Rice Sdd7-CGBE base editor and application thereof
By introducing the Sdd7-CGBE base editor into rice and utilizing the combined functions of Sdd7 and coUNG, efficient CG base transversion was achieved, solving the problems of low efficiency and numerous by-products of traditional CGBEs in rice, and reducing indels and bystander effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
- Filing Date
- 2026-02-04
- Publication Date
- 2026-05-08
AI Technical Summary
Traditional CGBEs in rice suffer from low efficiency, numerous byproducts, and safety concerns, making it difficult to achieve efficient C→G base transversion and reduce indels and bystander effects.
Using the rice Sdd7-CGBE base editor, an Sdd7-CGBE base editor was formed by importing sgRNA expression cassette, Cas9 protein, cytosine deaminase Sdd7 gene, and uracil DNA glycosylase coUNG. Taking advantage of the high efficiency of Sdd7 deamination activity and the uracil excision function of coUNG, combined with nSpCas9 guidance, CG transversion was performed at specific sites.
In rice, CG transversion efficiency of over 40% and byproducts of less than 5% were achieved, which is significantly better than traditional tools and reduces indels and bystander effects.
Smart Images
Figure CN121992018A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural technology, specifically to a rice Sdd7-CGBE base editor and its application. Background Technology
[0002] Base editing is a technique that enables targeted single nucleotide mutations without breaking the DNA double strand. Currently, the mainstream tools include cytosine base editors (CBEs), adenine base editors (ABEs), and guanine base editors (CGBEs). CBEs and ABEs primarily mediate conversion mutations (such as C→T or A→G), but cannot directly achieve base transversions between pyrimidine and purine (such as C→G or A→T). Research has found that removing the uracil glycosylase inhibitor (UGI) from a CBE results in C→A and C→G base transversions at some editing sites. Based on this mechanism, in 2020, several research teams modified CBEs and successfully developed the base editor GBE / CGBE, which can achieve C→G transversions in mammalian cells. CGBEs typically consist of three parts: nCas9 (D10A), cytidine deaminase, and uracil-N-glycosylase (UNG), further expanding the application scope of single-base editing tools.
[0003] However, traditional CGBEs rely on natural cytosine deaminases (such as the AID / APOBEC family), which easily activate the base excision repair pathway, leading to high-frequency indels and off-target effects. Specifically, the mechanism is as follows: UDG excises uracil (U) to form a base-free site (AP site), which, under the action of AP lyase or spontaneous breakage, forms a single-strand gap. If this gap coincides with a gap generated by nCas9 on the non-edited strand, it will trigger a DNA double-strand break, subsequently generating indels via the NHEJ repair pathway. Furthermore, CBEs also exhibit significant random DNA / RNA off-target effects, posing safety risks.
[0004] In the plant field, expanding the types of base substitutions is of great significance for germplasm resource creation. Although early systems based on the first-generation CGBE achieved C→G transversion in species such as rice, tomato, and poplar, they suffered from low efficiency and numerous byproducts, limiting their widespread application. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides a rice Sdd7-CGBE base editor and its applications. This invention forms the Sdd7-CGBE base editor by introducing an sgRNA expression cassette, Cas9 protein, the cytosine deaminase Sdd7 gene, and the uracil DNA glycosylase coUNG into a target receptor. This editor, through the efficient deamination activity of Sdd7 and the uracil excision function of coUNG, targets specific sites under the guidance of nSpCas9, inducing CG transversion while reducing indels and bystander effects.
[0006] Therefore, the present invention provides the following technical solution:
[0007] In a first aspect, the present invention provides a rice Sdd7-CGBE base editor in an optional embodiment, wherein the gene sequence of the base editor includes at least:
[0008] (1) The nucleotide sequence as shown in SEQ ID NO.1; or,
[0009] (2) A nucleotide sequence that replaces one or more nucleotide sequences in the nucleotide sequence shown in SEQ ID NO.1 and is capable of rice genome splicing; or,
[0010] (3) A nucleotide sequence in which one or more nucleotide sequences are added to the nucleotide sequence shown in SEQ ID NO.1, and which is capable of rice genome splicing; or,
[0011] (4) A nucleotide sequence that is missing one or more nucleotide sequences in the nucleotide sequence shown in SEQ ID NO.1 and is capable of rice genome splicing.
