Application of PHR2 in regulation and control of nodulation and nitrogen fixation process of leguminous plants under phosphorus starvation stress
By knocking out or inhibiting the expression of the PHR2 gene, the problem of suppressed root nodule symbiosis and nitrogen fixation in legumes under phosphorus starvation conditions was solved, thereby improving the nitrogen fixation capacity and growth performance of plants, reducing fertilizer use, and lowering agricultural production costs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2026-01-21
- Publication Date
- 2026-05-08
AI Technical Summary
Under phosphorus-starved conditions, root nodule symbiosis and nitrogen fixation in legumes are inhibited, leading to insufficient nitrogen supply and affecting plant growth and development. Existing technologies have not been able to effectively solve the problem of plant tolerance under nitrogen and phosphorus starvation.
By knocking out or inhibiting the expression of the PHR2 gene in the plant genome, the activity or content of the PHR2 protein can be reduced, thereby promoting root nodule formation and nitrogen fixation in legumes under phosphorus starvation stress. This can be achieved by using gene knockout, gene silencing, CRISPR-Cas technology, and other methods to enhance nitrogenase activity in legumes.
It improves the nitrogen-fixing capacity of legumes under phosphorus-starved conditions, reduces dependence on phosphate and nitrogen fertilizers, lowers agricultural production costs, and enhances the tolerance of plants under nitrogen and phosphorus-starved conditions.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to the application of PHR2 in regulating the nodulation and nitrogen fixation process in legumes under phosphorus starvation stress. Background Technology
[0002] Nitrogen, an essential nutrient for plant growth and development, is a crucial component of plant organisms and directly participates in numerous physiological and biochemical processes. Under nitrogen-deficient conditions, plants exhibit symptoms such as yellowing leaves and slow growth. In agricultural production, insufficient nitrogen in the soil is a significant factor limiting crop yields. To ensure crop yields, large amounts of chemical fertilizers are often applied. The excessive use of chemical fertilizers not only increases agricultural production costs but also leaves fertilizer residues in the soil, significantly impacting soil and the environment.
[0003] To address nitrogen deficiency in soil, legumes such as soybeans and alfalfa can form symbiotic relationships with rhizobia in the soil, creating specific organs called root nodules. The rhizobia colonizing these nodules convert atmospheric nitrogen into ammonia, which is then absorbed and utilized by the plants—a process known as biological nitrogen fixation. Biological nitrogen fixation requires a significant amount of energy, thus necessitating a large supply of phosphorus from the plants. However, under natural conditions, most phosphorus in the soil forms insoluble salts with metal ions, reducing its solubility and mobility, hindering the effective utilization of phosphorus by plants. This makes phosphorus a major limiting factor for biological nitrogen fixation.
[0004] In recent years, significant progress has been made in the study of the molecular mechanisms of root nodule symbiosis establishment, but the molecular mechanisms by which plants regulate root nodule symbiosis under phosphorus starvation conditions remain unclear.
[0005] Therefore, in-depth research is needed in this field on the molecular mechanisms of root nodule symbiosis in plants under nitrogen and phosphorus starvation conditions, in order to clarify the regulatory role of the plant's nutritional status on root nodule symbiosis. Summary of the Invention
[0006] Under nitrogen and phosphorus starvation conditions, rhizobium infection and nodule formation in plants are significantly inhibited, thus affecting subsequent biological nitrogen fixation. This inhibited nitrogen fixation leads to nitrogen deficiency, further suppressing plant growth and development. Therefore, the technical problem this invention aims to solve is: how to improve the tolerance of leguminous plants to nitrogen and phosphorus starvation during interactions with rhizobia.
[0007] To address the aforementioned technical problems, the application of substances that reduce the activity or content of protein PHR2, or substances that inhibit or reduce the expression of the gene encoding protein PHR2, is provided, wherein the application is any one of the following: P1. Application in enhancing nitrogen fixation capacity of leguminous plants under phosphorus starvation stress; P2. Application in promoting nitrogen-fixing root nodule formation in leguminous plants under phosphorus starvation stress; P3. Application of increasing nitrogenase activity in root nodules of leguminous plants under phosphorus starvation stress; P4. Applications in legume breeding; The protein PHR2 may be a protein of the following types: A1), A2), or A3): A1) The amino acid sequence of this protein is SEQ ID No. 2; A2) A protein derived from A1) or having more than 80% identity with and the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in A1). A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) and A2).
