Method for establishing liver cell line of micropterus salmoides
By optimizing the DMEM/F-12 medium and culture conditions, the problem of efficient culture of largemouth bass liver cell lines was solved, and a highly viable and stable cell line was established, which is suitable for multi-faceted research and disease mechanism analysis.
Patent Information
- Application Number
- CN202610202973.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-11
- Publication Date
- 2026-05-12
AI Technical Summary
The existing methods for establishing largemouth bass liver cell lines are not suitable for large-scale culture, and the digestion method damages the cells and affects their growth and activity.
Using DMEM/F-12 basal medium containing specific concentrations of components, supplemented with fetal bovine serum, human FGF, and antibiotic compound solution, and optimizing primary and passaged culture media, combined with suitable culture conditions and cell cryopreservation solution, we achieved efficient culture and passage of liver cells.
The established cell line is highly viable and grows rapidly, making it suitable for various research applications. It has been successfully passaged more than 100 times, providing an important platform for research on fish liver diseases.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This application belongs to the field of cell culture technology, specifically relating to a method for establishing a liver cell line of largemouth bass. Background Technology
[0002] Largemouth bass ( Micropterus salmoides Largemouth bass, also known as California bass or black bass, belongs to the order Perciformes, family Spinypanidae, and genus Perciformes. Its meat is delicate and delicious, rich in nutrients, and boneless. It is characterized by rapid growth and strong adaptability, making it one of my country's major specialty freshwater aquaculture species. However, largemouth bass are prone to liver metabolic diseases during aquaculture, such as fatty liver and hepatomegaly. The fish liver plays a crucial role in energy metabolism, nutrient conversion, and storage. Studying the largemouth bass liver can provide a deeper understanding of its energy distribution mechanisms, nutritional requirements, and the impact of feed composition on growth performance and health, thus providing a scientific basis for precise nutritional regulation and promoting the sustainable development of aquaculture.
[0003] Cell lines are an important platform for conducting research on fish physiology, nutrition, disease and genetic mechanisms. Currently, the tissue block method reported for establishing largemouth bass liver cell lines is not suitable for primary culture of largemouth bass liver cells. The digestion method can achieve large-scale culture, but the digestion process will damage the primary liver cells and affect their growth and activity to a certain extent. Summary of the Invention
[0004] The purpose of this application is to provide a culture medium suitable for culturing liver cell lines using the tissue block method for largemouth bass.
[0005] This invention provides a culture medium for culturing largemouth bass liver cell lines, including a primary culture medium; The primary culture medium is a DMEM / F-12 basal medium containing the following components at concentrations: 18%–22% fetal bovine serum (FBS), 4.5–5.5 μg / mL human FGF, and 3.5%–4.5% first antibiotic compound solution (FGF). The first antibiotic compound solution includes 390~410 U / mL penicillin, 0.38~0.42 mg / mL streptomycin and 180~220 μg / mL amphotericin B.
[0006] Preferably, the primary culture medium is a DMEM / F-12 basal culture medium containing the following components at a concentration of 20% fetal bovine serum, 5 μg / mL human FGF, and a 4% first antibiotic compound solution. The first antibiotic compound solution includes 400 U / mL penicillin, 0.4 mg / mL streptomycin and 200 μg / mL amphotericin B.
[0007] Preferably, it also includes a subculture medium; The passage medium is a DMEM / F-12 basal medium containing the following components at concentrations: 18%–22% fetal bovine serum and 1.8%–2.2% second antibiotic compound solution (by volume). The second antibiotic compound solution includes 180-220 U / mL penicillin, 0.18-0.22 mg / mL streptomycin, and 90-110 μg / mL amphotericin B.
[0008] Preferably, the passage medium is a DMEM / F-12 basal medium containing the following components at a concentration of 20% fetal bovine serum and 2% second antibiotic compound solution. The second antibiotic compound solution includes 200 U / mL penicillin, 0.2 mg / mL streptomycin, and 100 μg / mL amphotericin B.