[0012] Preferably, the gene sequence of the rice Sdd7-CGBE base editor is the nucleotide sequence shown in SEQ ID NO.1.
[0013] Preferably, the rice Sdd7-CGBE base editor includes cytosine deaminase Sdd7, inactivated nSpCas9 protein, and codon-optimized uracil DNA glycosylase coUNG;
[0014] The cytosine deaminase Sdd7 is located at the 5' end of the active nSpCas9 protein, and the two are linked together by a 32aa linker.
[0015] The codon-optimized uracil DNA glycosylase coUNG is located at the 3' end of the active nSpCas9 protein, and the two are linked together by a 32aa linker.
[0016] Secondly, in an optional embodiment, the present invention provides an expression cassette comprising the aforementioned rice Sdd7-CGBE base editor.
[0017] Thirdly, in optional embodiments, the present invention provides an expression vector, including the rice Sdd7-CGBE base editor or the expression cassette described above.
[0018] Preferably, it also includes an sgRNA sequence and expression cassette adapted to the rice Sdd7-CGBE base editor.
[0019] Preferably, the nucleotide sequence of the sgRNA sequence is shown in SEQ ID NO.4.
[0020] Fourthly, in optional embodiments, the present invention provides the application of the above-mentioned rice Sdd7-CGBE base editor, the above-mentioned expression cassette, or the above-mentioned expression vector in realizing the CG inversion of rice bases.
[0021] Fifthly, in an optional embodiment, the present invention provides a method for constructing a fusion editing tool for a novel base editor system, Sdd7-CGBE, comprising the following steps:
[0022] The sgRNA expression cassette, Cas9 protein, cytosine deaminase Sdd7 gene, and uracil DNA glycosylase coUNG are introduced into the target receptor to express the sgRNA expression cassette, Cas9 protein, cytosine deaminase Sdd7, and uracil DNA glycosylase coUNG in the target receptor, thereby enabling CG base editing of the target gene in the receptor genome.
[0023] Preferably, the cytosine dehydrogenase Sdd7 gene, Cas9 protein, and uracil DNA glycosylase coUNG use the same constitutive promoter Ubiqutin and the same 35S terminator.
[0024] The sgRNA expression cassette includes: the rice OsU6 promoter, the spectinomycin resistance gene SpR, a synthetically produced sgRNA backbone sequence, and a Poly-T terminator.
[0025] Furthermore, the method also includes:
[0026] S1: Synthesize fragments containing the adenine deaminase Sdd7 gene, uracil DNA glycosylase coUNG, and nSpCas9 gene, respectively;
[0027] S2: The synthesized adenine deaminase Sdd7 gene fragment, uracil DNA glycosylase coUNG gene fragment, and nSpCas9 gene fragment were subjected to PCR amplification and purification to obtain the PCR products of Sdd7, coUNG, and nSpCas9.
[0028] S3: Homologous recombination ligation of the PCR products of Sdd7, coUNG and nSpCas9 was performed using the T vector to obtain the T-Sdd7-nSpCas9-coUNG gene;
[0029] S4: PstI / SacI restriction sites were added to both ends of the T-Sdd7-nSpCas9-coUNG gene. The Sdd7-nSpCas9-coUNG gene fragment was digested with PstI / SacI and recovered. The plant intermediate vector pHUC400 was digested with PstI / SacI and recovered. The gene sequence Sdd7-nSpCas9-coUNG was ligated into the intermediate vector pHUC400 to obtain the plant intermediate vector pHUC400-Sdd7-nSpCas9-coUNG.
[0030] S5: The Sdd7-nSpCas9-coUNG gene fragment in the intermediate plant vector pHUC400-Sdd7-nSpCas9-coUNG was recovered, and then the plant expression vector pHUC422 was digested with HindIII and recovered. The gene fragment Sdd7-nSpCas9-coUNG was ligated into the expression vector pHUC422 to obtain the plant expression vector pHUC422-Sdd7-nSpCas9-coUNG.
