Method for transforming citrus by using drosophila Drosocin gene to induce antibacterial peptide expression to resist liberobacter asiaticum

By introducing the Drosocin gene from fruit flies into citrus and inducing the expression of antimicrobial peptides, the problems of chemical pesticide resistance and long breeding cycles in the control of Huanglongbing (HLB) in citrus have been solved, achieving green and efficient disease control and enhancing the resistance of citrus to HLB.

CN121992029APending Publication Date: 2026-05-08SOUTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-25
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing citrus Huanglongbing control technologies rely on chemical pesticides, leading to pesticide resistance and environmental pollution. Disease-resistant varieties have long breeding cycles and unstable resistance, and there is a lack of green and efficient control strategies.

Method used

By introducing the Drosocin gene from fruit flies into citrus recipient materials, the expression of Drosocin antimicrobial peptides was induced using genetic engineering techniques, thereby enhancing the resistance of citrus to Huanglongbing (HLB).

Benefits of technology

It effectively inhibits the proliferation of Clas, the pathogen of Huanglongbing in citrus, reduces the incidence of disease, avoids environmental pollution, shortens the breeding cycle, improves breeding efficiency, and has environmentally friendly and highly targeted control effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121992029A_ABST
    Figure CN121992029A_ABST
Patent Text Reader

Abstract

The invention discloses a method for transforming citrus by using a drosophila Drosocin gene to induce antibacterial peptide expression resistance to citrus huanglongbing, and relates to the technical field of forest breeding and seedling raising, the method comprises the following steps: introducing the drosophila Drosocin gene into a citrus receptor material, and inducing Drosocin antibacterial peptide expression to obtain a citrus huanglongbing-resistant citrus material, and the nucleotide sequence of the drosophila Drosocin gene is as shown in SEQ ID NO: 1. According to the invention, the Drosocin gene is introduced into a citrus receptor material to induce the expression of Drosocin antibacterial peptide, so as to obtain a citrus material capable of resisting Candidatus Liberobacter asiaticum, thereby achieving the purposes of inhibiting the proliferation of Candidatus Liberobacter asiaticum and providing a green and efficient Candidatus Liberobacter asiaticum prevention and control means.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of forest tree breeding and seedling technology, specifically to a method for inducing the expression of antimicrobial peptides to resist Huanglongbing by transforming citrus with the Drosocin gene from fruit flies. Background Technology

[0002] Citrus fruits are a globally important economic crop and consistently hold the title of the world's largest fruit. Over the past decade, global citrus planting areas have continued to expand, and production has steadily increased. This positive development has not only powerfully promoted the prosperity of the global fruit industry but also injected continuous momentum into the economic and trade development of southern China. Within China's national economic system, the citrus industry, with its massive scale, extensive industrial linkages, and significant economic benefits, occupies a crucial and irreplaceable position, making it one of the most dynamic and promising pillar industries in the agricultural economy.

[0003] The citrus industry, while experiencing rapid growth, is frequently plagued by numerous diseases, which seriously threaten the industry's stability and sustainable development. Among these, citrus Huanglongbing (HLB) is caused by bacteria of the genus *Bacillus* (Citrus phloem bacilli). Candidatus Liberibacter spp., Citrus Huanglongbing (HLB) is a devastating disease caused by Clas, often referred to as "citrus cancer" in the field of citrus diseases. Its symptoms are extremely complex and diverse. Initially, it may only manifest as mild symptoms such as yellowing leaves and stunted growth, but as the disease progresses, it gradually leads to the withering and death of the entire citrus tree. Even more serious is the fact that HLB is characterized by rapid spread and high mortality, and its causative agent, Clas, cannot currently be cultured in pure form on artificial culture media, posing significant challenges to the diagnosis, research, and control of the disease.

[0004] Antimicrobial peptides ( Antimicrobial Peptides, AMPs Antimicrobial peptides, as an important component of the organism's innate immune system, possess unique biological characteristics and broad application prospects. These small molecule peptides exhibit broad-spectrum bactericidal activity, capable of inhibiting or killing a variety of pathogenic microorganisms, including bacteria, fungi, and some viruses. Compared to traditional antibiotics, antimicrobial peptides have a more complex and diverse mechanism of action and are less likely to induce drug resistance in pathogens. This characteristic gives them a significant advantage in addressing the increasingly serious problem of antibiotic resistance.