[0009] Preferably, it also includes the cell cryopreservation solution; The cell cryopreservation solution is the cell cryopreservation solution in the culture medium described in the above technical solution.
[0010] This invention provides a method for establishing a liver cell line of largemouth bass, comprising the following steps: Largemouth bass liver tissue fragments were cultured in the primary culture medium to obtain a cell monolayer. After preparing single cells from the cell monolayer, they were placed in the culture medium for subculture to obtain the largemouth bass liver cell line.
[0011] Preferably, the primary culture temperature is 27~29℃, and the time is 10~15 days; the primary culture is 5% CO2. The primary culture medium was changed daily.
[0012] Preferably, the subculture is performed every 2 days; The number of generations in the subculture includes 10 to 120 generations; Generations 1-10 are passed down in a 1:1 ratio; after generation 10, the ratio is 1:2.
[0013] Preferably, the largemouth bass liver cell line is further preserved in a cell preservation solution; The cell preservation solution comprises fetal bovine serum and DMSO in a volume ratio of 8-10:0.8-1.2.
[0014] Preferably, the largemouth bass liver cell line includes cell resuscitation; The cell resuscitation process includes thawing in a water bath, separating the cells, and resuspending them in a passage culture medium. The water bath melting temperature is 36~38 ℃, and the time is 50~70 s.
[0015] This invention provides a culture medium for largemouth bass liver cell line culture, comprising a primary culture medium. The primary culture medium is a DMEM / F-12 basal medium containing the following components at concentrations: 18%–22% fetal bovine serum (FBS), 4.5–5.5 μg / mL human FGF, and 3.5%–4.5% of a first antibiotic compound solution. The first antibiotic compound solution comprises 390–410 U / mL penicillin, 0.38–0.42 mg / mL streptomycin, and 180–220 μg / mL amphotericin B. This primary culture medium allows largemouth bass liver cells to migrate from tissue fragments, enabling the establishment of largemouth bass liver cell lines using the tissue fragment method. The primary culture medium exhibits high cell viability, vigorous division, and rapid growth.
[0016] This invention provides a method for establishing a liver cell line for largemouth bass, exhibiting good reproducibility and ease of operation. The obtained cell line is highly stable and has been successfully passaged over 100 times to date. The liver cell line constructed using this technique demonstrates excellent performance, with a predominantly spindle-shaped cell morphology, active proliferation, and a short passage cycle, making it suitable for research and applications in pathology, physiology, and molecular genetics. For example, this cell line can be used to explore the molecular mechanisms of precise nutritional regulation in fish, screen functional feed additives, and conduct research related to nutritional metabolic pathology. Furthermore, this cell line provides an important in vitro research platform for elucidating the mechanisms of liver-related diseases in fish, screening drugs, and developing potential treatment strategies. Attached Figure Description
[0017] Figure 1 Results of hepatocyte migration from the liver tissue of largemouth bass; Figure 2 The results of passage culture of largemouth bass liver cell line; Figure 3 Results of cell doubling time in different basal culture media; Figure 4 The effect of different concentrations of fetal bovine serum on cell doubling time; Figure 5 The effects of culture conditions with 5% CO2 and without CO2 on cell culture were investigated. Figure 6 The results of chromosome determination for the liver cell line of largemouth bass; Figure 7 for cox 1 and Cytb Electrophoretic detection results of PCR amplification products of genes. Detailed Implementation
[0018] This invention provides a culture medium for culturing largemouth bass liver cell lines, including a primary culture medium; The primary culture medium is a DMEM / F-12 basal medium containing the following components at concentrations: 18%–22% fetal bovine serum, 4.5–5.5 μg / mL human FGF, and 3.5%–4.5% of a first antibiotic compound solution; the first antibiotic compound solution includes 390–410 U / mL penicillin, 0.38–0.42 mg / mL streptomycin, and 180–220 μg / mL amphotericin B.