[0031] S6: Using restriction enzyme sites, the target gene sequence of the plant expression vector is ligated into the plant expression vector pHUC422-Sdd7-nSpCas9-coUNG, and then the plant expression vector pHUC422-Sdd7-nSpCas9-coUNG containing the promoter and target gene sequence is introduced into the target receptor for expression.
[0032] Preferably, the cytosine dehydrogenase Sdd7 gene, Cas9 protein, and uracil DNA glycosylase coUNG use the same constitutive promoter Ubiqutin and the same 35S terminator. The sgRNA expression cassette includes: the rice OsU6 promoter, the spectinomycin resistance gene SpR, a synthetically produced sgRNA backbone sequence, and a Poly-T terminator.
[0033] Based on expression vectors, corresponding gene-targeting vectors can be constructed according to the actual needs of experiments.
[0034] Specifically, this invention provides a method for constructing a targeting vector and introducing it into cells using the pHUC422-Sdd7-nSpCas9-coUNG expression vector.
[0035] Based on the expression vector, a simple annealing, enzyme digestion, and ligation process is required to obtain a targeting vector for a specific gene. This targeting vector is then introduced into rice cells, involving the following steps:
[0036] (1) After the rice seeds are dehulled, surface disinfected with ethanol and sterilized, the embryos are separated and placed on callus induction medium for culture (about 7-10 days) to obtain secondary callus tissue.
[0037] (2) Transfer the secondary callus obtained in step (1) to fresh callus induction medium for pre-culture (about 15-20 days).
[0038] (3) Immerse the pre-cultured callus tissue from step (2) in the Agrobacterium suspension carrying the targeting vector for about 15 minutes.
[0039] (4) Transfer the callus treated with Agrobacterium in step (3) to a culture dish containing three layers of sterile filter paper, wherein 2.5 mL-3.5 mL of Agrobacterium suspension culture medium has been added to the filter paper, and co-culture at a predetermined temperature (21℃-23℃) for about 48 hours.
[0040] (5) Transfer the callus tissue after co-culture in step (4) to the pre-screening medium for culture (about 5-7 days).
[0041] (6) Transfer the callus tissue after screening and culture in step (5) to a screening medium containing screening agent and culture for a predetermined time to screen and obtain resistant callus tissue;
[0042] (7) Transfer the resistant callus obtained in step (6) to a differentiation and regeneration medium to promote its differentiation and formation of regenerated seedlings;
[0043] (8) Transfer the regenerated seedlings obtained in step (7) to a rooting medium to induce and form complete plants with roots.
[0044] In the method described above: the seeds used in step (1) are mature rice seeds; the callus induction medium used in steps (1) and (2) is the induction medium listed in Table 1; the contact operation between the callus and Agrobacterium in step (3) is completed by immersing the callus in the Agrobacterium suspension carrying the target carrier; the Agrobacterium suspension medium used in step (4) is the Agrobacterium suspension medium listed in Table 1; the pre-screening medium used in step (5) is the pre-screening medium listed in Table 1; the screening medium used in step (6) is the screening medium listed in Table 1; the differentiation and regeneration medium used in step (8) is the differentiation and regeneration medium listed in Table 1; the rooting medium used in step (8) is the rooting medium listed in Table 1; the rice is japonica rice (Oryza sativa subsp. japonica); more preferably, the japonica rice is the Nipponbare variety.
[0045]
[0046] The invented vector was constructed via conventional enzyme digestion and ligation, and adapted to an sgRNA expression cassette. Experiments demonstrated that this editor achieved a CG transversion efficiency of over 40% in rice with less than 5% byproducts, significantly outperforming traditional tools.