[0005] Based on these properties, antimicrobial peptides have found wide application in various fields, including medicine, food preservation, and agricultural disease control. In plant disease control, plant-derived and microbial-derived antimicrobial peptides, due to their natural affinity for plants, have shown potential in inhibiting the growth of plant pathogens and enhancing plant disease resistance. Animal-derived antimicrobial peptides, due to their unique amino acid composition and structural characteristics, often exhibit stronger antimicrobial activity and stability, and are gradually becoming an important research direction for developing novel biopesticides.

[0006] In the traditional control system for citrus diseases, the long-term and excessive use of chemical pesticides is a prominent problem. While chemical pesticides can effectively control the spread of diseases in the short term, pathogens gradually develop antibiotic resistance as the duration and frequency of use increase. This leads to a gradual decline in the effectiveness of chemical pesticides, necessitating continuously increased dosages and frequencies, thus creating a vicious cycle. This not only further exacerbates the problem of pathogen resistance but also causes serious pollution to the ecological environment, threatening human health and ecological balance.

[0007] Breeding disease-resistant varieties is another traditional disease control strategy, but this method has obvious limitations. The breeding of disease-resistant varieties often requires multiple generations of hybridization and field trials, resulting in a lengthy breeding cycle that typically takes several years or even decades to develop new varieties with stable disease resistance. Furthermore, due to the complex and variable growing environment of citrus, the disease resistance traits of disease-resistant varieties are unstable under different environmental conditions, easily leading to a decline in resistance and making it difficult to meet the needs of actual production.

[0008] Currently, the field of citrus disease control lacks a comprehensive, green, and efficient control strategy. This is especially true when facing diseases like citrus Huanglongbing (HLB), which are difficult to culture and cause significant damage; existing control methods are inadequate. The inability to culture Clas makes it difficult to fully understand its biological characteristics and pathogenic mechanisms, thus limiting the development of targeted control technologies. Currently, HLB control mainly relies on early detection, timely removal of diseased trees, and control of transmission vectors. However, these methods have limited effectiveness in practice and cannot fundamentally control the spread and prevalence of the disease, leaving HLB to continue to pose a serious threat to the citrus industry. Summary of the Invention

[0009] The purpose of this invention is to provide a method for inducing the expression of antimicrobial peptides to resist Huanglongbing (HLB) by transforming citrus with the Drosocin gene from fruit flies. By introducing the Drosocin gene from fruit flies into citrus recipient materials, the expression of Drosocin antimicrobial peptides is induced, thereby obtaining citrus materials resistant to HLB. This addresses the technical problems of existing HLB control technologies that rely on chemical pesticides, leading to pesticide resistance and environmental pollution, as well as the long breeding cycle and unstable resistance of disease-resistant varieties.

[0010] The present invention is achieved through the following technical solution: a method for transforming citrus with the fruit fly Drosocin gene to induce the expression of antimicrobial peptides to resist Huanglongbing, comprising introducing the fruit fly Drosocin gene into citrus recipient material, inducing the expression of Drosocin antimicrobial peptides, and obtaining citrus material resistant to citrus Huanglongbing, wherein the nucleotide sequence of the fruit fly Drosocin gene is shown in SEQ ID NO:1.

[0011] As an optional implementation, the amino acid sequence of the Drosocin antimicrobial peptide is shown in SEQ ID NO:2.

[0012] As an optional implementation, the Drosocin gene from fruit flies is introduced into citrus receptor material via a recombinant expression vector, wherein the recombinant expression vector is pNM-GFP-Drosocin.

[0013] As an optional implementation, the recombinant expression vector is introduced into citrus receptor material via Agrobacterium-mediated transformation, wherein the Agrobacterium is Agrobacterium K599 strain.

[0014] As an optional implementation, the Agrobacterium-mediated method includes: culturing Agrobacterium containing a recombinant expression vector to the logarithmic growth phase, collecting the bacterial cells by centrifugation, resuspending the cells in an induction buffer to prepare an Agrobacterium suspension, co-culturing citrus explants with the Agrobacterium suspension, wherein the co-culture induces Agrobacterium to infect the citrus explants, and induces the formation of hairy roots, wherein the hairy roots express the antimicrobial peptide Drosocin.

[0015] As an optional implementation, the induction buffer contains MES, which adjusts the pH of the Agrobacterium suspension to induce the expression of the Vir gene by the Agrobacterium.

[0016] In one optional implementation, the trifoliate orange stem segment is cut to form a wound after surface disinfection; the co-culture is performed using vacuum permeation treatment, which allows the Agrobacterium suspension to enter the tissue of the trifoliate orange stem segment.