[0019] In this invention, the primary culture medium is preferably a DMEM / F-12 basal medium containing the following components at the following concentrations: 20% fetal bovine serum (FBS), 5 μg / mL human FGF, and 4% (v / v) a primary antibiotic compound solution. The primary antibiotic compound solution preferably includes 400 U / mL penicillin, 0.4 mg / mL streptomycin, and 200 μg / mL amphotericin B. This invention does not impose any special restrictions on the source of the components of the primary culture medium; components of primary culture media well known in the art can be used. The primary culture medium is used for the migration of primary cells from largemouth bass liver tissue and for the temporary storage of largemouth bass liver tissue. The primary culture medium not only facilitates the migration of liver cells from liver tissue but also ensures strong cell viability and a high cell proliferation rate.
[0020] In this invention, the primary culture medium is an optimized experimental medium. When an inappropriate primary culture medium is used, it is impossible to achieve the purpose of isolating largemouth bass liver cells using the tissue block method.
[0021] In this invention, the culture medium preferably further includes a passage medium. The passage medium is preferably a DMEM / F-12 basal medium containing the following components at the following concentrations: 18%–22% fetal bovine serum and 1.8%–2.2% a second antibiotic compound solution; or it can be a 20% fetal bovine serum and 2.0% second antibiotic compound solution. The second antibiotic compound solution preferably includes 180–220 U / mL penicillin, 0.18–0.22 mg / mL streptomycin, and 90–110 μg / mL amphotericin B; or it can be 200 U / mL penicillin, 0.2 mg / mL streptomycin, and 100 μg / mL amphotericin B. The passage medium is used for the passage culture and post-resuscitation culture of primary liver cells from largemouth bass.
[0022] In this invention, both the primary culture medium and the differentiation medium are based on DMEM / F-12. The selection of the basal medium in this invention showed that, compared with M199, L15, and DMEM media, DMEM / F12 resulted in higher cell growth, and the doubling time was the shortest at 4 days, with a significant difference. This indicates that using DMEM / F-12 as the basal medium is beneficial for promoting the growth and proliferation of largemouth bass liver cells.
[0023] In this invention, the culture medium preferably further includes the cell cryopreservation solution. The cell cryopreservation solution preferably comprises fetal bovine serum and DMSO in a volume ratio of 8-10:0.8-1.2. The volume ratio of fetal bovine serum to DMSO is 9:1. Experiments show that, compared with DMEM / F-12 basal medium containing fetal bovine serum and DMSO, DMEM / F-12 basal medium alone, and commercially available cell preservation solutions, the cell cryopreservation solution provided by this invention has a higher cell resuscitation viability.
[0024] This invention provides a method for establishing a liver cell line of largemouth bass, comprising the following steps: Largemouth bass liver tissue fragments were cultured in the primary culture medium to obtain a cell monolayer. After preparing single cells from the cell monolayer, they were placed in the culture medium for subculture to obtain the largemouth bass liver cell line.
[0025] In this invention, fragments of largemouth bass liver tissue are cultured in the primary culture medium to obtain a cell monolayer.
[0026] In this invention, to promote rapid cell migration from tissue blocks, the liver tissue of largemouth bass is finely fragmented to obtain largemouth bass liver tissue fragments. The particle size of the largemouth bass liver tissue fragments is 0.8~1.2 mm. Experiments show that when the particle size of the largemouth bass liver tissue fragments is greater than 2 mm, cells cannot migrate from the largemouth bass liver tissue fragments. This invention does not impose any particular limitation on the method of finely fragmenting the largemouth bass liver tissue; methods well known in the art can be used, such as cutting with scissors.