[0047] The nucleotide sequence of SEQ ID NO.1 is shown below:
[0048]
[0049] The nucleotide sequence of SEQ ID NO.2 is shown as follows:
[0050] ATGAGTAGCGAGACAGGTCCTGTTGCAGTTGACCCGACCCTTCGGAGAAGGATAGAGCCACACGAATTTGAAGTGTTTTTCGACCCTAGAGAACTGAGGAAGGAGACGTGCCTTCTGTACGAGATAAACTGGGGTGGTCGCCACTCTATTTGGAGGCACACTTCGCAAAACACGAACAAGCATGTGGAGGTGAACTTTATAGAAAAATTTACGACTGAGAGATACTTCTGCCCTAATACCCGGTGCTCCATCACCTGGTTCCTTAGCTGGAGCCCTTGTGGCGAATGCTCGAGGGCAATCACCGAGTTTCTGTCCAGATACCCACATGTGACGCTTTTTATATATATTGCCCGCTTGTATCACCACGCTGACCCTAGAAACCGCCAGGGTCTTCGCGATCTGATATCTTCAGGAGTTACCATCCAAATAATGACGGAACAAGAATCCGGTTACTGTTGGCGCAATTTCGTCAACTATAGCCCTTCCAATGAAGCTCATTGGCCTAGATATCCGCACCTCTGGGTCCGGCTGTATGTTCTCGAGCTTTACTGCATTATACTTGGACTTCCCCCCTGCTTGAATATTCTCCGCAGAAAGCAGCCTCAGCTTACGTTTTTTACGATTGCACTCCAAAGTTGTCATTATCAGAGACTGCCACCCCATATCTTGTGGGCTACGGGACTGAAG。
[0051] The nucleotide sequence of SEQ ID NO.3 is shown as follows:
[0052] ATGATCGGCCAGAAGACCCTGTACTCCTTCTTCTCACCATCTCCAGCAAGGAAGCGCCATGCCCCTAGCCCGGAGCCAGCCGTGCAGGGCACAGGAGTGGCCGGCGTCCCGGAGGAGTCAGGCGACGCTGCCGCCATCCCGGCCAAGAAGGCACCAGCGGGCCAGGAGGAGCCTGGCACCCCGCCATCCAGCCCGCTGAGCGCGGAGCAGCTGGATCGCATTCAGCGGAATAAGGCTGCCGCCCTCCTGAGGCTGGCGGCCCGCAACGTGCCAGTCGGCTTCGGCGAGTCATGGAAGAAGCATCTGTCTGGCGAGTTCGGCAAGCCTTACTTCATTAAGCTCATGGGCTTCGTGGCCGAGGAGAGGAAGCACTACACCGTGTACCCTCCGCCACATCAGGTCTTCACCTGGACACAGATGTGCGACATCAAGGATGTCAAGGTGGTCATTCTGGGCCAGGACCCATACCACGGCCCTAATCAGGCCCATGGCCTCTGCTTCTCCGTGCAGCGCCCGGTCCCTCCGCCACCTTCCCTGGAGAACATCTACAAGGAGCTGAGCACAGACATTGAGGATTTCGTGCACCCAGGCCATGGCGATCTGTCTGGATGGGCAAAGCAGGGAGTCCTCCTGCTCAATGCCGTGCTGACCGTCCGCGCCCACCAGGCGAACTCTCATAAGGAGCGGGGCTGGGAGCAGTTCACAGACGCCGTGGTGTCCTGGCTGAACCAGAATAGCAACGGCCTCGTGTTCCTGCTCTGGGGCTCATACGCCCAGAAGAAGGGCTCTGCGATCGATCGGAAGAGGCACCATGTGCTCCAGACAGCCCACCCTTCCCCGCTCTCAGTCTACAGGGGCTTCTTCGGCTGCCGCCATTTCTCAAAGACAAATGAGCTGCTCCAGAAGTCTGGCAAGAAGCCGATTGACTGGAAGGAACTC。
[0053] The nucleotide sequence of SEQ ID NO.4 is shown below:
[0054] GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0055] Compared with the prior art, the present invention has one of the following beneficial effects:
[0056] 1. This invention introduces an sgRNA expression cassette, Cas9 protein, cytosine deaminase Sdd7 gene, and uracil DNA glycosylase coUNG into a target receptor to form an Sdd7-CGBE base editor. This editor, through the efficient deamination activity of Sdd7 and the uracil excision function of coUNG, targets specific sites under the guidance of nSpCas9, inducing CG transversion while reducing indels and bystander effects. Attached Figure Description
[0057] Figure 1 This is a schematic diagram of the Sdd7-CGBE plant expression vector plasmid in Example 1 of the present invention;
