Suspended graphene field effect transistor, preparation method thereof and application of suspended graphene field effect transistor in biosensor

Abstract

The invention belongs to the technical field of biomarker detection, and particularly relates to a suspended graphene field effect transistor, a preparation method thereof and application of the suspended graphene field effect transistor in a biosensor. The suspended graphene field effect transistor provided by the invention comprises a substrate, wherein a groove is formed in the upper surface of the substrate; the insulating layers are arranged on the upper surface, except for the groove, of the substrate, the side wall of the groove and the bottom surface of the groove, the electrode layers are arranged on the upper surfaces of the insulating layers and comprise source electrodes and drain electrodes, and the source electrodes and the drain electrodes are located on the upper surfaces of the insulating layers on the two sides of the groove respectively; and the single-layer graphene film is arranged on the upper surface of the electrode layer, covers the groove and is communicated with the source electrode and the drain electrode. The suspended graphene field effect transistor provided by the invention can realize miR-21 detection without marking, is high in detection sensitivity and low in detection limit, can realize miR-21 detection in a fly mole magnitude, and provides a technical approach for promoting early cancer diagnosis.

Description

Technical Field

[0001] This invention belongs to the field of biomarker detection technology, specifically relating to a suspended graphene field-effect transistor, its fabrication method, and its application in biosensors. Background Technology

[0002] Early detection of cancer largely relies on identifying molecular markers that indicate the onset of malignant transformation. Among these biomolecules, microRNAs (miRNAs) have become important regulators of gene expression and are associated with tumorigenesis, development, and metastasis. microRNA-21 (miR-21) is one of the most frequently upregulated oncogenic miRNAs and is closely associated with the development of breast cancer, liver cancer, and several other solid tumors. Because its overexpression is closely related to disease stage and clinical prognosis, miR-21 is widely considered a valuable biomarker for early diagnosis and treatment monitoring. Therefore, the ability to rapidly, sensitively, and without the need for additional molecular markers to detect miR-21 is of great significance for improving clinical outcomes.

[0003] However, current detection standards, such as quantitative polymerase chain reaction (qPCR) and enzyme-linked immunosorbent assay (ELISA), rely on multi-step sample preparation and enzyme amplification, which often face limitations in sensitivity and operational complexity. Summary of the Invention

[0004] The purpose of this invention is to provide a suspended graphene field-effect transistor, its fabrication method, and its application in biosensors. The suspended graphene field-effect transistor provided by this invention can achieve label-free miR-21 detection with high detection sensitivity and low detection limit, enabling femtomolar miR-21 detection, thus providing a technical approach for advancing early cancer diagnosis.

[0005] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a suspended graphene field-effect transistor, comprising a substrate, wherein a groove is formed on the upper surface of the substrate; an insulating layer disposed on the upper surface of the substrate excluding the groove, the sidewalls of the groove, and the bottom surface of the groove; an electrode layer disposed on the upper surface of the insulating layer, the electrode layer including a source and a drain, the source and drain being located on opposite sides of the upper surface of the insulating layer of the groove; and a monolayer graphene film disposed on the upper surface of the electrode layer, the monolayer graphene film covering the groove and communicating with the source and drain.

[0006] Preferably, the electrode layer is made of elemental gold; the thickness of the electrode layer is 40~60 nm.

[0007] Preferably, the substrate is a Si substrate and the insulating layer is a SiO2 layer.

[0008] This invention provides a method for fabricating the suspended graphene field-effect transistor described above, comprising the following steps: Grooves are etched on the upper surface of the substrate, then an insulating layer is prepared, then an electrode material film is deposited, and then the electrode material film is patterned to obtain the source and drain electrodes. An electrode layer is obtained on the upper surface of the insulating layer. The single-layer graphene film is transferred to the upper surface of the electrode layer to cover the groove, while the source and drain are connected to obtain a semi-finished device. The semi-finished device is annealed to obtain the suspended graphene field-effect transistor.

[0009] Preferably, the annealing process is carried out in a reducing atmosphere, which includes hydrogen and an inert gas, and the annealing temperature is 150~180°C.

[0010] Preferably, the single-layer graphene film is prepared by chemical vapor deposition; the etching method for the groove is a combination of photolithography and inductively coupled plasma etching; and the deposition method for the electrode material film includes electron beam evaporation or magnetron sputtering.

[0011] This invention provides the application of the suspended graphene field-effect transistor described in the above technical solution or the suspended graphene field-effect transistor prepared by the preparation method described in the above technical solution in the preparation of biosensors for detecting biomarkers.

[0012] This invention provides a biological detection kit, comprising a suspended graphene field-effect transistor as described in the above technical solution or a suspended graphene field-effect transistor prepared by the preparation method described in the above technical solution, a surface functionalization reagent, and a detection probe.

[0013] Preferably, the surface functionalizing agent is a solution of 1-pyrenebutyric acid N-hydroxysuccinimide ester; the detection probe is an amino-modified DNA probe, and the nucleotide sequence of the amino-modified DNA probe is shown in SEQ ID NO.2.