[0027] In this invention, the primary culture temperature is preferably 27-29°C, and can be 28°C. The primary culture time is preferably 10-15 days; the primary culture is preferably 5% CO2. The primary culture medium is preferably changed once a day. On the third day of the primary culture, cells migrate from the liver tissue block, and after 10-15 days of culture, the cells form a monolayer.
[0028] After obtaining the cell monolayer, the present invention prepares single cells from the cell monolayer and then passages them in the culture medium to obtain the liver cell line of largemouth bass.
[0029] In this invention, the subculture medium is preferably changed every two days. The number of subcultures is preferably 10 to 120. Subcultures of the first 10 generations are performed at a 1:1 ratio; after the 10th generation, subcultures are performed at a 1:2 ratio.
[0030] In this invention, cells obtained using the aforementioned method were passaged 120 times. From the 10th to the 120th passage, the cells consistently exhibited a polygonal shape, indicating successful establishment of the largemouth bass liver cell line. Chromosomal analysis of the largemouth bass liver cell line showed that the chromosome number ranged from 26 to 96, with 68% of the cells having 48 chromosomes, exhibiting a telogen morphology. This indicates that the cell line obtained using the method of this invention is normal. Furthermore, the mitochondrial cytochrome c oxidase subunit I gene (…) cox1 ) and mitochondrial cytochrome b ( Cytb Genetic identification of the cell line's origin revealed that the cells passaged in this invention originated from the liver cell line of the largemouth bass.
[0031] In this invention, the largemouth bass liver cell line preferably further includes preservation in a cell preservation solution. The cell preservation solution preferably comprises fetal bovine serum and DMSO in a volume ratio of 8-10:0.8-1.2. The volume ratio of fetal bovine serum to DMSO is 9:1.
[0032] In this invention, the largemouth bass liver cell line preferably includes cell resuscitation. Cell resuscitation preferably includes water bath thawing, cell separation, and resuspending in a passage medium. The water bath thawing temperature is preferably 36-38°C, and can be 37°C. The water bath thawing time is preferably 50-70 seconds, and can be 60 seconds.
[0033] The following detailed description of the method for establishing a largemouth bass liver cell line provided by the present invention, with reference to the embodiments, should not be construed as limiting the scope of protection of the present invention.
[0034] Example 1 (1) Place 8 cm long largemouth bass fry in water containing 1% triple antibiotics (100 U / mL penicillin, 0.1 mg / mL streptomycin, and 50 μg / mL amphotericin B) and fast for 24 h. Add ethyl m-aminobenzoate methanesulfonate to anesthetize the fish until they are belly-up and show no stress response to external stimuli. Use a disposable 1 mL sterile syringe to draw blood from the tail vein until no more blood flows out of the syringe. Wipe the fish body with 75% alcohol cotton balls for disinfection. Then, under sterile conditions, remove the liver tissue, rinse it in 75% alcohol for 5 seconds, and then rinse it 3-5 times with PBS buffer containing 2% triple antibiotics (200 U / mL penicillin, 0.2 mg / mL streptomycin, and 100 μg / mL amphotericin B).
[0035] (2) Under aseptic conditions, the extracted liver tissue was immersed in DMEM / F-12 basal medium (stored at 4℃, not to be used for more than 1 week) containing primary culture medium (primary culture medium containing 20% fetal bovine serum, 5 μg / mL human FGF, and 4% triple antibodies, including 400 U / mL penicillin, 0.4 mg / mL streptomycin and 200 μg / mL amphotericin B). Connective tissue, adipose tissue and blood spots in the liver tissue were removed with sterile ophthalmic forceps. Then, the liver tissue and primary culture medium were transferred into a 2 mL centrifuge tube. The liver tissue was cut into pieces of about 1 mm using sterile surgical scissors. 3 Small tissue pieces were prepared, a process that took approximately 3 minutes. The liver tissue was transferred to a 15 mL centrifuge tube, and 6 mL of PBS buffer containing 2% triple antibody was added to rinse the tissue pieces. The mixture was allowed to stand, and this process was repeated 3-5 times until the supernatant was clear. The supernatant was discarded, and the tissue was evenly seeded onto 25 cm² plates. 2 In the culture flask, ensure that each tissue piece is in full contact with the culture medium, promoting cell migration. Remove excess liquid. Invert the culture flask and incubate at 28°C with 5% CO2 for 4 hours. Then, turn the flask upright and slowly add 5 mL of primary culture medium to completely immerse the liver tissue piece in the primary culture medium. Continue culturing at 28°C with 5% CO2. Change the primary culture medium daily, replacing it completely each time.