[0017] As an optional implementation, the method further includes molecular identification of the obtained citrus materials, the molecular identification comprising: extracting genomic DNA from the citrus materials, performing PCR amplification using primers pNM-GFP-Drosocin-F and pNM-GFP-Drosocin-R, and detecting the Drosocin gene of the fruit fly; and extracting total RNA from the citrus materials, reverse transcribing it into cDNA, and then performing real-time quantitative reverse transcription polymerase chain reaction using primers RT-Drosocin-F and RT-Drosocin-R to detect the transcription level of the Drosocin gene of the fruit fly. The nucleotide sequence of the primer pNM-GFP-Drosocin-F is as follows: tttggagaggacagggtaccatgGGCAAACCGCGTCCGTATT; The nucleotide sequence of the primer pNM-GFP-Drosocin-R is as follows: gggaattcctgcaggtcgacTTAAACACGAATTGGACGAGGAT; The nucleotide sequence of the primer RT-Drosocin-F is as follows: atgGGCAAACCGCGTCCGTATT; The nucleotide sequence of the primer RT-Drosocin-R is as follows: TTAAACACGAATTGGACGAGGAT.

[0018] As an optional implementation, the method also includes evaluating the resistance of the obtained citrus materials to citrus Huanglongbing (HLB). The resistance evaluation includes inoculating the citrus materials with HLB fungus, culturing them, extracting DNA, and detecting the colonization level of CLAs by quantitative polymerase chain reaction.

[0019] As an alternative implementation, the citrus material is a transgenic hairy root expressing the antimicrobial peptide Drosocin.

[0020] Compared with the prior art, the embodiments of the present invention have the following advantages and beneficial effects: 1. This invention provides a method for transforming citrus with the Drosocin gene from Drosophila melanogaster to induce the expression of antimicrobial peptides to resist Huanglongbing (HLB). After successful expression of Drosocin in citrus, the transgenic hairy roots exhibited significant resistance to Clas colonization. Experimental data showed that, compared with the empty vector control, the colonization rate of Clas in the transgenic hairy roots was significantly reduced. This result fully demonstrates that the antimicrobial peptide Drosocin, derived from Drosophila melanogaster, can exert a strong inhibitory effect in citrus, effectively inhibiting Clas proliferation and providing a key intrinsic defense mechanism for citrus against HLB.

[0021] 2. Compared with traditional control methods that rely on chemical pesticides and the breeding of disease-resistant varieties, the embodiments of this invention, using droocin as a bio-derived peptide, have many outstanding advantages. Its environmentally friendly characteristics mean that its application will not pollute the ecological environment, ensuring the balance and stability of the ecosystem; its strong targeting ensures that droocin can accurately act on the pathogen Clas, reducing the impact on non-target organisms; at the same time, its low tendency to induce resistance avoids the development of drug resistance in pathogens due to long-term exposure, ensuring the persistence of control effects. These advantages are highly consistent with the development concept of green agriculture, opening up a new and sustainable strategic path for the control of citrus Huanglongbing (HLB).

[0022] 3. Drosocin, derived from the animal immune system, has been successfully applied in the field of plant disease control, breaking the boundaries of traditional plant disease control and vividly demonstrating the feasibility and enormous potential of "cross-species disease-resistant elements." This innovative achievement has brought new ideas and methods to the field of plant disease control, inspiring researchers to further explore and utilize disease-resistant resources from different biological kingdoms, develop more efficient and environmentally friendly plant disease control technologies, and promote the development of plant disease control research to a deeper and broader level. Attached Figure Description

[0023] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of the present invention and should not be considered as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort. In the drawings: Figure 1 This is a schematic diagram of the expression vector structure in Embodiment 2 of the present invention; Figure 2 This is a schematic diagram of the fluorescence detection results in Example 7 of the present invention; Figure 3 This is a PCR identification diagram of the transgenic plant in Example 8 of the present invention; Figure 4 This is a detection graph of the expression results in Embodiment 10 of the present invention; Figure 5 This is a graph showing the detection results of Huanglongbing resistance in Example 10 of the present invention. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are some embodiments of the present invention, but not all embodiments.

[0025] Therefore, the detailed description of the embodiments of the present invention provided below is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0026] Currently, the main methods for controlling diseases that seriously threaten the citrus industry, such as Huanglongbing (HLB), rely on chemical pesticides and the breeding of disease-resistant varieties. However, the long-term and extensive use of chemical pesticides has led to the gradual emergence of pathogens and increased antibiotic resistance, resulting in declining control effectiveness. This necessitates increasing the dosage and frequency of pesticide application, creating a vicious cycle and causing serious environmental pollution. Breeding disease-resistant varieties, on the other hand, requires multiple generations of hybridization and field trials, resulting in an extremely long breeding cycle that often takes several years or even decades to develop new varieties with stable disease resistance. Furthermore, due to the complex and variable growing environment of citrus, the disease resistance traits of disease-resistant varieties are unstable under different conditions, easily leading to a decline in resistance and making it difficult to meet actual production needs.