[0008] In the above applications, the protein PHR2 can be derived from alfalfa (Alfalfa fasciata). Medicago littoralis ).
[0009] In the above applications, the gene encoding the protein PHR2 can be a DNA molecule as shown in a1), a2), or a3) below: a1) The coding sequence is the DNA molecule shown in SEQ ID No. 1 of the sequence listing; a2) has 90% or more identity with the nucleotide sequence defined by a1) and encodes a DNA molecule that encodes the protein PHR2 described above; a3) hybridizes under strict conditions to the nucleotide sequence defined by a1) or a2) and encodes the DNA molecule that encodes the protein PHR2 described above.
[0010] The term "identity" refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences. Having 90% or more identity can mean at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity.
[0011] In the above applications, the substance that reduces the activity or content of protein PHR2 may be a substance that knocks out the gene encoding protein PHR2, and / or a substance that inhibits or reduces the expression of the gene encoding protein PHR2.
[0012] In the above applications, inhibiting or reducing the expression of the gene encoding the protein PHR2 can be achieved by gene knockout or gene silencing.
[0013] Gene knockout refers to the process of making a specific target gene lose its function by altering its DNA sequence.
[0014] Gene silencing refers to the phenomenon of preventing or reducing the expression of a gene without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA, including antisense RNA, co-suppression, quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.
[0015] In the above applications, the substance that inhibits or reduces the expression of the gene encoding the protein PHR2 can be a reagent that inhibits or reduces the expression of the gene. The reagent that inhibits or reduces the expression of the gene can be a gene knockout reagent, such as a reagent that knocks out the gene through homologous recombination or a reagent that knocks out the gene through CRISPR-Cas. The reagent that inhibits or reduces the expression of the gene can contain a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.
[0016] In the above applications, the substance that reduces the activity or content of protein PHR2, or the substance that inhibits or reduces the expression of the gene encoding protein PHR2, can be any one of the following c1)-c4): c1) Nucleic acid molecules that inhibit or reduce the expression of the PHR2 gene encoding the protein; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3).
[0017] c1) The nucleic acid molecule mentioned is a nucleic acid molecule that targets the PHR2 protein encoding gene.
[0018] In the above applications, the legume breeding refers to the selection of legume varieties with strong nitrogen-fixing ability under phosphorus starvation stress.
[0019] In the above applications, the legume is preferably alfalfa, and more preferably alfalfa tribulus. Medicago truncatula ) or string alfalfa ( Medicago littoralis ).
[0020] To address the aforementioned technical problems, the present invention also provides a method for enhancing the nitrogen fixation capacity of legumes under phosphorus starvation stress, comprising enhancing the nitrogen fixation capacity of legumes under phosphorus starvation stress by inhibiting or reducing the expression level of the gene encoding the protein PHR2 in the plant genome.
[0021] To address the aforementioned technical problems, the present invention also provides a method for promoting the formation of nitrogen-fixing root nodules in legumes under phosphorus starvation stress, comprising promoting the formation of nitrogen-fixing root nodules in legumes under phosphorus starvation stress by inhibiting or reducing the expression level of the gene encoding the protein PHR2 in the plant genome.
[0022] To address the aforementioned technical problems, the present invention also provides a method for improving the nitrogenase activity in leguminous root nodules under phosphorus starvation stress, comprising improving the nitrogenase activity in leguminous root nodules under phosphorus starvation stress by inhibiting or reducing the expression level of the gene encoding the protein PHR2 in the plant genome.
[0023] In the above method, the legume is preferably alfalfa, and more preferably alfalfa tribulus. Medicago truncatula ) or string alfalfa ( Medicago littoralis ).
[0024] The above-mentioned inhibition or reduction of the expression level of the gene encoding the protein PHR2 in the plant genome can be achieved by any means in the prior art, so as to induce deletion mutations, insertion mutations or base transformation mutations in the gene, thereby reducing or losing gene function. Specifically, this can be achieved by chemical mutagenesis, physical mutagenesis, RNAi, site-directed genome editing or homologous recombination, etc.