[0036] The results are as follows Figure 1 As shown, adherent cells migrated from the largemouth bass liver tissue on the third day after initiation of primary culture. Thereafter, the culture medium was changed daily, and the results were as follows. Figure 1 As shown, it can grow into a cell monolayer in 10-15 days.
[0037] (3) When the primary liver cells of largemouth bass reach 80%-90% adhesion coverage, subculture is initiated using trypsin digestion. First, aspirate all the primary culture medium, rinse three times with PBS buffer containing 2% tri-antibiotics, add 1 mL of 0.25% trypsin digestion solution to cover the cell layer, ensuring the trypsin fully contacts the cell surface. Place the culture flask in a 28℃, 5% CO2 incubator until the cells become rounded, then immediately transfer to a clean bench. Add 4 mL of subculture medium (DMEM / F-12 basal medium containing 20% fetal bovine serum, 2% tri-antibiotics (200 U / mL penicillin, 0.2 mg / mL streptomycin, and 100 μg / mL amphotericin B) to terminate digestion, gently pipette to mix, and seed the cell suspension into a new 25 cm² culture medium. 2 The cells were further cultured in culture flasks. From passage 1 to 10, the cells were passaged at a 1:1 ratio and continuously cultured in a 28°C, 5% CO2 incubator, with passages every 2 days and the culture medium completely replaced daily. After passage 10, the cells were passaged at a 1:2 ratio and continuously cultured in a 28°C, 5% CO2 incubator, with passages every 2 days and the culture medium completely replaced daily. At passage 50, the largemouth bass liver cell line was successfully established.
[0038] The results are as follows Figure 2 As shown, the largemouth bass liver cell line stably exhibits a polygonal shape from generation 10 to generation 120, indicating that the largemouth bass liver cell line has been successfully established.
[0039] Comparative Example 1 The liver cell line of largemouth bass was established according to the method in Example 1, except that the primary culture medium was replaced with DMEM / F-12 basal medium containing 20% fetal bovine serum, 5 μg / mL human FGF, 10 μg / mL human EGF, and 4% triple antibodies. The triple antibodies consisted of 400 U / mL penicillin, 0.4 mg / mL streptomycin, and 200 μg / mL gentamicin.
[0040] When largemouth bass liver tissue was cultured in primary culture for 15 days, a small number of cells migrated out of the tissue block, but the cells died during further culture.
[0041] Comparative Example 2 The difference from Example 1 is that the subculture medium used in step (3) uses M199, DMEM and L15 basal culture medium, while the rest are the same as in Example 1.
[0042] The cell results obtained from passaged culture for 4 days in Example 1 were compared with those obtained from passaged culture for 4 days in Comparative Example 1. The results are as follows: Figure 3As shown in Table 1, the cell doubling time after 4 days of culture using basal media of M199, DMEM, and L15 was much longer than that of primary culture medium containing DMEM / F12 basal medium.
[0043] Table 1. Culture results in different basal media
[0044] Note: Different letters in the same column indicate significant differences. P <0.05.
[0045] Comparative Example 3 The difference from Example 1 is that the DMEM / F-12 basal medium used in step (3) contains fetal bovine serum concentrations of 5%, 10%, 15%, and 25%, respectively. All other aspects are the same as in Example 1.