[0027] For citrus Huanglongbing (HLB), caused by pathogens like Clas that are difficult to culture and spread rapidly with significant destructive power, current technologies cannot provide effective, green control solutions. Due to a lack of in-depth understanding of Clas's biological characteristics and pathogenic mechanisms, it is difficult to develop targeted control technologies. Current measures, primarily relying on early detection, timely removal of diseased trees, and control of transmission vectors, have limited effectiveness in practical applications and cannot fundamentally curb the spread and prevalence of the disease, thus allowing HLB to continue to pose a serious threat to the citrus industry.

[0028] Drosocin is an antimicrobial peptide isolated from Drosophila melanogaster. In-depth research has revealed that this antimicrobial peptide possesses unique physicochemical properties and biological activities. It exhibits significant inhibitory activity against a variety of Gram-negative bacteria, effectively interfering with cell wall synthesis and disrupting cell membrane structure at low concentrations, thereby inhibiting bacterial growth and reproduction. Structurally, Drosocin possesses a specific amino acid sequence and spatial conformation. This unique structural feature provides the basis for its binding to specific receptors on the bacterial cell surface, thus exerting its antimicrobial effect. Based on its excellent antimicrobial activity and unique structural characteristics, Drosocin is considered a lead compound for the development of novel antimicrobial agents, providing an important material basis and research direction for the development of new antimicrobial drugs.

[0029] This invention integrates the Drosocin antimicrobial peptide gene from the fruit fly *Drosophila melanogaster* into the citrus genome via a specific expression vector, enabling citrus plants to express the Drosocin antimicrobial peptide. This effectively enhances the resistance of citrus plants to citrus Huanglongbing (HLB), reducing the incidence and severity of the disease. This research is significant for breeding new citrus varieties with specific functions. It not only enriches citrus varietal resources and meets market demand for high-quality, disease-resistant citrus, but also significantly accelerates the process of disease-resistant citrus breeding, shortens the breeding cycle, and improves breeding efficiency, providing strong technical support for the sustainable development of the citrus industry.

[0030] Specifically, this invention provides a method for transforming citrus fruits using the Drosocin gene from fruit flies to induce the expression of antimicrobial peptides to resist Huanglongbing (HLB). The method utilizes Drosocin, an antimicrobial peptide derived from the Drosophila melanogaster, to be expressed in citrus fruits through genetic engineering to inhibit the proliferation of the HLB pathogen Clas. To better demonstrate the significant effects of this invention, experimental verification of specific implementation methods will be conducted below.

[0031] It should be noted that, for ease of understanding, this embodiment uses Agrobacterium rhizogenes-mediated genetic transformation to introduce the Drosocin gene into citrus (taking trifoliate orange as an example) to verify its expression in the plant and its inhibitory effect on Clas, the pathogen of citrus Huanglongbing. Of course, other varieties of citrus are also applicable in other embodiments.

[0032] Example 1: Basic Information (1) Drosocin nucleic acid sequence: GGCAAACCGCGTCCGTATTCGCCGCGTCCGACCAGCCATCCTCGTCCAATTCGTGTTTAA (2) Drosocin protein sequence GKPRPYSPRPTSHPRPIRV* Example 2: Construction of hairline carrier (1) Carrier and fragment processing A drosocin-coding DNA fragment containing the homologous arm of the pNM-GFP vector and the overexpression vector pNM-GFP were selected as experimental materials. The drosocin-coding DNA fragment and the overexpression vector pNM-GFP were subjected to double digestion using restriction endonucleases KpnⅠ and BamH1 (purchased from Thermo Fisher Scientific). The digestion reaction system was prepared according to the standard conditions provided by the enzyme supplier to ensure the high efficiency and specificity of the digestion reaction.

[0033] After the enzyme digestion reaction was completed, the digestion products were separated using agarose gel electrophoresis. Gel bands containing the target fragment were accurately extracted by observing the gel under UV light. Subsequently, the target fragment was recovered and purified using a gel recovery kit to remove impurities and other non-target components from the gel, obtaining a high-purity digestion product that provides a high-quality template for subsequent ligation reactions.

