] 1.2 Phenotypic analysis of the OsARF1 loss-of-function mutant arf1-1

[0066] Seeds of wild-type 9522 (WT) and the arf1-1 mutant were planted in soil columns containing different hardnesses (1.2 BD and 1.6 BD, respectively). Root growth was observed 7-10 days after planting using CT scanning. Results showed that WT rice roots grew normally in loose soil (1.2 BD), while root elongation was significantly inhibited in firm soil (1.6 BD). Figure 1 B). The root penetration ability of arrf1-1 was significantly lower than that of WT under both conditions, manifested by a decrease in principal root length (B). Figure 1 B).

[0067] Example 3: Construction of OsARF1 overexpressing plants

[0068] 1. Construction of OsARF1 overexpressing plants

[0069] 1.1 Construction of pTCK303-OsARF1 overexpression vector

[0070] S1. Amplification of the OsARF1 gene sequence: Using rice root cDNA as a template, PCR amplification was performed using primers pTCK303-OsARF1-F (SEQ ID NO. 20) and pTCK303-OsARF1-R (SEQ ID NO. 21) to obtain the PCR product of the OsARF1 gene as shown in SEQ ID NO. 2; the sequence of the rice root cDNA (EU847008);

[0071] S2, Enzyme digestion: The PCR product of the OsARF1 gene in step S1 was digested with BamHI (G / GATCC) to generate suitable sticky ends; at the same time, the pTCK303 vector (U-Bio Biotechnology, VT2119) was digested with BamHI to give it sticky ends that match the PCR product.

[0072] S3. Using an in-fusion enzyme (Shanghai Haojia Technology Development Co., Ltd., 639648), the fragments of the OsARF1 gene PCR product digested with enzymes and the fragments of the pTCK303 vector digested with enzymes were ligated together and sequenced for verification (verification method is the same as in Example 2) to obtain the pTCK303-OsARF1 plasmid.

[0073] 2. Phenotypic analysis of OsARF1 overexpressing plants

[0074] The pTCK303-OsARF1 overexpression vector was transformed into rice using Agrobacterium-mediated transformation (method as in Example 2) to obtain OsARF1 overexpressing plants (OE-ARF1). Wild-type WT (WT) and OE-ARF1 seeds (9522 variety) were planted in soil columns containing different hardnesses (1.2BD and 1.6BD, respectively). Root growth was observed after 7-10 days using CT scanning. Results showed that under loose soil conditions (1.2BD), there was no significant difference in root growth between WT and OE-ARF1. However, under firm soil conditions (1.6BD), OE-ARF1 roots exhibited significantly stronger penetration ability than WT roots. Figure 1 B).

[0075] 3. Analysis of OsARF1 gene expression patterns

[0076] Germinated WT rice seeds were planted in soils with different hardnesses (1.2 BD and 1.6 BD). Root tip samples (approximately 1.5 cm) were collected after 7-10 days of growth, and total RNA was extracted. The expression level of the OsARF1 gene was detected using real-time quantitative PCR. The results showed that the expression level of the OsARF1 gene gradually increased with increasing soil hardness, reaching its highest level in the 1.6 BD hard soil, which was 7 times higher than that in the control group. Figure 2 ).

[0077] Example 4: Study on the molecular mechanism of OsARF1 gene regulating root penetration ability in hard soil

[0078] 1. Effects of OsARF1 on downstream gene expression

[0079] RNA-seq was used to compare and analyze the root tip transcriptomes of WT, arf1-1, and OE-ARF1 plants grown in hard soil (1.6 BD). The results showed that the gene OsCESA6, associated with primary cell wall cellulose synthesis, was upregulated in arf1-1 but downregulated in OE-ARF1. This result was further validated by real-time quantitative PCR. Figure 3 ).