[0046] The cell results obtained from passaged culture for 4 days in Example 1 were compared with those obtained from passaged culture for 4 days in Comparative Example 2. The results are as follows: Figure 4 As shown in Table 2, the cell doubling time after 4 days of culture using culture media containing 5%, 10%, and 15% fetal bovine serum was significantly longer than that using culture media containing 20% fetal bovine serum.
[0047] Table 2. Effects of different concentrations of fetal bovine serum on cell growth.
[0048] Note: Different letters in the same column indicate significant differences. P <0.05.
[0049] Comparative Example 4 The difference from Example 1 is that the culture conditions used are 0% CO2 or 5% CO2, while the rest are the same as in Example 1.
[0050] The results of primary cultured cells grown for 10 days and passaged cells grown for 4 days obtained in Example 1 were compared with the results of primary cultured cells grown for 10 days and passaged cells grown for 4 days obtained in Comparative Example 3. The results are as follows: Figure 5 As shown, the growth rate of primary cells grown for 10 days and passaged cells grown for 4 days under 0% CO2 culture conditions is much lower than that under 5% CO2 culture conditions.
[0051] Example 2 Cryopreservation and thawing of the largemouth bass liver cell line obtained in Example 1 (1) Cryopreservation: Take a 75 cm bottle 2The vigorous growth of largemouth bass liver cells, which covered the bottom of the culture flask, was rinsed 2-3 times with PBS containing antibiotics (same as step (1) in Example 1). 2 mL of trypsin (i.e., the 0.25% trypsin digestion solution described in step (3) of Example 1) was added, and the flask was shaken to ensure full contact between the trypsin and the cells. Digestion was carried out at 28 ℃ and 5% CO2 until the cells were observed to be rounded under an inverted microscope. The cells were immediately transferred to a clean bench, and 2 mL of passage culture medium (same as step (3) in Example 1) was added to stop the digestion. The cells were gently pipetted to mix. The cell suspension was transferred to a centrifuge tube, centrifuged at 3000 r / min for 5 min, the supernatant was discarded, and 1 mL of prepared 10% DMSO cryopreservation solution (fetal bovine serum and DMSO mixed at a volume ratio of 9:1, freshly prepared) was slowly added to the precipitate. The cells were gently resuspended by pipetting to make the cell count approximately 1×10⁻⁶. 6 Cells / mL were transferred to 2 mL cryovials. The cryovials were placed in a programmed cryopreservation box and incubated at -80°C for 24 hours. Finally, the cryovials were removed and placed in liquid nitrogen for long-term storage.
[0052] (2) Cell thawing: Remove the cryovials from liquid nitrogen and place them in a 28°C, 5% CO2 water bath, shaking rapidly for 60 seconds until completely thawed. Then, in a sterile operating table, dilute the thawed cells with 3 mL of passage culture medium, centrifuge at 1500 r / min for 1 min, discard the supernatant, resuspend the cells in 5 mL of passage culture medium (same as step (3) in Example 1), and seed them into 25 cm² cells. 2 In a culture flask, incubate at 28 ℃ in a 5% CO2 incubator.
[0053] The results are shown in Table 3. The cell survival rate of largemouth bass liver cells after cryopreservation and thawing reached 85%-90%. After 72 hours of thawing, the cells could fill the bottom of the culture flask and there was no significant difference in cell morphology compared with those before cryopreservation. This indicates that the cell lines constructed by the cell line construction method of the present invention have the advantage of good stability.
[0054] Table 3 Cell viability
[0055] Comparative Example 5 The difference from Example 2 is that the cell cryopreservation solution used in step (1) is a mixture of commercial serum-free cell cryopreservation solution (New Serum), DMEM / F-12 medium containing fetal bovine serum and DMSO, and the rest is the same as in Example 2.