[0034] (2) Carrier connection and transformation The purified drosocin coding sequence DNA fragment was ligated with the enzyme digestion product of the overexpression vector pNM-GFP using the ClonExpress II One Step Cloning Kit (Novozymes, CAT: C112-01). This kit, based on the principle of homologous recombination, can efficiently and accurately insert the target fragment into the vector. The ligation reaction system was precisely prepared according to the kit instructions and incubated under suitable reaction conditions to promote the successful homologous recombination reaction.

[0035] After the ligation reaction, the ligation product was transformed into *E. coli* DH5α competent cells. The transformation process was strictly performed according to the instructions for use of competent cells to ensure transformation efficiency. The transformed cells were evenly spread on LB agar containing the appropriate antibiotics and incubated upside down overnight at a suitable temperature to allow single colonies of *E. coli* containing the recombinant plasmid to grow.

[0036] Example 3: Positive clone screening and plasmid extraction (1) The next day, observe the growth of colonies on LB solid medium, select single colonies with full shape and appropriate size, inoculate them into LB liquid medium containing the corresponding antibiotics, and shake them in a shaker under suitable temperature and speed conditions. After the culture reaches the logarithmic growth phase, use a plasmid extraction kit (purchased from Tiangen Company, CAT: DP103) to extract plasmids from the bacterial culture.

[0037] The extracted plasmids were screened for positive clones using agarose gel electrophoresis and enzyme digestion identification. The plasmids identified as positive clones were used as the overexpression vector for Drosocin, pNM-GFP-Drosocin, the specific structure of which is described in [reference needed]. Figure 1 As shown.

[0038] (2) Primer information The primer information used in the construction of the hair root vector is as follows: The nucleotide sequence of primer pNM-GFP-Drosocin-F is as follows: tttggagaggacagggtaccatgGGCAAACCGCGTCCGTATT The nucleotide sequence of primer pNM-GFP-Drosocin-R is as follows: gggaattcctgcaggtcgacTTAAACACGAATTGGACGAGGAT Example 4: Transformation of Agrobacterium with overexpression vector In this embodiment of the invention, Agrobacterium rhizogenes strain K599 was selected as the gene transformation medium. The successfully constructed overexpression vector was introduced into Agrobacterium tumefaciens K599 (purchased from Weidi Biotechnology) using a chemical transformation method. The specific operation steps are as follows: Take pre-frozen Agrobacterium competent cells K599 (volume 50g) from an ultra-low temperature freezer at -80℃. μ Place the L cells on ice to thaw slowly, to prevent damage from sudden temperature changes. Once the competent cells are completely thawed, add 2... μ The plasmid overexpressing the L-type vector was gently mixed using a pipette to ensure full contact between the plasmid and competent cells. The mixture was then placed on ice for 5 minutes to allow for better plasmid attachment to the competent cell surface. Subsequently, the mixture was rapidly transferred to liquid nitrogen and frozen for 5 minutes. This step creates micropores in the cell membrane, facilitating plasmid entry into the cells. Immediately afterward, the mixture was removed from the liquid nitrogen and placed in a 42°C water bath for 5 minutes to further promote plasmid entry into the cells. After heat shock, the mixture was again placed on ice for 5 minutes to allow the cell membrane to repair itself. 700 mg of [unspecified substance] was added to the treated mixture. μMix the antibiotic-free LB broth gently and incubate at 28°C in a shaker at 200 rpm for 2 hours to allow the Agrobacterium cells to return to normal growth and express resistance genes. After incubation, transfer the bacterial culture to a centrifuge tube and centrifuge at 6000 rpm for 1 minute to precipitate the cells. Discard most of the supernatant, retaining only about 100 ml of the supernatant. μ L of supernatant was used to gently resuspend the bacterial block using a pipette. The resuspended bacterial solution was then evenly spread onto a substrate containing 50 μL of supernatant. μ g / mL kanamycin and 20 μ Agrobacterium was screened for successful transformation with the overexpression vector on LB agar plates containing g / mL rifampicin. The plates were then inverted and incubated in a 28°C incubator for 2-3 days until plaques appeared.

[0039] After the colonies grew, single colonies were validated by PCR using primers pNM-GFP-Drosocin-F and pNM-GFP-Drosocin-R to confirm the successful introduction of the overexpression vector into Agrobacterium cells. The PCR reaction system was prepared according to standard methods, and the reaction conditions were as follows: pre-denaturation at 94℃ for 3 min; then, a cycling phase was performed: denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, for a total of 30 cycles; finally, a final extension at 72℃ for 10 min was performed. The PCR products were detected by agarose gel electrophoresis, and the results were used to determine whether a clone was positive.