[0014] This invention provides a biosensor, comprising a suspended graphene field-effect transistor as described in the above technical solution or a suspended graphene field-effect transistor prepared by the preparation method described in the above technical solution, and a detection probe modified on the surface of the monolayer graphene film.

[0015] This invention provides a suspended graphene field-effect transistor (referred to as a suspended GFET device, or suspended device), comprising a substrate, wherein a groove is formed on the upper surface of the substrate; an insulating layer disposed on the upper surface of the substrate excluding the groove, the sidewalls of the groove, and the bottom surface of the groove; an electrode layer disposed on the upper surface of the insulating layer, the electrode layer including a source and a drain, the source and drain being located on opposite sides of the upper surface of the insulating layer on the groove; and a monolayer graphene film disposed on the upper surface of the electrode layer, the monolayer graphene film covering the groove and communicating with the source and drain. In the suspended GFET device provided by this invention, the monolayer graphene film is disposed above the groove, and simultaneously contacts both the source and drain, thereby suspending the monolayer graphene film above the groove and forming a suspended graphene channel in the region between the source and drain. In conventional graphene field-effect transistors (GFETs), the monolayer graphene film sits on the surface of a flat substrate (without a groove structure) (called a support device, or supported device). Compared to a support device, this invention separates the graphene channel formed by the monolayer graphene film from the substrate by creating grooves on the substrate. The floating GFET device designed in this invention can effectively minimize substrate-induced scattering while retaining the inherent electronic properties of the monolayer graphene film material, thereby effectively reducing noise and enhancing signal conduction. Meanwhile, the suspended GFET device provided by this invention has a groove structure on its substrate surface. A graphene channel formed by a single-layer graphene film between the source and drain electrodes is suspended above the groove. This allows both surfaces of the graphene channel to be functionally modified and connected to detection probes. In other words, both surfaces of the graphene channel can be used to contact and react with the analyte. Therefore, in wet detection, both surfaces of the graphene channel are exposed to the detection solution, enabling the binding of the analyte to both sides of the graphene channel. This means that both surfaces of the graphene channel can specifically capture the target biostandard (e.g., miR-21), thereby enhancing the electrical signal. The suspended GFET device provided by this invention enables sensitive and label-free miR-21 detection. The suspended graphene channel structure formed by the suspended GFET device provided by this invention effectively enhances signal modulation and lowers the detection limit, providing a technical approach for advancing early cancer diagnosis.

[0016] The results of the embodiments show that the suspended GFET device provided by the present invention can minimize substrate-induced scattering. Compared with the supported device, the suspended GFET device provided by the present invention has improved carrier mobility and reduced electrical noise. Raman spectroscopy analysis of the embodiments confirms that after surface functionalization treatment, the graphene channel of the suspended GFET device provided by the present invention maintains its structural integrity. The embodiments of the present invention systematically evaluate the performance of the suspended GFET device as a biosensor. Concentration-dependent measurements of miR-21 show that the relative resistance (ΔR / R0) increases monotonically (with increasing target concentration), and the Dirac point (V0) is... Dirac The detection limit also shifts accordingly in the positive direction, indicating that it is on the femtomolar scale. The results of the embodiments demonstrate that the suspended GFET device provided by this invention can effectively convert the molecular binding process into a measurable electrical signal. The results of the embodiments also demonstrate that the suspended GFET device provided by this invention, combined with a stable surface functionalization strategy, can serve as a sensitive platform for nucleic acid detection. It enables label-free quantitative analysis of low-abundance microRNA biomarkers, indicating its application potential in biomedical research and diagnostics. Attached Figure Description

[0017] Figure 1 The detection principle diagram of the suspended graphene field-effect transistor and biosensor provided by the present invention; Figure 2 Flowchart of surface functionalization and miR-21 detection of a single-layer graphene film for a suspended graphene field-effect transistor provided by the present invention. Figure 3 The image shows the fabrication and characterization of the suspended GFET device prepared in Example 1. Figure 4 The sensing mechanism and performance characterization diagram of the suspended graphene field-effect transistor provided by the present invention; Figure 5 The quantitative performance test results of the suspended graphene field-effect transistor provided by the present invention; Figure 6 The specific analysis results of the suspended graphene field-effect transistor provided by the present invention. Detailed Implementation

[0018] This invention provides a suspended graphene field-effect transistor, comprising a substrate, wherein a groove is formed on the upper surface of the substrate; an insulating layer disposed on the upper surface of the substrate excluding the groove, the sidewalls of the groove, and the bottom surface of the groove; an electrode layer disposed on the upper surface of the insulating layer, the electrode layer including a source and a drain, the source and drain being located on opposite sides of the upper surface of the insulating layer of the groove; and a monolayer graphene film disposed on the upper surface of the electrode layer, the monolayer graphene film covering the groove and communicating with the source and drain.

[0019] In this invention, unless otherwise specified, all raw materials / components used in the preparation are commercially available products well known to those skilled in the art.

[0020] The structural schematic diagram of the suspended graphene field-effect transistor provided by this invention is shown below. Figure 1 As shown below, in conjunction with Figure 1 The suspended graphene field-effect transistor provided by the present invention will be described in detail.