[0058] Figure 2 The mutation of the DTH8 gene mediated by Sdd7-nSpCas9-coUNG in Example 3, with the PAM sequence being NGG;
[0059] Figure 3 To determine the efficiency of base substitution in pHUC422-Sdd7-nSpCas9-coUNG-SLR1 / PDS / TAC1 and pHUC422-APOBEC1-nSpCas9-coUNG-SLR1 / PDS / TAC in Comparative Example 1;
[0060] Figure 4 To determine the efficiency of base substitution in pHUC422-Sdd7-nSpCas9-coUNG-SLR1 / PDS / TAC1 and pHUC422-Sdd7-nSpCas9-hUNG-SLR1 / PDS / TAC in Comparative Example 2;
[0061] Figure 5 The byproduct efficiency of pHUC422-Sdd7-nSpCas9-coUNG and pHUC422-Sdd7-nSpCas9-hUNG at three target sites in Comparative Example 2 is shown. Detailed Implementation
[0062] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
[0063] Those skilled in the art can make certain equivalent modifications and obvious improvements to this invention.
[0064] Example 1
[0065] Sdd7-nSpCas9-coUNG gene splicing
[0066] The gene in this application is named Sdd7-nSpCas9-coUNG, and its sequence is shown in SEQ ID NO.1.
[0067] Sdd7, laboratory-preserved inactivated nSpCas9, and cod-derived uracil DNA glycosylase cUNG were cloned using the Gibson Assembly seamless cloning technique developed by NEB. Primers containing PstI / SacI restriction sites were designed and seamlessly ligated to the T-vector of Thürschner's gold to obtain the intermediate vector T-Sdd7-nSpCas9-coUNG (see [link to original text]). Figure 1 The specific steps are as follows:
[0068] Primers were synthesized based on the splicing order of the Sdd7, nSpCas9, and coUNG genes and the T vector sequence:
[0069] The upstream primer for the Sdd7 gene is: 5'-TTACGCCAAGCTGCCCTTGctgcagGCCACCATGAAACGCACCGCCG-3'.
[0070] The downstream primer for the Sdd7 gene is: 5'-GGACCCGCCAGATGACTCGCTCCACCATGGTCTTGCCCCT-3'.
[0071] The upstream primer for the nSpCas9 gene is: 5'-GAGTCATCTGGCGGGTCCTCCG-3'.
[0072] The downstream primer for the nSpCas9 gene is: 5'-CCCACTGCTACCGCCGGAatcgccgccgagttgtgagagg-3'.
[0073] The upstream primer for the coUNG gene is: 5'-TCCGGCGGTAGCAGTGGGGGCT-3'.
[0074] The downstream primer for the coUNG gene is: 5'-GCGAATTGAAGCTGCCCTTGGAGCTTCACACCTTCCTTTTCTTCTTC-3'.
[0075] Using the Sdd7, nSpCas9, and coUNG genes as templates, PCR amplification was performed using upstream and downstream primers, and the PCR products were recovered. The three recovered PCR products, along with the T vector fragment digested with EcoRI, were then combined according to the principle of homologous recombination to form a gene fused together with Sdd7-nSpCas9-coUNG, named T-Sdd7-nSpCas9-coUNG.