[0040] Example 5: Preparation of Agrobacterium tumefaciens bacterial suspension The K599 strain, which was verified by PCR to contain the recombinant vector pNM-GFP-Drosocin, was inoculated onto solid TY medium containing streptomycin and kanamycin and cultured in a constant temperature incubator at 28°C for 48 h to allow Agrobacterium to grow into single colonies on the medium.

[0041] Select plump, appropriately sized single colonies and inoculate them into liquid TY medium containing the appropriate antibiotic. Incubate in a constant-temperature shaker at 220 rpm at 28°C until the OD600 value of the bacterial culture reaches 0.6-0.8. At this point, the Agrobacterium cells are in the logarithmic growth phase, exhibiting vigorous growth and are suitable for subsequent infection experiments.

[0042] Transfer the bacterial culture to a suitable OD600 value into centrifuge tubes and centrifuge at 4000 rpm for 10 min to collect the bacterial cells. Discard the supernatant and resuspend the bacterial cells in induction buffer (100 mM MES, pH 5.6), adjusting the OD600 value of the bacterial culture to 1.0-1.5. Incubate the resuspended bacterial culture in the dark for 1.5 h to induce the expression of the Vir gene in Agrobacterium cells under the action of the induction buffer, thereby enhancing their infectivity and preparing them for subsequent infection of plant cells.

[0043] Example 6: Explant treatment and infection Select healthy, uniformly sized *Citrus trifoliata* plants and cut their stem segments into explants approximately 3 cm in length. To reduce the risk of microbial contamination and improve the success rate of infection, the cut surfaces of the stem segments were strictly disinfected using appropriate combinations of disinfectants and treatment times to ensure a smooth and clean cut surface, creating favorable conditions for subsequent *Agrobacterium* infection.

[0044] This experiment included multiple parallel groups, with 30 stem segments treated in each group. The base of the sterilized stem segments was completely immersed in a suspension of Agrobacterium K599 containing the recombinant vector pNM-GFP-Drosocin. To enhance the infection efficiency of Agrobacterium on the stem segments, a vacuum permeation method was used. Containers containing the stem segments and Agrobacterium suspension were placed in a vacuum apparatus, and the vacuum was maintained at a suitable pressure for 30 minutes, allowing Agrobacterium to more fully contact and invade the stem segment tissue cells.

[0045] Example 7: Induction of green fluorescent transgenic hairy roots The infected stem segments were carefully transferred to culture containers filled with vermiculite. Vermiculite has good air permeability and water retention, providing suitable environmental conditions for stem segment growth. The culture containers were placed in a culture chamber set at 26°C with a photoperiod of 16 hours light / 8 hours dark to simulate natural light conditions, thereby promoting stem segment growth and inducing the formation of hairy roots.

[0046] After approximately four weeks of cultivation, hairy roots were gradually induced at the base of the stem segments. The fluorescence expression of the hairy roots was observed under dark-field or blue light excitation conditions, and hairy roots exhibiting obvious green fluorescence were selected. Figure 2 As shown, these hairy roots were preliminarily identified as transgenic hairy roots that may contain the target gene.

[0047] Example 8: PCR identification of hairy roots of transgenic plants Genomic DNA was extracted from 100 mg of hairy roots of transgenic plants using a DNA extraction kit (Adley, CAT: DN15), and PCR was used to detect the integration of the Drosocin coding sequence into the citrus genome.

[0048] PCR identification of transgenic plants Nucleotide sequence of primer pNM-GFP-Drosocin-F: tttggagaggacagggtaccatgGGCAAACCGCGTCCGTATT The nucleotide sequence of primer pNM-GFP-Drosocin-R: gggaattcctgcaggtcgacTTAAACACGAATTGGACGAGGAT.

[0049] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0050] The results are as follows Figure 3 As shown, positive plants can obtain an amplified fragment of 124 bp (including homologous arms), while WT plants do not amplify.

[0051] Example 9: Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of transgenic plants: First, total RNA was extracted from the leaves of the transgenic plants using the appropriate reagent (product number: RN09) from the Adley brand. Next, complementary DNA (cDNA) was synthesized from the extracted total RNA using the PrimeScript RT Master Mix reverse transcription kit (TaKaRa, product number: RR036A). Finally, qRT-PCR was used to detect the expression level of the target gene.

[0052] The primer sequences used for detection are as follows: The nucleotide sequence of primer RT-Drosocin-F is as follows: atgGGCAAACCGCGTCCGTATT The nucleotide sequence of primer RT-Drosocin-R is as follows: TTAAACACGAATTGGACGAGGAT.