[0025] The above-mentioned inhibition or reduction of the expression level of the gene encoding the protein PHR2 in the plant genome can be achieved by inserting a tobacco retrotransposon into the gene encoding the protein PHR2. Tnt1 The method led to PHR2 Frameshift mutations lead to PHR2 Loss of gene function, thereby achieving PHR2 Gene knockout.
[0026] The method described above may include introducing into the plant a substance that reduces or inhibits the activity of the protein PHR2 described above, or introducing a substance that reduces or inhibits the expression of the gene encoding the protein PHR2. The substance that reduces or inhibits the activity of the protein PHR2 described above, or the substance that reduces or inhibits the expression of the gene encoding the protein PHR2, may be any one of the following c1)-c4): c1) Nucleic acid molecules that inhibit or reduce the expression of the protein PHR2 encoding gene mentioned above; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3).
[0027] c1) The nucleic acid molecule mentioned is a nucleic acid molecule that targets the PHR2 protein encoding gene.
[0028] In agricultural production, legumes can establish a nitrogen-fixing symbiotic relationship with rhizobia in the soil, converting atmospheric nitrogen into ammonia to meet their needs. This reduces the plant's dependence on nitrogen fertilizer to some extent. However, since biological nitrogen fixation requires a large amount of energy, it can only proceed smoothly under conditions of sufficient phosphorus supply. Therefore, phosphate fertilizers are still needed to ensure crop yield. Excessive application of phosphate fertilizers can also have serious impacts on the soil environment. This study found that knocking out… PHR2 Genes can enhance the nitrogen-fixing capacity of legumes under nitrogen and phosphorus starvation conditions. These findings could help reduce the application of phosphorus and nitrogen fertilizers in the cultivation of legumes such as soybeans and alfalfa, thereby lowering agricultural production costs. Attached Figure Description
[0029] Figure 1 The mutant in Example 1 of this invention phr2 tobacco retrotransposon Tnt1 exist PHR2 The insertion site of the gene, related PCR identification results, and PHR2 Results of gene expression level detection. Figure 1 A is PHR2 A schematic diagram of the gene structure, and mutants. phr2 tobacco retrotransposon Tnt1 exist PHR2 The insertion site of the gene. Figure 1 B is a homozygous mutant. phr2 The PCR identification results. Figure 1 C represents fern-like alfalfa ( Medicago littoralis Wild-type R108 and mutantphr2 Under phosphorus-sufficient (+Pi, 500 μM KH2PO4) and phosphorus-starved (-Pi, 0 μM KH2PO4) conditions PHR2 Gene expression levels. Different letters represent significant differences; the analysis of differences used univariate variable analysis. P <0.05.
[0030] Figure 2 The mutant in Example 1 of this invention phr2 The root nodule phenotypes of wild-type R108 under phosphorus-sufficient (+Pi, 500 μM KH2PO4) and phosphorus-starved (-Pi, 0 μM KH2PO4) conditions.
[0031] Figure 3 The mutant in Example 1 of this invention phr2 The statistical results of root nodule number in wild-type R108 under phosphorus-sufficient (+Pi, 500 μM KH2PO4) and phosphorus-starved (-Pi, 0 μM KH2PO4) conditions were presented. Different letters represent significant differences, and univariate analysis was used for the analysis of differences. P <0.05.
[0032] Figure 4 The mutant in Example 1 of this invention phr2 Nitrogenase activity in root nodules of wild-type R108 and control plants under phosphorus-sufficient (+Pi, 500 μM KH2PO4) and phosphorus-starved (-Pi, 0 μM KH2PO4) conditions was measured. Different letters represent significant differences. One-way variable analysis was used for the analysis of differences. P <0.05.
[0033] Figure 5 In Embodiment 1 of the present invention phr2 Mutants expressed PHR2 The effects of genetic modification. Among them, Figure 5 A represents the phosphorus-starved condition. phr2 Rotation in mutants PHR2 The gene exhibits a brown tumor phenotype similar to that of the wild type. Figure 5 B represents the results of RT-qPCR analysis. phr2 Rotation in mutants PHR2 In the transgenic positive roots of the gene PHR2 Gene expression was restored to wild-type levels. Figure 5 C represents the statistical results of the number of root nodules. In the figure, transformation... pPHR2 :: PHR2-3 × FLAG carrier phr2 The mutant plant was labeled as pPHR2 :: PHR2-3 ×FLAG ( phr2 ), converting an empty vector (EV) phr2 The mutant plant was labeled EV ( phr2 Wild-type plants transformed with empty vectors are labeled EV (R108), phosphorus-starved conditions are labeled -Pi, and phosphorus-sufficient conditions are labeled +Pi. Detailed Implementation
[0034] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0035] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0036] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.
