DCAPs molecular marker related to prematurity character of citrus reticulata fruits and application of dCAPs molecular marker

Abstract

The invention relates to the technical field of plant molecular breeding and biology, in particular to a dCAPs molecular marker related to prematurity characters of citrus reticulata fruits and application of the dCAPs molecular marker. The dCAPs molecular marker related to the prematurity character of the Satsuma citrus fruits is characterized in that the molecular marker comprises a single nucleotide polymorphism (SNP) site located at the 39493125th site of a fifth chromosome of a Satsuma citrus genome, the nucleotide of the SNP site is T or A, and the login number of the Satsuma citrus genome in the national genomics data center is GWHERCA00000000. The molecular marker comprises a nucleotide sequence as shown in SEQ ID NO: 1. On the basis of key SNP mutation causing CLASP gene function loss, the method can be directly used for early screening of early-maturing bud mutation resources of satsuma oranges, auxiliary selection of early-maturing single plants of filial generations and identification of variety authenticity and purity, the breeding period can be remarkably shortened, and the breeding efficiency can be improved.

Description

Technical Field

[0001] This invention relates to the fields of plant molecular breeding and biotechnology, specifically to a dCAPs molecular marker related to the early ripening trait of Wenzhou mandarin oranges and its application. Background Technology

[0002] Citrus is one of the world's major fruit commodities, and my country's citrus industry ranks first globally in scale. Through long-term development, my country has made significant progress in citrus variety improvement in terms of uses, ripening period, and diversification. However, the ripening period of citrus fruits in my country is still relatively concentrated, with mid-season varieties accounting for over 50%, while high-quality extra-early and late-maturing varieties are relatively scarce. Therefore, selecting early-maturing varieties and precisely controlling the fruit ripening period are crucial for seizing market opportunities, improving planting efficiency, and achieving a balanced year-round supply of fresh fruit, and are important goals of citrus breeding.

[0003] Wenzhou mandarin oranges are one of the main cultivated citrus varieties in my country, exhibiting a high natural mutation rate. Through continuous bud mutation selection over multiple generations, China, Japan, and other countries have bred hundreds of bud mutation varieties, such as 'Owari' and 'Miyagawa,' from primary lines like Imuri and Wase, forming a large-scale group of Wenzhou mandarin orange bud mutation varieties with rich genetic backgrounds. This group shows significant differences in fruit ripening characteristics, with a difference of more than 50 days between the very early-maturing and late-maturing varieties. This not only greatly extends the market supply period of Wenzhou mandarin oranges but also provides extremely valuable genetic material for elucidating the genetic mechanisms regulating fruit ripening and for conducting targeted molecular breeding.

[0004] With the development of high-throughput sequencing technology, single nucleotide polymorphism (SNP) markers have become one of the core tools for marker-assisted breeding due to their large number, wide distribution, and good stability. CAPS markers are developed based on restriction endonuclease cleavage polymorphisms in PCR amplification products, but their application is limited by the existence of natural restriction enzyme sites. Derivative CAPS (dCAPs) technology, by artificially introducing mismatched bases into specific primers to create or destroy restriction endonuclease recognition sites, can convert almost any SNP site into dCAPs markers that are easily detected by conventional electrophoresis, greatly expanding the application scope of SNP genotyping technology. Currently, no functional dCAPs markers for the early-maturing trait of Wenzhou mandarin oranges have been reported. Developing such markers has important theoretical and applied value for accelerating the maturity breeding process of Wenzhou mandarin oranges and achieving varietal diversification. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies.

[0006] One of the objectives of this invention is to propose a dCAPs molecular marker associated with the early maturity trait of Wenzhou mandarin oranges. The molecular marker contains a single nucleotide polymorphism (SNP) site located at position 39493125 on chromosome 5 of the Wenzhou mandarin orange genome. The nucleotide of the SNP site is either T or A. The accession number of the Wenzhou mandarin orange genome in the National Genomics Data Center is GWHERCA00000000.

[0007] Furthermore, the molecular marker comprises a nucleotide sequence as shown in SEQ ID NO: 1.

[0008] A second objective of this invention is to provide a primer pair for the aforementioned dCAPs molecular markers, comprising a forward primer and a reverse primer, wherein the forward primer contains the nucleotide sequence shown in SEQ ID NO: 2, and the reverse primer contains the nucleotide sequence shown in SEQ ID NO: 3.