[0080] 2. Effects of OsARF1 on the cell wall of the root cortex

[0081] Root tips from WT, arf1-1, and OE-ARF1 plants grown in loose (1.2 BD) and hard (1.6 BD) soils were fixed in glutaraldehyde and osmium tetroxide, then embedded in resin, and ultrathin sections were prepared and stained. Transmission electron microscopy was used to observe the cortical cell wall structure of the root tips. The results showed that, compared with WT, the cortical cell walls of arf1-1 were significantly thicker, while those of OE-ARF1 were thinner.

[0082] 3. Effects of OsARF1 on root morphology

[0083] Root tips of WT, arf1-1, and OE-ARF1 plants grown in loose (1.2 BD) and hard (1.6 BD) soils were stained with 10 μM PI, then fixed in 5% low-melting-point agar. Sections with a thickness of 50 μM were prepared using a vibratory microtome, and root diameters were observed under an SP5 confocal microscope. Results showed that hard soil induced an increase in WT root diameter, while the root diameter of arf1-1 was not induced by soil hardness, and its root diameter was significantly smaller than that of WT in hard soil. Conversely, the root diameter of OE-ARF1 was significantly larger than that of WT in loose soil. Figure 4 ).

[0084] In summary, this invention reveals that the OsARF1 gene influences the synthesis and thickening of the cell wall in the root cortex of rice by regulating the expression of the downstream OsCESA6 gene, thereby regulating root morphology and the ability to penetrate hard soil. Under hard soil conditions, the upregulation of the OsARF1 gene inhibits the expression of OsCESA6, reducing cellulose synthesis and cell wall thickening in the cortex, promoting root thickening, and enhancing the root's ability to penetrate hard soil. This invention provides an important theoretical basis for breeding new rice varieties adapted to hard soil growth.

[0085] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. The application of the OsARF1 gene in regulating the ability of rice roots to penetrate hard soil, characterized by, The amino acid sequence encoded by the gene OsARF1 is shown in SEQ ID No.

2.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the gene OsARF1 is shown in SEQ ID No.

1.

3. The application according to claim 1, characterized in that, The application involves overexpressing the OsARF1 gene in rice to obtain rice varieties with enhanced root penetration ability in hard soil.

4. The application according to claim 1, characterized in that, The rice variety in question is Wuyujing 7, a japonica rice variety.

5. A recombinant expression vector comprising the gene OsARF1, characterized in that, The amino acid sequence encoded by the OsARF1 gene is shown in SEQ ID No. 2; And / or, the nucleotide sequence of the gene OsARF1 is as shown in SEQ ID No.

1.

6. A method for constructing a recombinant expression vector, characterized in that, Includes the following steps: S1. Amplification of the OsARF1 gene sequence: Using rice root cDNA as a template, PCR amplification was performed to obtain the PCR product of the OsARF1 gene as shown in SEQ ID NO.2; S2, Enzyme digestion: The PCR product of the OsARF1 gene in step S1 is digested with enzymes to generate suitable sticky ends; the pTCK303 vector is digested with enzymes to give it sticky ends that match the PCR product. S3. Using in-fusion enzyme, the fragments of the PCR product of the OsARF1 gene digested with enzyme and the fragments of the pTCK303 vector digested with enzyme were ligated together. After sequencing verification, the pTCK303-OsARF1 plasmid was obtained.

7. The method for constructing the recombinant expression vector according to claim 6, characterized in that, In step S1, the primer sequences for PCR amplification are as described in SEQ ID No. 3 and SEQ ID No.

4.

8. The method for constructing the recombinant expression vector according to claim 6, characterized in that, In S2, BamHI was used to digest the PCR product of the OsARF1 gene and the pTCK303 vector.

9. A method for regulating rice root morphology, characterized in that, Root thickening is promoted by downregulating the expression of the OsCESA6 gene by upregulating the expression of the OsARF1 gene; the amino acid sequence encoded by the OsARF1 gene is shown in SEQ ID No. 2; and / or, the nucleotide sequence of the OsARF1 gene is shown in SEQ ID No.

1.

10. The method for regulating rice root morphology according to claim 9, characterized in that, The regulation mentioned is a positive regulation.

Images