[0076] Example 2
[0077] Construction of Sdd7-nSpCas9-coUNG base editor plant targeting vector
[0078] The plasmid was extracted from *E. coli* XL-blue containing the T-Sdd7-nSpCas9-coUNG vector using the Axygen plasmid extraction kit, digested with PstI / SacI, and the Sdd7-nSpCas9-coUNG fragment was recovered. Simultaneously, pHUC SpR (laboratory-preserved) was linearized using PstI / SacI, and the pHUC400 fragment was recovered. The Sdd7-nSpCas9-coUNG and pHUC400 fragments were ligated using T4 ligase to obtain the plant intermediate expression vector pHUC-Sdd7-nSpCas9-coUNG. Further, the complex promoter expression cassette 35S-CMYLCV-SpR was introduced through the HindIII restriction site to obtain pHUC422-Sdd7-nSpCas9-coUNG. The DTH8 gene from rice was selected as the target site. The synthesized primers were annealed and ligated. The annealed product was then ligated with pHUC422-Sdd7-nSpCas9-coUNG to obtain pHUC422-Sdd7-nSpCas9-coUNG-DTH8. The plant expression vector pHUC422-Sdd7-nSpCas9-coUNG-DTH8 was transformed into Agrobacterium tumefaciens strain EHA105 (preserved by the Rice Research Institute of Anhui Academy of Agricultural Sciences) using a liquid nitrogen freeze-thaw method for genetic transformation. Target primer synthesis sequence:
[0079] DTH8 FP: TGCAGGAGCCGAAGGAGACGGTGC;
[0080] DTH8 RP: AAACGCACCGTCTCCTTCGGCTCC.
[0081] Example 3
[0082] Rice genetic transformation and the acquisition of mutants using pHUC422-Sdd7-nSpCas9-coUNG-DTH8 as the targeting vector
[0083] 1. Induction and pre-culture of mature embryonic callus
[0084] Mature seeds of Nipponbare were collected, shelled, and selected from those that were morphologically normal, clean, and free of mold. The seeds were treated with 70% ethanol and shaken for 90 seconds, then the ethanol was discarded. Subsequently, the seeds were soaked in a 50% sodium hypochlorite solution containing 1 drop of Tween 20 (the stock solution had an effective chlorine concentration ≥4%), and shaken at 180 r / min for 45 minutes in a shaker. The sodium hypochlorite solution was discarded, and the seeds were rinsed 5–10 times with sterile water until odorless. Finally, sterile water was added, and the seeds were soaked overnight at 30°C. In a clean bench, the embryos were separated along the aleurone layer using a scalpel, and inoculated onto callus induction medium (see Table 1) with the scutellum facing upwards, 12 seeds per dish, and incubated in the dark at 30°C to induce callus formation.
[0085] After approximately two weeks of culture, spherical, rough-surfaced, light yellow secondary callus tissue was selected for pre-culture. This pre-cultured tissue was then transferred to fresh induction medium and incubated in the dark at 30°C for 5 days. After the pre-culture, well-grown, vigorously dividing granular callus tissue was collected into 50 mL sterile centrifuge tubes for subsequent Agrobacterium infection.
[0086] 2. Agrobacterium culture and suspension preparation
[0087] Agrobacterium EHA105 carrying the pHUC422Sdd7-nSpCas9-coUNG-DTH8 vector was streaked onto LB agar plates containing kanamycin (50 mg / L) and rifampin (20 mg / L) and incubated in the dark at 28°C for 24 hours. Single colonies were transferred to fresh k / r LB agar plates for secondary activation and incubated in the dark at 28°C overnight. Bacterial growth was scraped off with an inoculation loop and suspended in 20–30 mL of Agrobacterium suspension medium (see Table 1), and the OD660 was adjusted to 0.10–0.25 and incubated at room temperature for at least 30 minutes.
[0088] 3. Infection and Co-cultivation
[0089] Immerse the pre-cultured callus in Agrobacterium suspension and gently agitate for 15 minutes. Discard the bacterial solution, blot off any remaining liquid with sterile filter paper, and air dry in a laminar flow hood. Add 2.5 mL of suspension culture medium to a 100×25 mm culture dish lined with three layers of sterile filter paper, evenly disperse the callus, and incubate in the dark at 23°C for 48 hours.
[0090] 4. Pre-screening and screening culture
[0091] After co-culture, the callus tissue was evenly inoculated onto the pre-selection medium (see Table 1) and cultured in the dark at 30°C for 5 days. Then, it was transferred to the selection medium, with 25 callus tissues per dish, and cultured in the dark at 30°C for 2–3 weeks. After the resistant callus tissue showed obvious growth, it entered the differentiation stage.