[0009] The third objective of this invention is to propose the application of the primer pair in the preparation of a kit for identifying the ripening period of Wenzhou mandarin oranges.

[0010] The fourth objective of this invention is to provide a method for identifying the ripening period of Wenzhou mandarin oranges, comprising the following steps: Step (1): Extract genomic DNA from the Wenzhou mandarin orange sample to be tested; Step (2): Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 3 to obtain the amplification product; Step (3): The amplification product obtained in step (2) is digested with the restriction endonuclease HindIII to obtain the digested product; Step (4) Detect the enzyme digestion product obtained in step (3): If the enzyme digestion product shows a single DNA fragment of about 259 bp, the Wenzhou mandarin orange sample is determined to be homozygous TT genotype at the SNP site and belongs to a late-maturing variety; if the enzyme digestion product shows two DNA fragments with a length difference of about 25 bp, the Wenzhou mandarin orange sample is determined to be heterozygous TA genotype at the SNP site and belongs to an early-maturing variety.

[0011] Furthermore, the PCR amplification product in step (2) is 259 bp in length.

[0012] Furthermore, in step (4), the enzyme digestion products are detected by agarose gel electrophoresis or capillary electrophoresis.

[0013] The fifth objective of this invention is to provide a kit for identifying the ripening period of Wenzhou mandarin oranges, comprising the aforementioned primer pair and restriction endonuclease HindIII. Beneficial effects

[0014] This invention, based on a key SNP mutation leading to loss of CLASP gene function, successfully developed a molecular marker for dCAPs closely related to the early-maturing trait of Wenzhou mandarin oranges and its detection method. This method has the following advantages: 1. High accuracy: The markers are derived from functional SNPs that are highly cosegregated with the traits, and the identification results are highly consistent with the maturity traits shown in the field.

[0015] 2. Fast and simple: No complicated sequencing equipment is required. Detection can be completed in one day using only conventional PCR, enzyme digestion and agarose gel electrophoresis. The operation is simple and easy to promote and apply in ordinary laboratories.

[0016] 3. Low cost: The reagents used are all commonly used in molecular biology, and the cost is far lower than that of high-throughput sequencing.

[0017] 4. Broad application prospects: This marker can be directly used for early screening of early-maturing bud mutation resources of Wenzhou mandarin oranges, auxiliary selection of early-maturing single plants of hybrid offspring, and identification of variety authenticity and purity. It can significantly shorten the breeding cycle, improve breeding efficiency, and provide effective technical support for the structural adjustment and industrial upgrading of citrus varieties in my country. Attached Figure Description

[0018] Figure 1 This is a schematic diagram of the high-quality SNP site screening process and key site location in Embodiment 1 of the present invention. (A) illustrates the technical route for screening high-quality somatic SNP sites from Wenzhou mandarin orange materials through resequencing and bioinformatics analysis (including BCFtools filtering, GATK4 hard filtering, VarScan2 statistical validation, and non-specific site filtering); (B) schematically marks the specific location of the screened key SNP site (chromosome 5, position 39493125, T / A) on the Wenzhou mandarin orange genome chromosome, and notes that it is located in the coding region of the CLASP gene.

[0019] Figure 2 This is a schematic diagram illustrating the principle of the dCAPs molecular markers developed in this invention. The diagram demonstrates the strategy of designing specific primers based on the target SNP site (T / A): the reverse primer (dCAPs-R) introduces a mismatched base "C" (marked in the diagram). When the template DNA is the mutant allele "A" at the SNP site, a complete HindIII restriction enzyme recognition site (5'-AAGCTT-3') will be formed in the PCR amplification product; however, when the template DNA is the wild-type allele "T", this restriction site cannot be formed. The diagram further illustrates that after HindIII digestion, different genotypes (TA heterozygous vs. TT homozygous) will produce DNA fragments of different lengths (234bp + 25bp vs. 259bp), which can be distinguished by electrophoresis.