[0021] The suspended graphene field-effect transistor provided by this invention includes a substrate, the upper surface of which is provided with grooves. In this invention, the substrate is preferably a Si substrate. In this invention, the cross-section of the groove can be quadrilateral, specifically rectangular. In this invention, the width of the groove is preferably 15-20 μm, more preferably 18-20 μm. The depth of the groove is preferably 3-6 μm, more preferably 4-6 μm. The groove is arranged in a non-linear form on the substrate to increase the effective area of ​​the graphene channel suspended on the substrate surface. In an embodiment of this invention, the groove presents a continuous Z-shaped structure on the substrate.

[0022] The suspended graphene field-effect transistor provided by this invention includes an insulating layer disposed on the upper surface of the substrate (excluding the groove), the sidewalls of the groove, and the bottom surface of the groove. In this invention, the insulating layer is preferably a SiO2 layer. The thickness of the insulating layer is preferably 5-10 nm, and in the embodiment, it can be 10 nm. The function of the insulating layer is to prevent leakage current in the suspended graphene field-effect transistor.

[0023] The suspended graphene field-effect transistor provided by this invention includes an electrode layer disposed on the upper surface of the insulating layer. The electrode layer includes a source and a drain, which are respectively located on the upper surfaces of the substrate on both sides of the groove. In this invention, the material of the electrode layer is preferably elemental gold. The thickness of the electrode layer is preferably 40-60 nm, and in this embodiment, it can be 50 nm.

[0024] The suspended graphene field-effect transistor provided by this invention includes a monolayer graphene film disposed on the upper surface of the electrode layer. The monolayer graphene film covers the groove and connects the source and drain. The monolayer graphene film is in contact with the source and simultaneously with the drain. A graphene channel is formed in the region of the monolayer graphene film above the groove.

[0025] This invention provides a method for fabricating the suspended graphene field-effect transistor described above, comprising the following steps: Grooves are etched on the upper surface of the substrate, then an insulating layer is prepared, then an electrode material film is deposited, and then the electrode material film is patterned to obtain the source and drain electrodes. An electrode layer is obtained on the upper surface of the insulating layer. The single-layer graphene film is transferred to the upper surface of the electrode layer to cover the groove, while the source and drain are connected to obtain a semi-finished device. The semi-finished device is annealed to obtain the suspended graphene field-effect transistor.

[0026] This invention involves etching grooves on the upper surface of a substrate, then preparing an insulating layer, depositing an electrode material film, and patterning the electrode material film to obtain source and drain electrodes. An electrode layer is then formed on the upper surface of the insulating layer. In this invention, the groove etching method is a combination of photolithography and inductively coupled plasma (ICP) etching. The etching gases used in the ICP etching preferably include C4F8 and SF6. In this invention, the combination of photolithography and ICP etching preferably includes: patterning the upper surface of the substrate with photoresist to obtain the area to be etched; and then performing automated etching using an ICP device, with the etching program of the ICP device set to 15 cycles.

[0027] In this invention, when the substrate is preferably a Si substrate, after obtaining the groove, the substrate with the groove is preferably oxidized to obtain the insulating layer.

[0028] In this invention, the deposition method of the electrode material thin film preferably includes electron beam evaporation or magnetron sputtering. The operating pressure of the magnetron sputtering is preferably 2 × 10⁻⁶. -4 Pa. The reagents used in the patterning process preferably include n-methyl-2-pyrrolidone (NMP).

[0029] After obtaining the electrode layer, the present invention transfers the monolayer graphene film onto the upper surface of the electrode layer, covering the groove, and simultaneously connecting the source and drain electrodes to obtain a semi-finished device. In the present invention, the monolayer graphene film is preferably prepared by chemical vapor deposition. The preferred method for preparing the monolayer graphene film includes: placing a substrate in a tube furnace, introducing a reaction gas and a carrier gas into the tube furnace, depositing monolayer graphene on the surface of the substrate, and obtaining a monolayer graphene film on the surface of the substrate. The reaction gas preferably includes methane and hydrogen. The carrier gas is preferably argon. The flow rate of methane is preferably 20-40 sccm, more preferably 30 sccm. The flow rate of hydrogen is preferably 40-60 sccm, more preferably 50 sccm. The flow rate of the carrier gas is preferably 150-250 sccm, more preferably 200 sccm. The deposition temperature is preferably 1000-1100℃, and in the embodiment, it can be 1050℃. The deposition time is preferably 30-40 min. The substrate is preferably copper foil. Prior to deposition, the substrate is preferably pretreated, which preferably includes sequential pre-cleaning and drying. The pre-cleaning preferably involves immersing the substrate sequentially in an ammonium persulfate aqueous solution, deionized water, and ethanol. The molar concentration of ammonium sulfate in the ammonium silicate aqueous solution is preferably 0.1 mol / L. The drying is preferably nitrogen blowing. The substrate is placed in a tube furnace, and then preferably the tube furnace is evacuated to 10 °C. -6 The process involves heating the tube furnace to 100-150°C under hydrogen gas and holding for 5-10 minutes for degassing; then further heating to 1000-1035°C and holding for 20-30 minutes for substrate purification. The preferred hydrogen flow rate is 1-2 sccm. The preferred pressure in the tube furnace during degassing is 15-20 mTorr. When the substrate is copper foil, this invention removes oxides from the copper foil surface through substrate purification, while simultaneously increasing the grain size within the copper foil. Furthermore, through degassing and substrate purification, this invention enables graphene to grow more uniformly on the substrate surface, resulting in better single-crystal growth of graphene and higher growth uniformity.