[0053] When calculating the relative expression level of the Hinnavin I gene in transgenic plants, a 2-1 ratio was used. −ΔΔCtThe method involves using a water-treated sample as a reference sample, with its Hinnavin I gene expression level set at 1. Then, the fold increase in the target gene expression level in the transgenic citrus compared to the reference sample gene expression level is calculated. This fold increase is determined by 2... −ΔΔCt The result is calculated to be the relative expression level of the target gene, and the relevant results are presented in the form of a chart.

[0054] The reaction conditions for qRT-PCR were set as follows: pre-denaturation at 95℃ for 3 minutes; then, the cycling phase was initiated, with each cycle consisting of denaturation at 94℃ for 10 seconds, annealing at 56℃ for 10 seconds, and extension at 72℃ for 10 seconds, for a total of 40 cycles; finally, extension at 72℃ for 10 minutes.

[0055] Example 10: Evaluation of Pathogen Inoculation and Resistance Suppression Effects Following the research method used by Zou (2017), quantitative polymerase chain reaction (qPCR) technology was employed to assess the resistance of transgenic plants to Huanglongbing (HLB). Degree. Starting from the grafting and virus transmission operation for Huanglongbing, on the 10th day after inoculation (10 dpi), transgenic hairy root samples of consistent quality were selected, deoxyribonucleic acid (DNA) was extracted from them, and quantified to 100. n g / u L. Following the method of Zou et al. (2017), the content of citrus 18S gene and CLas 16S gene was detected by aPCR technology.

[0056] The relative content of CLas bacteria is calculated using the following formula (in Logarithmic form). 10 (in units): Las copies μ g-1 citrus DNA= ﹛10 (-0.2718×CtCas16s+10.624) / 10 (-0.2749×CCs18$+4.0531) ﹜ ×10 3(12.7 <ctCLas16s<31.3 and 8.4<cts18s<26.5 ) Wild-type plants were used as control samples, combined with reference Figure 4 and Figure 5 As shown, the resistance level of transgenic plants was determined by analyzing the logarithmic values ​​of the Huanglongbing pathogen content. For data processing, Excel software was used for data statistics and chart creation, and Prism software was used for significance analysis. Through these operations, the inhibitory effect of Drosocin on the proliferation of Clas bacteria was evaluated.

[0057] Therefore, this invention introduces the antimicrobial peptide Drosocin, derived from the fruit fly *Drosophila melanogaster*, into the control of citrus Huanglongbing (HLB). Using advanced genetic engineering techniques, the gene encoding Drosocin is precisely inserted into the citrus genome, enabling the citrus to autonomously express this antimicrobial peptide. Drosocin, with its unique amino acid sequence and spatial structure, can specifically recognize and bind to the outer membrane protein of the HLB pathogen *Candidatus Liberibacter asiaticus* (Clas), interfering with the pathogen's normal physiological metabolic processes and effectively inhibiting the proliferation of Clas within the citrus plant. This molecular-level approach constructs a robust defense against HLB for the citrus.

[0058] It should be noted that other embodiments of the present invention are not limited to citrus as a single crop. Given that Clas or similar Gram-negative bacteria pose a serious threat to many crops, the technical solutions adopted in the embodiments of the present invention can be further extended to other crops infected by such pathogens, such as some closely related species of citrus and other economic and food crops susceptible to Gram-negative bacteria. By flexibly adjusting the construction strategy of the expression vector and the transformation method, the Drosocin gene can be stably expressed in different plant systems, thereby providing effective technical support for disease control in various crops.

[0059] It should also be noted that in practical applications, if Drosocin cannot be obtained or used for various reasons, other antimicrobial peptides with similar antimicrobial activity can be used as alternatives. These alternative antimicrobial peptides are widely available, including antimicrobial peptides from other animal sources and those that have been artificially designed and synthesized. The key is that these alternative antimicrobial peptides must possess functional properties similar to Drosocin, namely, the ability to specifically bind to and inhibit the outer membrane proteins of Clas or related pathogens, interfering with the growth and reproduction of pathogens, thereby achieving the purpose of disease control. This flexible substitution mechanism ensures the feasibility and effectiveness of this invention under different conditions, providing diverse options for the control of citrus Huanglongbing and other similar diseases.