[0037] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.
[0038] In the following examples, clover R108 has been described in the literature "Two complete telomere-to-telomeregenome assemblies of Medicago As described in "Molecular Plant 18, 1409–1412, 2025", the public can obtain the experiments described in this application from the applicant to replicate the landscape and evolution of its centromeres.
[0039] In the following examples, mutant NF17945 (hereinafter referred to as...) phr2The original mutant is described in the literature “Wang, P., Zhong, Y., Li, Y., Zhu, W., Zhang, Y., Li, J., Chen, Z. and Limpens, E. (2024), The phosphate starvation response regulator PHR2 antagonizes arbusculemaintenance in Medicago. New Phytol, 244: 1979-1993. https: / / doi.org / 10.1111 / nph.19869”, donated by Peng Wang of Hunan Normal University. The original mutant is from the Noble Foundation Tnt1 database (https: / / medicago-mutant.dasnr.okstate.edu / mutant / index.php), which is available to the public from the applicant for replicating the experiments described in this application.
[0040] In the following examples, rhizobia Sinorhizobium meliloti 1021 has been discussed in the literature "D. Capela, F. Barloy-Hubler, M. Gatius, J. Gouzy, & F. Galibert, A high-density physical map of Sinorhizobium meliloti 1021 chromosome derived from bacterial artificialchromosome library, Proc. Natl. Acad. Sci. USA 96 (16) 9357-9362, https: / / doi.org / 10.1073 / pnas.96.16.9357 (1999). The public can obtain the experiments to replicate this application from the applicant.
[0041] Example 1 A gene associated with nodulation and nitrogen fixation in legumes under nitrogen and phosphorus starvation conditions has been identified. PHR2 From clover ( Medicago littoralis The gene was cloned in R108. PHR2The genome sequence is shown in SEQ ID No. 3, where positions 1-1311 are 5'-UTR, positions 1312-1704 are exon 1, positions 2146-2350 are exon 2, positions 2434-2510 are exon 3, positions 2602-2641 are exon 4, positions 3058-3115 are exon 5, positions 3444-3513 are exon 6, positions 3651-3974 are exon 7, and positions 3975-4347 are 3'-UTR. PHR2 The gene coding region sequence is shown in SEQ ID No. 1, encoding the PHR2 protein, and the amino acid sequence of the PHR2 protein is shown in SEQ ID No. 2.
[0042] SEQ ID No. 1: SEQ ID No.2: MSSSIPSSSMQAASINSNIRSVGHMFSTPSEQPDNVHFSSASEIHSMTFPQESDVMSWGTDPFEDILQFPDNVPTQNDHVEYNGSEVLGGNAKTTDFKEWVDQLMSVDDDSIQPNWNELLGDNNMAEPKSQDAQMSPSLLMQETQVSQQQYIPSLPSKEVNDLPNSSVSTTSQSKPRMRWTPELHEAFVEAVNQLGGSEKATPKGVLNLMKVEGLTIYHVKSHLQKYRTARYKPESSEGIPEKKLTSIDEMPSIDLKTPKGITEALRLQMELQKRLHEQLEIQRNLQIQIENQGKHLQMMFEQQMKSDEPSAPLSSVAVPSPVENLENTNEGHEKIGINGSASENMPEGSSQNTSTEQKGDDAKATGELELGEDQLTAPPTKRVKTDK SEQ ID No.3: 1. Knockout PHR2 Acquisition of mutant materials To verify PHR2 The inventors obtained the gene function using alfalfa R108 as the genetic background. Tnt1 Insertion mutant NF17945, hereinafter referred to as phr2 This was a gift from Wang Peng of Hunan Normal University. The mutant is... PHR2 A tobacco retrotransposon was inserted into the first exon of the gene. Tnt1 The specific insertion position is between positions 1386 and 1387 of SEQ ID No. 3, resulting in PHR2 A frameshift mutation in the gene causes premature termination of transcription and shortening of the protein sequence, making it impossible to obtain the protein PHR2 with the amino acid sequence SEQ ID No. 2, ultimately leading to... PHR2 Loss of function, thereby achieving PHR2 Gene knockout. PHR2 Gene structure diagram, and phr2 In mutants Tnt1 exist PHR2 See the diagram illustrating the gene insertion site. Figure 1 A.