[0030] The present invention preferably employs a PMMA-assisted wet transfer method to transfer a single-layer graphene film located on the substrate surface onto the electrode layer. After transfer, the PMMA support layer is removed by dissolving it in acetone and ethanol.

[0031] After obtaining the semi-finished device, the present invention anneales the semi-finished device to obtain the suspended graphene field-effect transistor. In the present invention, the annealing treatment is preferably carried out in a reducing atmosphere, which preferably includes hydrogen and an inert gas. The inert gas is preferably argon. The volume ratio of hydrogen to the inert gas is preferably 4:1. The annealing temperature is preferably 150~180℃. The annealing time is preferably 20~40 min, and in the embodiment, it can be 30 min.

[0032] This invention provides the application of the suspended graphene field-effect transistor described in the above technical solution or the suspended graphene field-effect transistor prepared by the preparation method described in the above technical solution in the preparation of biosensors for detecting biomarkers.

[0033] In this invention, the biomarker can be a ribonucleic acid biomarker, and in the example, it can be miR-21.

[0034] This invention provides a biological detection kit, comprising a suspended graphene field-effect transistor as described in the above technical solution or a suspended graphene field-effect transistor prepared by the preparation method described in the above technical solution, a surface functionalization reagent, and a detection probe.

[0035] In this invention, the surface functionalizing agent is preferably a solution of 1-pyrenebutyric acid N-hydroxysuccinimide. The 1-pyrenebutyric acid N-hydroxysuccinimide solution is preferably an organic solvent for 1-pyrenebutyric acid N-hydroxysuccinimide, and the organic solvent in the 1-pyrenebutyric acid N-hydroxysuccinimide solution is preferably anhydrous N,N-dimethylformamide (DMF). The molar concentration of 1-pyrenebutyric acid N-hydroxysuccinimide in the 1-pyrenebutyric acid N-hydroxysuccinimide solution is preferably 7.5~8 mM, and in the examples it can be 7.8 mM.

[0036] In this invention, the detection probe is preferably a peptide polynucleotide oligomer (PMO) probe, and in the examples, it can be an amino-modified DNA probe, the nucleotide sequence of which is shown in SEQ ID NO.2. In this invention, the 5' end of the amino-modified DNA probe has a six-carbon (C6) chain with a terminal amino group. SEQ ID NO.2 is TTTTTTTCAACATCAGTCTGATAAGCTA.

[0037] In this invention, the detection probe is used in the form of a detection probe solution, which is preferably a PBS solution of the detection probe, wherein the pH value of the PBS is preferably 7.4 to 7.8.

[0038] In this invention, the bioassay kit is preferably used to detect miR-21. The nucleotide sequence of miR-21 is shown in SEQ ID NO.1.

[0039] In this invention, SEQ ID NO.1 is UAGCUUAUCAGACUGAUGUUGA.

[0040] When the bioassay kit provided by this invention is applied to miR-21 detection, it is preferable to first modify the suspended graphene field-effect transistor with a surface-functionalization reagent to obtain a modified device, and then use a detection probe to react with the modified device to obtain a biosensor; then the biosensor is used to detect miR-21, preferably in the form of a miR-21 test solution. The specific preparation method of the biosensor in this invention is described below.

[0041] This invention provides a biosensor, comprising a suspended graphene field-effect transistor as described in the above technical solution or a suspended graphene field-effect transistor prepared by the preparation method described in the above technical solution, and a detection probe modified on the surface of the monolayer graphene film.

[0042] In this invention, the method for preparing the biosensor preferably includes the following steps: The suspended graphene field-effect transistor is immersed in a surface functionalizing agent for incubation to obtain a modified device. The surface (preferably a dual surface) of the monolayer graphene film of the modified device is modified with functional groups of the surface functionalizing agent. The biosensor is obtained by combining the monolayer graphene film of the modified device with the detection probe solution.

[0043] In this invention, the surface functionalizing agent is preferably a solution of 1-pyrenebutyric acid N-hydroxysuccinimide. The 1-pyrenebutyric acid N-hydroxysuccinimide solution is preferably an organic solvent for 1-pyrenebutyric acid N-hydroxysuccinimide, and the organic solvent in the 1-pyrenebutyric acid N-hydroxysuccinimide solution is preferably anhydrous N,N-dimethylformamide (DMF). The molar concentration of 1-pyrenebutyric acid N-hydroxysuccinimide in the 1-pyrenebutyric acid N-hydroxysuccinimide solution is preferably 7.5~8 mM, and in the examples, it can be 7.8 mM. The incubation temperature can be room temperature. The incubation time is preferably 0.5~1 h. After the incubation, washing is performed to obtain the modified device. The washing reagents are preferably N,N-dimethylformamide (DMF), isopropanol (IPA), and ultrapure water, in that order.