[0020] Figure 3 This image shows the results of identifying 38 Wenzhou mandarin orange varieties using the developed dCAPs markers in Example 2 of this invention. (A) is a 5% agarose gel electrophoresis image, showing the electrophoretic bands of the enzyme digestion products of some representative varieties. Lane M represents the DNA molecular weight standard; lanes 1-8 show the detection results for different varieties, clearly showing two band patterns: a single 259bp main band (corresponding to the TT genotype, a late-maturing variety) and a main band of approximately 234bp generated after digestion (corresponding to the TA genotype, an early-maturing variety; the 25bp fragment is not shown). (B) is a capillary electrophoresis analysis image, presenting the same identification results in the form of electrophoretic peaks. The sample showing a single 259bp peak is the TT genotype, and the sample showing a double peak of 234bp and 25bp is the TA genotype, which corroborates the agarose gel electrophoresis results. Detailed Implementation

[0021] The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0022] Example 1: Screening of SNP sites related to early maturity traits of Wenzhou mandarin oranges and development of dCAPs molecular markers.

[0023] (a) Experimental materials The 38 leaf samples of Wenzhou mandarin oranges used in this invention were collected from Yichang, Hubei Province, and the resource nursery of the Citrus Research Institute of the Chinese Academy of Agricultural Sciences (hereinafter referred to as "CIRI"). They cover different maturity types from extra-early to late-maturing (see Table 1 for details). The fruit maturity information of each variety comes from the National Citrus Information Resource Sharing Service Platform (http: / / xt.old.cric.cn / zy / ). The classification criteria are as follows: those maturing before October 1 are extra-early maturing, those maturing from October 1 to October 31 are early maturing, and those maturing after November 1 are late maturing.

[0024] Table 1: Information on 38 Wenzhou mandarin orange resequencing materials

[0025]

[0026] (II) Screening of high-quality SNP sites Genome resequencing was performed on the above 38 materials. To improve the accuracy of somatic mutation identification, high-quality SNP screening was conducted using the following bioinformatics workflow (see flowchart). Figure 1 ): 1. Use BCFtools software to filter out SNPs within a 20bp range of insertions / deletions (InDel).

[0027] 2. Use GATK4 software (default parameters) to perform hard-filtering on the variant detection results.

[0028] 3. Use VarScan2 software to count the sequencing reads of the alignment file (BAM file), retain specific variant sites with both positive and reverse strand reads greater than 2, and re-verify their genotypes.

[0029] 4. Filter out non-specific variant sites that are common in all or most of the 38 materials (i.e., sites that are present in all or most samples), while allowing a single site to have missing information in no more than 3 samples.

[0030] Through the above rigorous screening, 1839 high-quality somatic SNP sites were finally identified from all materials.

[0031] (III) Functional mutation analysis of the CLASP gene Gene annotation and functional analysis of the 1839 selected SNP loci revealed an SNP located at position 39493125 on chromosome 5 of the Wenzhou mandarin reference genome (National Genomics Data Center, accession number GWHERCA00000000) (see [link to SNP description]). Figure 1 The highlighted site (T) is of significant biological importance. This site is T in the reference sequence but mutated to A in some materials.

[0032] The nucleotide sequence of the dCAP molecular marker is shown in SEQ ID NO: 1: 5' - TGAGTTAGTCTTTATGGCTGACGGTTTATGATGATTAAGGTCCAACTCAGGTGGAATTTCATTATTATGCCCAGCACCTTCAGAGACCTCTAAATGGTCCCTAAGACCATTAATGTCTATACGTGGTGTGGAGAATCCCTCCAAGTATGTGTTTGAACCAGTCAAATCCTTAGTTTTGGAGCTAACATCAGCATTTGCACCAGTCTCAAAGTTTTGATATAAGTTCTCCTT / AAGCTTCATCAGATATCGCATGCCCCATA - 3'.

[0033] 1. Impact on gene function: This SNP is located in the coding region of the microtubule-binding protein gene CLASP. The T>A mutation causes the codon at this location to change to a stop codon (TAG), which prematurely terminates the translation of CLASP gene mRNA, and is presumably led to the production of truncated non-functional protein.