[0092] 5. Differentiation and regeneration
[0093] Two to three well-grown callus particles were selected from each independent transformant and inoculated into differentiation and regeneration medium (see Table 1), with five transformants inoculated per dish. The transformants were cultured at 28°C under light (photoperiod 16 h / 8 h, light intensity 3000–6000 lx) to induce shoot regeneration.
[0094] 6. Rooting and Transplanting
[0095] When the regenerated shoots grew to about 2 cm, one healthy seedling from each transformant was selected and transferred to rooting medium (see Table 1) and cultured under the same light conditions. Two weeks later, plants with well-developed root systems were selected, the medium was washed off, and they were transplanted into soil for further cultivation.
[0096] 7. Molecular identification
[0097] DNA was extracted from leaves of all 48 rice tissue culture plants using the CTAB method, and the resulting genomic DNA samples were used for PCR analysis. The PCR primers used to amplify the genomic region containing the DTH8 target site were as follows:
[0098] DTH8 CHECK FP: AGCTATGGGCACTTGCTGAGCC
[0099] DTH8 CHECK RP:CGCGGTAGCGGTTGAGGTAGGA
[0100] The amplified fragment was approximately 400 bp in size. The PCR reaction program was set as follows: 95°C pre-denaturation for 5 minutes; followed by 35 cycles, each cycle consisting of 95°C denaturation for 30 seconds, 60°C annealing for 30 seconds, 72°C extension for 30 seconds; and a final extension at 72°C for 5 minutes. After recovery, the amplified product was TA cloned with the T vector. Positive single clones were selected and sequenced using M13F primers. The sequencing results were compared with the wild-type sequence (see...). Figure 2 It was found that 23 out of 48 transgenic plants underwent CG base transversion. The results indicate that the Sdd7-nSpCas9-coUNG base editor can achieve efficient CG mutations, further enriching the plant CGBE base editing tool system.
[0101] Comparative Example 1
[0102] The SLR1, PDS, and TAC1 genes from rice were selected as target sites. Primers were synthesized, annealed, and ligated. The annealed product was then ligated with pHUC422-Sdd7-nSpCas9-coUNG to obtain pHUC422-Sdd7-nSpCas9-coUNG-SLR1 / PDS / TAC1.
[0103] Target primer synthesis sequence:
[0104] SLR1 FP: TGCACAGGTCCCCCGCCGCATGAT;
[0105] SLR1 RP: AAACATCATGCGGCGGGGGACCTG;
[0106] PDS FP: TGCACACCACCCAAAGAGCGAACA;
[0107] PDS RP: AAACTGTTCGCTCTTTTGGGTGGTG;
[0108] TAC1 FP: TGCAAAATCCCGCAAAAGGTGAAA;
[0109] TAC1 RP: AAACTTTCACCTTTTGCGGGATTT.
[0110] Using the existing pHUC422-APOBEC1-nSpCas9-coUNG vector (where the sequence of APOBEC1 is shown in SEQ ID NO. 2), SLR1, PDS, and Pid3 targets were ligated to obtain a single-base mutant pHUC422-APOBEC1-nSpCas9-coUNG-SLR1 / PDS / TAC1 vector as a control group. The results showed that the CG editing efficiency of pHUC422-Sdd7-nSpCas9-coUNG-SLR1 / PDS / TAC1 was higher than that of pHUC422-APOBEC1-nSpCas9-coUNG-SLR1 / PDS / TAC1 (see [link to original text]). Figure 3 This demonstrates that pHUC422-Sdd7-nSpCas9-coUNG can efficiently mediate CG base substitution in the rice genome.