[0044] In this invention, the detection probe solution is preferably a PBS solution of an amino-modified DNA probe, wherein the molar concentration of the amino-modified DNA probe is preferably 1-2 µM. The binding is performed in a dark environment, and the binding time is preferably 40-60 min. After the binding is complete, this invention preferably uses PBS and ultrapure water to wash away any unbound amino-modified DNA probe.

[0045] In this invention, when the biosensor detects a biological standard (e.g., miR-21), it first performs a blank background detection. The blank solvent used for the blank background detection can be PBS solution with a pH of 7.4-7.8. After the blank background detection is completed, the biomarker to be tested is detected. Preferably, the biological standard is detected in the form of a blank background detection solution. In this embodiment of the invention, miR-21 is dissolved in PBS solution to establish a standard curve and detect miR-21.

[0046] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1 This embodiment provides a method for fabricating a suspended graphene field-effect transistor (suspended device), specifically including the following steps: (1) A single-layer graphene film was synthesized on copper foil using chemical vapor deposition (CVD). The copper foil was pre-cleaned by sequentially immersing it in 0.1M ammonium persulfate aqueous solution, deionized water, and ethanol, followed by nitrogen drying. To minimize contamination, the Cu foil was cut to a suitable size, folded into a closed bag, and placed in the central constant temperature zone of the tubular furnace quartz tube before being loaded into the quartz furnace. The vacuum was then evacuated to 10... -6 Torr was used to remove residual air from the tube. Hydrogen gas was introduced (flow rate 2 sccm), and the pressure was maintained at 20 mTorr. The temperature was raised to 150 °C and held for 10 minutes to remove water vapor. The temperature was then raised to 1035 °C and held for 30 minutes to remove surface oxides and increase the grain size of the Cu substrate. Then, at 1050 °C, CH4 (30 sccm) and H2 (50 sccm) were introduced into an Ar flow (200 sccm) and introduced into the quartz tube of the tubular furnace to begin growth. After 40 minutes, the furnace chamber was rapidly cooled under the same gas mixture as during growth, resulting in a monolayer graphene film on the copper foil surface.

[0048] (2) Grooves were etched on the substrate using standard photolithography and inductively coupled plasma (ICP) with a C4F8 / SF6 gas mixture (specifically, the area to be etched was first patterned with photoresist, and then automated etching was performed using an ICP device, with the etching program set to 15 cycles). After removing the photoresist, the substrate was evaporated or sputtered by electron beam (2×10⁻⁶). -4 Pa) deposits a 50 nm thick gold film on the substrate after etching grooves, and then uses n-methyl-2-pyrrolidone (NMP) to pattern the gold film into source and drain electrodes to obtain a patterned substrate.

[0049] Then, the CVD-grown monolayer graphene film from step (1) was transferred onto a patterned substrate using a PMMA-assisted wet transfer method, positioning the monolayer graphene film to bridge the grooves. The PMMA support layer was then removed using acetone and ethanol.

[0050] The completed device was then annealed at 180°C in an Ar / H2 environment (hydrogen to argon volume ratio of 4:1) for 30 minutes to remove transfer residues and obtain a suspended GFET device.

[0051] (3) Functionalize the monolayer graphene film of the suspended GFET device obtained in step (2). The entire process of surface functionalization of the monolayer graphene film and miR-21 detection in this embodiment is as follows: Figure 2 As shown. Figure 2The schematic diagram of the surface functionalization and detection process in Example 1 is as follows: (i) PBASE is non-covalently attached to a monolayer graphene film through π-π stacking. (ii) Aminated DNA probes are covalently immobilized on the PBASE layer. (iii) The target miR-21 in the sample hybridizes with the complementary probe (aminated DNA probe), inducing an electrical signal change in the bottom GFET. First, the device obtained in step (2) was placed in a 7.8 mM solution of 1-pyrene butyrate N-hydroxysuccinimide ester (PBASE) (solvent is anhydrous N,N-dimethylformamide (DMF)) and incubated at room temperature for 1 hour. Then it was rinsed with DMF, isopropanol (IPA) and ultrapure water, and then immediately the PBASE-modified device was incubated with a 2 µM aminated DNA probe solution (sequence details are in Table 1) in PBS (pH=7.8) for 40 minutes (incubation was carried out in the dark) to promote covalent binding (the activated ester moiety of PBASE will undergo a condensation reaction with the amino group). The sequence of the aminated DNA probe is complementary to miR-21, and the aminated DNA probe includes a 3' FAM tag for fluorescence verification. Unbound aminated DNA probes are removed by rinsing with PBS and ultrapure water to obtain a functionalized GFET. The functionalized GFET is a biosensor, which is a biosensor covalently bound to an aminated DNA probe on the surface of a monolayer graphene film.

[0052] (4) The miR-21 stock solution synthesized in this embodiment (10µM in RNase-free water) was stored at -80℃.