[0034] 2. Association with ripening period: Further statistical analysis of the relationship between the genotype at this locus and the known fruit ripening period in 38 materials (see Table 1) revealed a clear pattern: all extra-early and early-maturing varieties (e.g., numbers 1-19, 22, 25-27, 36 in Table 1) had a heterozygous TA genotype at this locus; while all late-maturing varieties (e.g., the remaining numbers in Table 1) had a homozygous TT genotype at this locus. This result significantly indicates that the T / A mutation at this SNP locus (especially the heterozygous TA genotype) is closely associated with the early ripening trait of Wenzhou mandarin oranges.

[0035] (iv) Development of dCAPs molecular markers: Based on the key SNP locus cosegregating with the precocious trait (chromosome 5, position 39493125, T / A), this invention develops a dCAPs molecular marker for identifying precocious varieties of Wenzhou mandarin oranges. The principle is as follows: Figure 2 As shown.

[0036] 1. Primer Design: Specific primers were designed using the dCAPSFinder2.0 online website (http: / / helix.wustl.edu / dcaps / dcaps.html). The core of the design was to artificially introduce a mismatched base "C" at the penultimate base of the 3' end of the reverse primer (dCAPs-R) (as shown in SEQ ID NO: 3). After binding with the mutant allele "A", it can form a recognition site for the restriction endonuclease HindIII (5'-AAGCTT-3') in the PCR product together with the upstream sequence, while the wild-type allele "T" cannot form this site.

[0037] 2. Primer sequence: Forward primer dCAPs-F: 5'-TGAGTTAGTCTTTATGGCTGACGG-3' (SEQ ID NO: 2) Reverse primer dCAPs-R: 5'-TATGGGGCATGCGATATCTGATGAAGCT-3' (SEQ ID NO: 3) Using this primer pair, a genomic region containing the target SNP site is amplified, with an expected amplification product length of 259 bp (as shown in SEQ ID NO: 1, which contains the target SNP site and the introduced mismatched bases).

[0038] 3. Label Validation: PCR amplification was performed on a subset of samples using the designed primers, and the amplification accuracy was verified by Sanger sequencing. The purified PCR products were then digested with HindIII restriction enzymes for validation, preliminarily confirming the feasibility of the dCAPs label design.

[0039] Example 2: Application of dCAPs molecular markers in identifying the early ripening trait of Wenzhou mandarin oranges (a) Experimental materials The same 38 young leaves of the Wenzhou mandarin orange variety as in Example 1 were used as verification materials (see Table 1).

[0040] (ii) Genomic DNA extraction Genomic DNA was extracted from the leaves of each material using the conventional CTAB method, and the DNA concentration and quality were detected using a micro-ultraviolet spectrophotometer. The concentration was then adjusted to 100-200 ng / μL for later use.

[0041] (III) PCR amplification Using the extracted genomic DNA as a template, PCR amplification was performed using the dCAPs primers designed in Example 1.

[0042] 1. PCR reaction system (50 μL): Genomic DNA (100-200 ng / μL): 4.0 μL; 2×EsTaqMasterMix (Dye): 25 μL; dCAPs-F primer (10 μM): 2.0 μL; dCAPs-R primer (10 μM): 2.0 μL; ddH2O: bring to 50 μL 2. PCR reaction procedure: Pre-denaturation at 95°C: 5 minutes; denaturation at 95°C: 30 seconds; annealing at 57°C: 30 seconds; extension at 72°C: 30 seconds; number of cycles: 30; final extension at 72°C: 5 minutes; store at 4°C.

[0043] After the reaction is complete, a small amount of the product can be taken for routine agarose gel electrophoresis to confirm the amplification of a single 259bp band.

[0044] (iv) Restriction endonuclease digestion The purified PCR products were digested with HindIII restriction enzyme to distinguish genotypes.

[0045] 1. Enzyme digestion reaction system (30μL): PCR purified product: 25μL; HindIII restriction enzyme: 1.0μL; 10×FastBuffer: 2.0μL; ddH2O: 2.0μL.

[0046] 2. Enzyme digestion conditions: Incubate at 37°C in a water bath for 30 minutes, followed by heating at 80°C for 20 minutes to inactivate the endonuclease.

[0047] (v) Electrophoresis detection and result interpretation Two electrophoresis methods were used to detect the enzyme digestion products, and the results were consistent.