[0043] by phr2 Using the mutant's genomic DNA as a template and wild-type R108 as a control, PCR identification was performed using primer pair 1 (phr2-F / phr2-R) and primer pair 2 (Tnt1-F / phr2-R), respectively. The detection results are as follows: Figure 1 As shown in B, phr2 In mutants PHR2 Existing at the gene site Tnt1 Insertion, resulting in PHR2 Functional deficiency, thereby achieving the goal of PHR2 Gene knockout. The specific primer sequences are as follows: phr2-F:TAGCAATAGAGGTGTCCTGT phr2-R: CCAAGACTTCAGAACCATTGT Tnt1-F: TCTTGTTGGATTGGTAGCC 2. Treatment with different phosphorus concentrations The mutants were planted under phosphorus-sufficient (+Pi, 500 μM KH2PO4) and phosphorus-starved (-Pi, 0 μM KH2PO4, with KCl replaced by equimolar concentrations of KCl) conditions, respectively. phr2 Wild-type R108 was used as a control. Details are as follows: Wild-type R108 and mutant R108 stored at 4°C for 3 days phr2After growing for 7 days on phosphorus-sufficient and phosphorus-starved BNM media, the seeds were transferred to freshly prepared phosphorus-sufficient and phosphorus-starved BNM media and inoculated with rhizobia. Sinorhizobium meliloti 1021 ( Sm 1021, OD 600 =0.02), after culturing for 21 days, the root nodule phenotype was observed and the number of root nodules was counted.
[0044] The formulations for phosphorus-sufficient BNM solid culture medium are shown in Tables 1 and 2: Table 1. Preparation of phosphorus-sufficient BNM medium stock solution (200 ×)
[0045] Table 2. Preparation of phosphorus-sufficient BNM liquid medium (1 L)
[0046] The pH of the culture medium was adjusted to 6.0 using 1 M KOH. The preparation method of BNM solid culture medium was as follows: 1 L of BNM liquid culture medium was supplemented with 11.5 g of plant gel (phytagel), sterilized in an autoclave at 121℃ for 20 min, poured into sterile petri dishes, and solidified to prepare sterile BNM solid culture medium.
[0047] Preparation method of phosphorus-starved BNM solid medium: The preparation method of phosphorus-sufficient BNM medium is the same as that of phosphorus-sufficient BNM medium. Replace 6.8 g KH2PO4 in stock solution 1 with 3.725 g KCl, and keep the other components unchanged.
[0048] Three replicates, with 10 plants per replicate line.
[0049] 2.1 Gene Expression Level Detection Wild-type R108 and mutant R108 were detected and analyzed using RT-qPCR. phr2 Under phosphorus-sufficient (+Pi, 500 μM KH2PO4) and phosphorus-starved (-Pi, 0 μM KH2PO4) conditions, rhizobia were inoculated. Sm 1021 days later, in the root nodule PHR2 Relative gene expression levels were determined using primers RT-MtPHR2-F and RT-MtPHR2-R. RT-MtPHR2-F: CATCTTCCTCGATGCAGGCT; RT-MtPHR2-R: TGGATCAGTTCCCCAGGACA.
[0050] Internal reference gene is MtACTIN2The primers targeting the internal reference gene are RT-ACTIN2-F and RT-ACTIN2-R: RT-ACTIN2-F: TCAATGTGCCTGCCATGTATGT; RT-ACTIN2-R: ACTCACACCGTCACCAGAATCC.
[0051] See results Figure 1 C, the results indicate that in the mutant phr2 No detection was found in the middle. PHR2 Gene expression indicates mutants phr2 middle PHR2 The gene was indeed knocked out.