[0053] In hybridization experiments, working solutions were freshly prepared in a buffer (1× SSC or 1× PBS, pH=7.4) containing 0.05% Tween-20 and 1 U / mL RNase inhibitor (the concentration of miR-21 in the working solution was 10 fM~100 nM).

[0054] The detection method for miR-21 is as follows: the functionalized GFET obtained in step (3) is incubated with miR-21 solution (i.e. working solution), then rinsed with buffer (1×PBS, pH=7.4), and then electrical measurements are performed.

[0055] Table 1. Oligonucleotide sequences used in Example 1

[0056] Comparative Example 1 This embodiment provides a method for fabricating a graphene field-effect transistor (support device), which is basically the same as the method in Embodiment 1, except that: step (2) is: without etching grooves on the Si substrate, the graphene is directly evaporated or sputtered by electron beam (2×10⁻⁶).-4 Pa) deposits a 50 nm thick gold film on a substrate, and then uses n-methyl-2-pyrrolidone (NMP) to pattern the gold film into source and drain electrodes to obtain a patterned substrate.

[0057] Test case (1) Characterization and electrical measurement This invention utilizes field emission scanning electron microscopy (FE-SEM) to examine the device morphology and the integrity of the monolayer graphene. Laser confocal microscopy confirmed the successful immobilization and spatial distribution of the FAM-labeled probes. All electrical measurements were performed using a Keithley 4200A-SCS semiconductor parameter analyzer. A fixed gate voltage of 50mV was set, while the source-drain voltage V0 was... DS Record transfer characteristics (I) from -2V to +2V (in 0.05V steps). DS vs. V DS That is, the rate of change of resistance between the source and drain electrodes. These scans are performed after each manufacturing and functionalization step to monitor D. irac Point and device stability. For real-time sensing, at a fixed V... DS = 100 mV and V G = 50 mV to monitor device resistance. Increasing concentrations of miR-21 solution (5 fM, 50 fM, 500 fM, 5 pM, and 50 pM) were sequentially introduced into the sensor surface. After each addition, the system was allowed to stabilize for 5 minutes while the current was continuously recorded. Empirically determined, this duration was sufficient for the signal to reach a stable plateau; this invention defines it as a signal drift of less than 0.5% over a 60-second interval. The sensor response was quantified as a relative resistance change (ΔR / R0), calculated from real-time current data.

[0058] (2) Results and Discussion Device fabrication and characterization: Microscopic analysis confirmed the structural integrity of the manufacturing apparatus. Figure 3 Fabrication and characterization of the floating GFET device prepared in Example 1. Figure 3 (a) in the image is a SEM image of the ICP etched groove. Figure 3 (b) shows the Raman spectra of graphene in the suspended and non-suspended regions, displaying the characteristic G and 2D bands. Figure 3 (c) is an optical microscope image of the etching process on the Si substrate. Figure 3 (d) in the image is an optical image of the gold electrodes arranged on the groove. Figure 3 (e) in the image shows the fluorescence image of the channel functionalized with FAM-labeled DNA probes, comparing the suspended region and the substrate-supported region. Figure 3 (f) in the image is a photograph of the packaging equipment during the electrical measurement process.

[0059] like Figure 3 As shown in (a) and (c), the ICP-etched grooves exhibit uniform depth and well-defined edges, with gold electrodes precisely aligned on them. Figure 3 (as shown in (d)). Raman spectroscopy was used to evaluate the quality of the transferred graphene channels ( Figure 3 (as shown in (b)). Compared to the substrate support region, the suspended monolayer graphene film exhibits higher performance at G(~4 cm⁻¹). -1 ) and 2D (~8 cm) -1 The band showed a decline, I 2D / I G The peak width was narrower and higher than normal. These spectral characteristics indicate reduced strain relaxation and substrate-induced doping, confirming the high crystallinity of the suspended channel. Fluorescence microscopy confirmed successful DNA probe immobilization. FAM-labeled probes showed that the fluorescence intensity of the suspended graphene channel was significantly higher than that of the non-suspended region (…). Figure 3 (as shown in (e)). This result indicates enhanced molecular accessibility on the graphene surface. Figure 3 (f) shows a fully packaged device configured with an electrolyte reservoir (1×PBS, pH=7.4) for liquid gate measurement. These characteristics validate the successful fabrication of a high-quality suspended GFET, establishing a robust platform for high-sensitivity biosensing.

[0060] Sensing mechanism and performance characterization: The response of the device to surface functionalization and target binding was investigated using spectroscopic and electrical methods to elucidate the sensing mechanism. Figure 4 This is a diagram illustrating the sensing mechanism and performance characteristics. Figure 4 (a) and (b) in the figure are the Raman spectra of supported graphene and suspended graphene under successive functionalization steps (original, PBASE modification, probe DNA functionalization and RNA hybridization). Figure 4 (c) in the figure represents the transfer curve of the supporting device during the functionalization process. Figure 4 (d) in the figure represents a comparison of the Dirac point displacement (ΔV) of the two devices throughout the functionalization process. Dirac ).