[0111] Comparative Example 2
[0112] Using the existing pHUC422-Sdd7-nSpCas9-hUNG vector (where the sequence of hUNG is shown in SEQ ID NO.3), SLR1, PDS, and Pid3 targets were ligated to obtain a single-base mutant pHUC422-Sdd7-nSpCas9-hUNG-SLR1 / PDS / TAC1 vector as a control group. The results showed that the CG editing efficiency of pHUC422-Sdd7-nSpCas9-coUNG-SLR1 / PDS / TAC1 was similar to that of pHUC422-APOBEC1-nSpCas9-coUNG-SLR1 / PDS / TAC1 (see [link to relevant documentation]). Figure 4 However, the editing purity is low, and there are many byproducts (see...). Figure 5 These results indicate that pHUC422-Sdd7-nSpCas9-coUNG can efficiently mediate CG base substitution in the rice genome with fewer byproducts.
[0113] Although the principles of the present invention have been described in detail above with reference to preferred embodiments, those skilled in the art should understand that the above embodiments are merely illustrative explanations of the implementation of the present invention and are not intended to limit the scope of the present invention. The details in the embodiments do not constitute a limitation on the scope of the present invention. Any obvious changes, such as equivalent transformations or simple substitutions, based on the technical solutions of the present invention without departing from the spirit and scope of the present invention fall within the protection scope of the present invention.
Claims
1. A rice Sdd7-CGBE base editor, characterized in that, The gene sequence of the base editor includes at least: (1) The nucleotide sequence as shown in SEQ ID NO.1; or, (2) A nucleotide sequence that replaces one or more nucleotide sequences in the nucleotide sequence shown in SEQ ID NO.1 and is capable of rice genome splicing; or, (3) A nucleotide sequence in which one or more nucleotide sequences are added to the nucleotide sequence shown in SEQ ID NO.1, and which is capable of rice genome splicing; or, (4) A nucleotide sequence that is missing one or more nucleotide sequences in the nucleotide sequence shown in SEQ ID NO.1 and is capable of rice genome splicing.
2. The rice Sdd7-CGBE base editor according to claim 1, characterized in that, The gene sequence of the rice Sdd7-CGBE base editor is the nucleotide sequence shown in SEQ ID NO.
1.
3. The rice Sdd7-CGBE base editor according to claim 1, characterized in that, The rice Sdd7-CGBE base editor includes the cytosine deaminase Sdd7, an inactivated nSpCas9 protein, and the codon-optimized uracil DNA glycosylase coUNG. The cytosine deaminase Sdd7 is located at the 5' end of the active nSpCas9 protein, and the two are linked together by a 32aa linker. The codon-optimized uracil DNA glycosylase coUNG is located at the 3' end of the active nSpCas9 protein, and the two are linked together by a 32aa linker.
4. An expression box, characterized in that, Includes the rice Sdd7-CGBE base editor as described in any one of claims 1-3.
5. An expression carrier, characterized in that, Includes the rice Sdd7-CGBE base editor as described in any one of claims 1-3 or the expression cassette as described in claim 4.
6. The expression vector according to claim 5, characterized in that, It also includes an sgRNA sequence and expression cassette adapted to the rice Sdd7-CGBE base editor.
7. The expression vector according to claim 6, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO.
4.
8. The application of the rice Sdd7-CGBE base editor according to any one of claims 1-3, the expression cassette according to claim 4, or the expression vector according to any one of claims 5-7 in realizing the CG inversion of rice bases.
9. A method for constructing a fusion editing tool for a novel base editor system Sdd7-CGBE, characterized in that, Includes the following steps: The sgRNA expression cassette, Cas9 protein, cytosine deaminase Sdd7 gene, and uracil DNA glycosylase coUNG are introduced into the target receptor to express the sgRNA expression cassette, Cas9 protein, cytosine deaminase Sdd7, and uracil DNA glycosylase coUNG in the target receptor, thereby enabling CG base editing of the target gene in the receptor genome.
10. The method for constructing the rice base editing tool Sdd7-CGBE according to claim 7, characterized in that, The cytosine dehydrogenase Sdd7 gene, Cas9 protein, and uracil DNA glycosylase coUNG use the same constitutive promoter Ubiqutin and the same 35S terminator. The sgRNA expression cassette includes: the rice OsU6 promoter, the spectinomycin resistance gene SpR, a synthetically produced sgRNA backbone sequence, and a Poly-T terminator.