[0048] 1. Agarose gel electrophoresis: Prepare a 5% agarose gel, load 10-15 μL of the enzyme digestion product onto the gel, and electrophores at a constant voltage of 90 V for 50 minutes in 1×TAE buffer. Observe and photograph the gel using a gel imaging system. Typical results are shown below. Figure 3 As shown (agarose gel electrophoresis image).

[0049] 2. Capillary electrophoresis: Capillary electrophoresis systems, such as those used in bioanalyzers (e.g., Agilent 2100), can also be used to analyze the enzyme digestion products. The results are as follows: Figure 3 As shown (capillary electrophoresis diagram).

[0050] 3. Genotype and Maturity Interpretation Criteria: Interpretation of late-maturing varieties: If the electrophoresis results show only one 259bp DNA fragment (e.g.) Figure 3 The middle lane indicates that the SNP site did not form a HindIII restriction site, and the sample at this site is homozygous for the TT genotype, corresponding to a late-maturing variety.

[0051] Interpretation of early-maturing varieties: If the electrophoresis results show the presence of two DNA fragments, approximately 234bp and 25bp in size, respectively (since small fragments may diffuse and are not easily visible in agarose gels, the 234bp band is the primary focus of observation), it indicates that the PCR product was completely cleaved by HindIII, and the sample at this locus is a heterozygous TA genotype, corresponding to an early-maturing or extra-early-maturing variety.

[0052] (vi) Application Validation Results The method established above was used to test all 38 Wenzhou mandarin orange samples, and the electrophoresis results were clearly distinguishable. Figure 3 The interpretation results were completely consistent with the genotypes obtained based on resequencing and the known fruit ripening information in Table 1. Specifically, the restriction enzyme digests of all 22 early / extra-early ripening varieties (TA genotype) were cleaved, showing a characteristic band of 234 bp in the electrophoresis diagram; the restriction enzyme digests of all 16 late ripening varieties (TT genotype) remained intact, retaining a complete band of 259 bp. This fully demonstrates that the dCAPs molecular markers developed in this invention can stably and accurately distinguish between early and late ripening varieties of Wenzhou mandarin oranges.

[0053] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A molecular marker of dCAPs associated with the early ripening trait of Wenzhou mandarin oranges, characterized in that, The molecular marker includes an SNP site located at position 39493125 on chromosome 5 of the Wenzhou mandarin genome, wherein the nucleotide of the SNP site is T or A, and the accession number of the Wenzhou mandarin genome in the National Genomics Data Center is GWHERCA00000000.

2. The dCAPs molecular marker according to claim 1, characterized in that, The molecular marker contains a nucleotide sequence as shown in SEQ ID NO:

1.

3. A primer pair for detecting the dCAPs molecular markers of claim 1 or 2, characterized in that, It includes a forward primer and a reverse primer, wherein the forward primer contains the nucleotide sequence shown in SEQ ID NO: 2 and the reverse primer contains the nucleotide sequence shown in SEQ ID NO:

3.

4. The use of the primer pair according to claim 3 in the preparation of a kit for identifying the ripening period of Wenzhou mandarin oranges.

5. A method for identifying the ripening period of Wenzhou mandarin oranges, characterized in that, Includes the following steps: Step (1): Extract genomic DNA from the Wenzhou mandarin orange sample to be tested; Step (2): Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 3 to obtain the amplification product; Step (3): The amplification product obtained in step (2) is digested with the restriction endonuclease HindIII to obtain the digested product; Step (4) Detect the enzyme digestion product obtained in step (3): If the enzyme digestion product shows a single DNA fragment of about 259 bp, the Wenzhou mandarin orange sample is determined to be homozygous TT genotype at the SNP site and belongs to a late-maturing variety; if the enzyme digestion product shows two DNA fragments with a length difference of about 25 bp, the Wenzhou mandarin orange sample is determined to be heterozygous TA genotype at the SNP site and belongs to an early-maturing variety.

6. The method according to claim 5, characterized in that, The product length of the PCR amplification in step (2) is 259 bp.

7. The method according to claim 5, characterized in that, In step (4), the enzyme digestion products are detected by agarose gel electrophoresis or capillary electrophoresis.

8. A kit for identifying the ripening period of Satsuma mandarin oranges, characterized in that, It contains the primer pair as described in claim 3 and the restriction endonuclease HindIII.

Images