[0061] Raman spectroscopy is used to track the progressive functionalization of suspended and supported graphene devices. Figure 4 (a) and (b) in the original state). With the support device (~1585 cm) -1 In contrast, suspended graphene exhibits a shifted G peak (~1579 cm⁻¹). -1 ) and higher I 2D / I GThe ratio indicates initial strain and doping reduction. Subsequent functionalization with PBASE and probe DNA resulted in an upshift of the G peak in both devices, consistent with p-type doping. Notably, the total G peak rise of the suspended device was ~16 cm⁻¹. -1 Approximately 8 cm (support device) -1 Twice that of the peak D. Throughout the process, the peak intensity (~1350 cm⁻¹) was... -1 The low spectral shift confirms that the modification is non-destructive. This significantly larger spectral shift, due to the absence of substrate screening, directly demonstrates the superior sensitivity of suspended graphene to surface charge modulation.

[0062] By measuring the transfer curve and the corresponding Dirac point voltage (V) Dirac This was used to track the functionalized electrical response. The original floating device showed a value close to 0 V. Dirac The V, while the support device shows slight initial p doping ( Figure 4 (as shown in (c)). Each subsequent functionalization step induced a change in V in both devices. Dirac The gradual positive displacement is consistent with the expected charge transfer of the attached molecules. Crucially, throughout the process, the Dirac point displacement (ΔV) of the suspending device... Dirac The magnitude of ) has always been larger ( Figure 4 As shown in (d) in the figure, this confirms that its structure more effectively converts surface charge changes into electrical signals.

[0063] Quantitative properties and specificity Figure 5 For quantitative performance and specificity. Figure 5 In the figure (a), the relative resistance change of the graphene-based device was measured at different target analyte concentrations from 5 fM to 50 pM (ΔR / R0=(R-R0) / R0, where R0 is the baseline resistance in PBS buffer). Figure 5 In Figure (b), the sensor response of the suspended graphene device, the supported graphene device, and the corresponding blank control is linearly fitted as a function of analyte concentration. Each data point is the average of measurements from 5 (N=5) independent devices, and the error bars represent the standard deviation. Figure 6 This study focuses on the specificity testing of suspended and supported graphene devices. The relative resistance changes (ΔR / R0) of the target analyte and several non-target analytes were measured, demonstrating selective detection behavior.

[0064] To provide quantitative analysis, this invention used five independent devices (five independent devices prepared in the same batch to verify device homogeneity) to characterize the dose response of the two device types. Figure 5(as shown in (a)). The target miR-21 concentration range is 5 fM to 50 pM. The sensor response was measured and quantified by the relative resistance change (ΔR / R0 = (R-R0) / R0), and a calibration curve was constructed. Figure 5 As shown in (b)), it has high linearity (R>0.996). 2 The obtained linear calibration curves are: y = 0.0072 lg(x) + 0.0015 for the suspended device and y = 0.0037 lg(x) + 0.0013 for the supported device prepared in Comparative Example 1. The sensitivity (slope) of the suspended GFET device is almost twice that of the conventional device (supported device). The blank measurement result in PBS is σ. blank = 5.2 × 10 -6 (Suspension device) and 9.3×10 -5 (Support device). Based on the 3σ / slope method, the detection limit (LOD) of the suspended device was determined to be 7 fM, a 10-fold improvement over the 76 fM of the conventional device. This enhanced performance is attributed to the higher conduction efficiency and lower background noise provided by the suspended structure. The relative standard deviation (RSD) at each concentration point was calculated to be no more than 3%, confirming the excellent device-to-device repeatability achieved through the standardized manufacturing and functionalization scheme of this invention.

[0065] To evaluate the sequence specificity of the biosensor, this invention tested its response to target miR-21, a single-base mismatch sequence (miR-21-1MM, as shown in Table 1, the nucleotide sequence of miR-21-1MM is shown in SEQ ID NO.3, which is UAGCUUAUCAGACUGAUGUAGA) and a double-base mismatch sequence (miR-21-2MM, as shown in Table 1, the nucleotide sequence of miR-21-2MM is shown in SEQ ID NO.4, which is UAGCUUAUCAGUCUGAUGUAGA). Figure 6As shown, the complementary miR-21 exhibits the highest electrical response, while the electrical responses of miR-21-1MM and miR-21-2MM gradually decrease. This indicates that the sensor possesses the ability to distinguish single nucleotide variants. Furthermore, the suspended graphene structure enhances this sequence discrimination capability. This effect can be attributed to improved electrostatic coupling for specific hybridization, coupled with suppression of nonspecific binding in the absence of a substrate. Thus, the suspended structure enhances specificity by increasing the target signal while minimizing the response to mismatched sequences. These spectroscopic and electrical properties consistently demonstrate the enhanced sensitivity of the suspended GFET structure. By decoupling the graphene channel from the substrate, its response to surface binding events—from binder immobilization to target hybridization—is significantly amplified. This makes the suspended platform a more efficient sensor for highly sensitive, label-free biosensing.