[0052] 2.2 Root nodule phenotype Analysis of wild-type R108 and mutant R108 under phosphorus-sufficient (+Pi, 500 μM KH2PO4) and phosphorus-starved (-Pi, 0 μM KH2PO4) conditions. phr2 Root nodule phenotype, inoculated with rhizobia Sm After 1021 days, the specific phenotypes at 21 days of total culture are shown in [the original text]. Figure 2 The results showed that under sufficient phosphorus conditions, wild-type R108 and mutant R108... phr2 There was no significant difference in nitrogenase activity in root nodules. Under phosphorus starvation conditions, wild-type R108 root nodules were brown, with significantly reduced nitrogenase activity; while mutant nodules showed significantly lower nitrogenase activity. phr2 The root nodules are pink, and their nitrogenase activity is significantly higher than that of the wild type.
[0053] Under phosphorus-sufficient (+Pi, 500 μM KH2PO4) and phosphorus-starved (-Pi, 0 μM KH2PO4) conditions, the effects on wild-type R108 and mutant R108 were investigated. phr2 Inoculation with rhizobia Sm The number of root nodules generated after 21 days of cultivation following 1021 days was statistically analyzed. Results are shown below. Figure 3 The results showed that under sufficient phosphorus conditions, wild-type R108 and mutant R108... phr2 Neither produced brown root nodules, and there was no significant difference in the number of pink and white root nodules produced by either strain. Under phosphorus starvation conditions, the wild-type R108 produced a significantly reduced number of pink root nodules and a significantly increased number of brown root nodules; while the mutant... phr2 The number of pink and white root nodules produced increased significantly, while brown root nodules were not produced.
[0054] 2.3 Nitrogenase activity in root nodules Wild-type R108 and mutant R108 were tested under phosphorus-sufficient (+Pi, 500 μM KH2PO4) and phosphorus-starved (-Pi, 0 μM KH2PO4) conditions. phr2Inoculation with rhizobia Sm Nitrogenase activity in root nodules after 21 days (1021 days) See results Figure 4 The results of the study indicate that the mutant phr2 Nitrogenase activity in root nodules was significantly increased under phosphorus starvation conditions compared to wild-type R108.
[0055] 3 turns PHR2 Effect The rooting experiment was used to compare wild-type and mutant strains. phr2 An instantaneous conversion experiment was conducted, as detailed below: Using pL1V-R2 as the starting vector, the vector was constructed using the Golden Gate cloning method [construction method references "Doreen Feike, Andrey V. Korolev, Eleni Soumpourou1, Eiichi Murakami, Dugald Reid, Andrew Breakspear, Christian Rogers, Simona Radutoiu, Jens Stougaard, Wendy A. Harwood, Giles ED Oldroyd, J. Benjamin Miller. Characterizing standard genetic parts and establishing common principles for engineering legume and cereal roots. Plant Biotechnology Journal (2019) 17, pp. 2234–2245" and "Standards for plant synthetic biology: a common syntax for exchange of DNAparts. New Phytologist (2015) 208: 13–19."]. PHR2 Gene expression vector pPHR2 :: PHR2-3 × FLAG This recombinant expression vector pPHR2 :: PHR2-3 × FLAG The nucleotide sequence is 13651 bp, as shown in SEQ ID No. 4 and SEQ ID No. 5 (the next position after position 12000 in SEQ ID No. 4 is position 1 in SEQ ID No. 5), containing fern shoots ( Medicago littoralis In the genome PHR2Upstream of genes includes PHR2 Nucleic acid sequences including gene promoters (as shown in positions 5076-7871 of SEQ ID No. 4) and PHR2 The gene coding region sequence (such as positions 7879-9036 of SEQ ID No. 4, which is the same as positions 7-1164 of SEQ ID No. 1) expresses the PHR2 protein with the amino acid sequence shown in SEQ ID No. 2.
[0056] SEQ ID No.4: SEQ ID No.5 expression carrier pPHR2::PHR2-3 × FLAG Through Agrobacterium rhizogenes ( Agrobacterium rhizogenes The mutant was mediated by strain AR.Qua1 (commercially available) phr2 Hairy root transformation was performed using wild-type R108 and mutants. phr2 pL1V-R2 was used as a control for empty vector transformation.