[0060] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for inducing antimicrobial peptide expression to resist Huanglongbing (HLB) by transforming citrus fruits with the Drosocin gene from fruit flies, characterized in that, The invention includes introducing the Drosocin gene from fruit flies into citrus recipient materials, inducing the expression of the antimicrobial peptide Drosocin, and obtaining citrus materials resistant to Huanglongbing (HLB). The nucleotide sequence of the Drosocin gene from fruit flies is shown in SEQ ID NO:

1.

2. The method according to claim 1 for transforming citrus with the Drosocin gene from fruit flies to induce the expression of antimicrobial peptides against Huanglongbing (HLB), characterized in that, The amino acid sequence of the Drosocin antimicrobial peptide is shown in SEQ ID NO:

2.

3. A method for inducing antimicrobial peptide expression against Huanglongbing by transforming citrus with the Drosocin gene from fruit flies according to claim 1 or 2, characterized in that, The Drosocin gene from fruit flies was introduced into citrus receptor material via a recombinant expression vector, namely pNM-GFP-Drosocin.

4. The method for transforming citrus fruits using the Drosocin gene from fruit flies to induce the expression of antimicrobial peptides against Huanglongbing (HLB) according to claim 3, characterized in that... The recombinant expression vector was introduced into the citrus receptor material via Agrobacterium-mediated transformation, wherein the Agrobacterium is Agrobacterium K599 strain.

5. The method according to claim 4 for transforming citrus with the Drosocin gene from fruit flies to induce the expression of antimicrobial peptides against Huanglongbing (HLB), characterized in that, The Agrobacterium-mediated method includes: culturing Agrobacterium containing a recombinant expression vector to the logarithmic growth phase, collecting the bacterial cells by centrifugation, resuspending the cells in an induction buffer to prepare an Agrobacterium suspension, co-culturing citrus explants with the Agrobacterium suspension, wherein the co-culture induces Agrobacterium to infect the citrus explants, and induces the formation of hairy roots, wherein the hairy roots express the antimicrobial peptide Drosocin.

6. The method for transforming citrus fruits using the Drosocin gene from fruit flies to induce the expression of antimicrobial peptides against Huanglongbing (HLB) according to claim 5, characterized in that, The induction buffer contains MES, which adjusts the pH of the Agrobacterium suspension to induce the expression of the Vir gene by the Agrobacterium.

7. A method for transforming citrus fruits using the Drosocin gene from fruit flies to induce the expression of antimicrobial peptides against Huanglongbing (HLB) according to claim 5, characterized in that... The trifoliate orange stem segments are cut to form wounds after surface disinfection; the co-culture is carried out using vacuum permeation treatment, which allows the Agrobacterium suspension to enter the tissue of the trifoliate orange stem segments.

8. A method for transforming citrus fruits using the Drosocin gene from fruit flies to induce the expression of antimicrobial peptides against Huanglongbing (HLB) according to claim 3, characterized in that, The method also includes molecular identification of the obtained citrus materials, which includes: extracting genomic DNA from the citrus materials, performing PCR amplification using primers pNM-GFP-Drosocin-F and pNM-GFP-Drosocin-R, and detecting the Drosocin gene of the fruit fly; and extracting total RNA from the citrus materials, reverse transcribing it into cDNA, and then performing real-time quantitative reverse transcription polymerase chain reaction using primers RT-Drosocin-F and RT-Drosocin-R to detect the transcription level of the Drosocin gene of the fruit fly. The nucleotide sequence of the primer pNM-GFP-Drosocin-F is as follows: tttggagaggacagggtaccatgGGCAAACCGCGTCCGTATT; The nucleotide sequence of the primer pNM-GFP-Drosocin-R is as follows: gggaattcctgcaggtcgacTTAAACACGAATTGGACGAGGAT; The nucleotide sequence of the primer RT-Drosocin-F is as follows: atgGGCAAACCGCGTCCGTATT; The nucleotide sequence of the primer RT-Drosocin-R is as follows: TTAAACACGAATTGGACGAGGAT.

9. A method according to claim 1 for transforming citrus fruit using the Drosocin gene in fruit flies to induce the expression of antimicrobial peptides against Huanglongbing (HLB), characterized in that, It also includes evaluating the resistance of the obtained citrus materials to Huanglongbing (HLB). The resistance evaluation includes inoculating the citrus materials with Huanglongbing fungus, extracting DNA after culture, and detecting the colonization level of CLAs by quantitative polymerase chain reaction.

10. A method according to claim 1 for transforming citrus fruit using the Drosocin gene from fruit flies to induce the expression of antimicrobial peptides against Huanglongbing (HLB), characterized in that, The citrus material is a transgenic hairy root expressing the antimicrobial peptide Drosocin.