[0066] In summary, this invention develops a suspended graphene field-effect transistor (GFET) for tagless electrical detection of miR-21. The suspended architecture aims to minimize substrate-induced scattering, which improves carrier mobility and reduces electrical noise compared to supported devices. Raman spectroscopy analysis confirms that graphene maintains its structural integrity after surface functionalization. The performance of this device as a biosensor was systematically evaluated. Concentration-dependent miR-21 measurements show that the relative resistance (ΔR / R0) increases monotonically with increasing target concentration, and the Dirac point (V0) increases. Dirac The corresponding positive shift indicates the existence of a detection limit within the femtomolar range. These results demonstrate that the suspended GFET platform effectively transduces molecular binding events into measurable electrical signals. This invention shows that the suspended GFET, combined with a stable surface functionalization strategy, can serve as a sensitive platform for nucleic acid detection. The ability to quantify low-abundance miRNA biomarkers indicates its potential application in biomedical research and diagnostics. Furthermore, although the fabrication process employs scalable microfabrication techniques, achieving high-yield, large-scale manufacturing will require optimization of the large-area graphene transfer process. Addressing these issues is crucial for translating this promising technology into a practical point-of-care diagnostic tool.

[0067] The above embodiments illustrate that the present invention provides a suspended graphene field-effect transistor (GFET) for label-free electrical detection of miR-21. This suspended structure aims to minimize substrate-induced scattering, which improves carrier mobility and reduces electrical noise compared to supported devices. Raman spectroscopy analysis confirmed that the graphene maintained its structural integrity after surface functionalization. The performance of this device as a biosensor was systematically evaluated. Concentration-dependent measurements of miR-21 showed a monotonically increasing relative resistance (ΔR / R0) (with increasing target concentration), and the Dirac point (V0) was... DiracThe detection limit also shifts accordingly in the positive direction, indicating that it is on the femtomolar scale. These results demonstrate that the suspended GFET platform can effectively convert molecular binding events into measurable electrical signals. This work shows that the suspended GFET, combined with a stable surface functionalization strategy, can serve as a sensitive platform for nucleic acid detection. Its ability to quantify low-abundance microRNA biomarkers demonstrates its potential application in biomedical research and diagnostics.

[0068] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. Other embodiments can be obtained based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A suspended graphene field-effect transistor, characterized in that, The device includes a substrate, the upper surface of which is provided with a groove; an insulating layer disposed on the upper surface of the substrate excluding the groove, the sidewalls of the groove, and the bottom surface of the groove; and an electrode layer disposed on the upper surface of the insulating layer, the electrode layer including a source electrode and a drain electrode, the source electrode and the drain electrode being located on the upper surfaces of the insulating layer on both sides of the groove. A single-layer graphene film is disposed on the upper surface of the electrode layer, the single-layer graphene film covering the groove and connecting the source and drain electrodes.

2. The suspended graphene field-effect transistor according to claim 1, characterized in that, The electrode layer is made of elemental gold; the thickness of the electrode layer is 40~60 nm.

3. The suspended graphene field-effect transistor according to claim 1 or 2, characterized in that, The substrate is a Si substrate, and the insulating layer is a SiO2 layer.

4. The method for fabricating the suspended graphene field-effect transistor according to any one of claims 1 to 3, characterized in that, Includes the following steps: Grooves are etched on the upper surface of the substrate, then an insulating layer is prepared, then an electrode material film is deposited, and then the electrode material film is patterned to obtain the source and drain electrodes. An electrode layer is obtained on the upper surface of the insulating layer. The single-layer graphene film is transferred to the upper surface of the electrode layer to cover the groove, while the source and drain are connected to obtain a semi-finished device. The semi-finished device is annealed to obtain the suspended graphene field-effect transistor.

5. The preparation method according to claim 4, wherein the annealing treatment is carried out in a reducing atmosphere, the reducing atmosphere including hydrogen and an inert gas, and the annealing temperature is 150~180℃.

6. The preparation method according to claim 4, characterized in that, The single-layer graphene film is prepared by chemical vapor deposition; the etching method of the groove is a combination of photolithography and inductively coupled plasma etching; the deposition method of the electrode material film includes electron beam evaporation or magnetron sputtering.

7. The application of the suspended graphene field-effect transistor according to any one of claims 1 to 3 or the suspended graphene field-effect transistor prepared by the preparation method according to any one of claims 4 to 7 in the preparation of a biosensor for detecting biomarkers.

8. A biological detection kit, characterized in that, The invention includes the suspended graphene field-effect transistor as described in any one of claims 1 to 3, or the suspended graphene field-effect transistor prepared by the preparation method described in any one of claims 4 to 6, the surface functionalization reagent, and the detection probe.

9. The biological detection kit according to claim 8, characterized in that, The surface functionalizing agent is a solution of 1-pyrenebutyric acid N-hydroxysuccinimide ester; the detection probe is an amino-modified DNA probe, and the nucleotide sequence of the amino-modified DNA probe is shown in SEQ ID NO.

2.

10. A biosensor, characterized in that, It includes the suspended graphene field-effect transistor according to any one of claims 1 to 3 or the suspended graphene field-effect transistor prepared by the preparation method according to any one of claims 4 to 7, and the detection probe modified on the surface of the monolayer graphene film.

Images