[0057] The transformed plants were grown in vermiculite for 28 days and then subjected to phosphorus starvation (-Pi, 0 μM KH2PO4) treatment (irrigated with phosphorus-starved BNM liquid medium). Positive roots were detected using mCherry assays [positive roots were labeled as...]. pPHR2 :: PHR2-3 × FLAG ( phr2 RT-qPCR analysis was used to determine the positive roots. PHR2 Gene expression levels have been restored, and the nodulation phenotype of positive roots has been statistically analyzed, with the wild-type R108 transgenic empty vector phenotype under phosphorus-sufficient conditions (irrigated with phosphorus-sufficient BNM liquid medium) serving as a control.
[0058] Found in mutants phr2 Slewing PHR2 It can restore the brown tumor phenotype of wild-type R108 under phosphorus starvation stress, see details. Figure 5 This indicates that it is indeed true. PHR2 Gene knockout resulted in wild-type R108 and mutant R108. phr2 Phenotypic changes in root nodules.
[0059] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The application of a substance that reduces the activity or content of protein PHR2, or a substance that inhibits or reduces the expression of the gene encoding said protein PHR2, characterized in that: The application is any one of the following: P1. Application in enhancing nitrogen fixation capacity of leguminous plants under phosphorus starvation stress; P2. Application in promoting nitrogen-fixing root nodule formation in leguminous plants under phosphorus starvation stress; P3. Application of increasing nitrogenase activity in root nodules of leguminous plants under phosphorus starvation stress; P4. Applications in legume breeding; The protein PHR2 is a protein that is, as shown in A1), A2), or A3): A1) The amino acid sequence of this protein is SEQ ID No. 2; A2) A protein derived from A1) or having more than 80% identity with and the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in A1). A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) and A2).
2. The application according to claim 1, characterized in that: The gene encoding the protein PHR2 is a DNA molecule as shown in a1), a2), or a3) below: a1) The coding sequence is the DNA molecule shown in SEQ ID No. 1 of the sequence listing; a2) has 90% or more identity with the nucleotide sequence defined in a1), and is a DNA molecule encoding the protein PHR2; a3) hybridizes under stringent conditions to the nucleotide sequence defined by a1) or a2) and is a DNA molecule encoding the protein PHR2.
3. The application according to any one of claims 1-2, characterized in that: A substance that reduces the activity or content of protein PHR2, or a substance that inhibits or reduces the expression of the gene encoding said protein PHR2, is any one of the following c1)-c4): c1) Nucleic acid molecules that inhibit or reduce the expression of the PHR2 protein-encoding gene; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3).
4. The application according to claim 3, characterized in that: c1) The nucleic acid molecule described is a nucleic acid molecule that targets the PHR2 encoding gene of any one of the proteins described in claims 1-3.
5. The application according to any one of claims 1-4, characterized in that: The legume in question is alfalfa.
6. The application according to any one of claims 5, characterized in that: The legume mentioned is alfalfa (Tribulus terrestris). Medicago truncatula ) or string alfalfa ( Medicago littoralis ).
7. A method for enhancing the nitrogen-fixing capacity of leguminous plants under phosphorus starvation stress, characterized in that: This includes enhancing the nitrogen fixation capacity of leguminous plants under phosphorus starvation stress by inhibiting or reducing the expression level of the gene encoding the protein PHR2 of claim 1 in the plant genome.
8. A method for promoting the formation of nitrogen-fixing root nodules in leguminous plants under phosphorus starvation stress, characterized in that: This includes promoting the formation of nitrogen-fixing root nodules in leguminous plants under phosphorus starvation stress by inhibiting or reducing the expression level of the gene encoding the protein PHR2 of claim 1 in the plant genome.
9. A method for increasing the nitrogenase activity in root nodules of leguminous plants under phosphorus starvation stress, characterized in that: This includes increasing nitrogenase activity in root nodules of leguminous plants under phosphorus starvation stress by inhibiting or reducing the expression level of the gene encoding the protein PHR2 of claim 1 in the plant genome.
10. The method according to any one of claims 7-9, characterized in that: The method includes introducing into the plant a substance that reduces the activity or content of the protein PHR2 of claim 1, or introducing a substance that reduces the expression of the gene encoding the protein PHR2 of claim 1; the substance that reduces the activity or content of the protein PHR2 of claim 1, or the substance that reduces the expression of the gene encoding the protein PHR2 of claim 1, is any one of the following c1)-c4): c1) Nucleic acid molecules that inhibit or reduce the expression of the PHR2 gene encoding the protein; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3).