[0056] One week later, the frozen cells were revived according to the method in step (2) of Example 2 to compare cell viability. The results are shown in Table 4. The cell viability of cells revived using cell cryopreservation medium containing fetal bovine serum and DMSO was much higher than that of cells revived using commercial serum-free cell cryopreservation medium and DMEM / F-12 medium containing fetal bovine serum and DMSO.
[0057] Table 4. Effects of different cell cryopreservation solutions on cell recovery viability.
[0058] Note: Different letters in the same column indicate significant differences. P <0.05.
[0059] Example 3 Chromosomal analysis of the liver cell line of largemouth bass in Example 1 Liver cells from vigorous cell division of the 20th generation largemouth bass were inoculated into 75 cm... 2 In the culture flask, when the cells are in the logarithmic growth phase, wash them three times with PBS, replace with fresh passage medium (same as step (3) in Example 1), add 10 μL of colchicine solution (1 mg / mL) (1 mg / mL colchicine solution: accurately weigh 25 mg of colchicine and dissolve it completely in sterile distilled water, make up to 25 mL, and filter it with a 0.22 μm needle filter under sterile conditions. The colchicine solution concentration is 1 mg / mL. After sterilization and sealing, store at 4℃), continue culturing for 12 h, then digest and collect the cell suspension into a 15 mL centrifuge tube, centrifuge at 1200 r / min for 10 min, and discard the supernatant; add 5 mL of KCl (0.075 M) (0.075 M KCl hypotonic solution: accurately weigh 0.2794 g of KCl, dissolve it in sterile distilled water, make up to 50 mL, effective at room temperature for a long time) solution to hypotonic treat the cells for 30 min; after hypotonic treatment, slowly add 1 Centrifuge at 1200 rpm for 10 min with 3 mL of pre-chilled Carnoy's fixative, discard the supernatant; add 3 mL of pre-chilled Carnoy's fixative, gently pipette to resuspend the cells, fix for 10 min, centrifuge at 1200 rpm for 10 min, discard the supernatant; repeat the above fixation steps twice. After the last fixation and centrifugation, carefully aspirate the supernatant, leaving about 200 μL of solution to resuspend the cells, and gently pipette to resuspend the cells. Drop the cell suspension from a height onto a pre-chilled glass slide, allow it to air dry, and then stain with 10% Giemsa stain (10% Giemsa stain: mix Giemsa stain with sterile distilled water at a volume ratio of 1:9, prepare fresh and use immediately) at room temperature for 30 min; rinse with double-distilled water, allow to air dry, and mount with neutral resin; observe 100 metaphase chromosomes under an oil immersion microscope, photograph, count the chromosome number, and perform karyotype analysis.
[0060] The results are as follows Figure 6 As shown in Table 5, chromosome analysis of the largemouth bass liver cell line revealed that the chromosome number of the largemouth bass liver cells ranged from 26 to 96, with 68% of the cells having 48 chromosomes. The chromosome morphology was telogen symmetry. This indicates that the cell line obtained by the method of this invention is normal.
[0061] Table 5. Chromosome determination results of largemouth bass liver cell line
[0062] Example 4 Validation of the origin of the liver cell line of the largemouth bass Through the mitochondrial cytochrome c oxidase subunit I gene ( cox 1) Identification of the cell line's origin using mitochondrial cytochrome b (Cytb) genes. First, DNA was extracted from cell samples, and a design was developed. cox1 and cytb The amplification primers for the gene were: cox1-F: AGAGGAGGAGACCCCATTC (SEQ ID NO:1); cox1-R: GACGTAGGGAAGTGGGCAA (SEQ ID NO:2); cytb F: CTCTGATATCGCAACCGCCT (SEQ ID NO:3); cytb-R: AATGGATGTTCCACGGGCAT (SEQ ID NO:4). PCR amplification was performed according to the following system and procedure: The PCR reaction volume was 20 μL, containing 10 μL of 2×GS Taq PCRMix, 0.8 μL of primers, 1 μL of DNA, and 8.2 μL of deionized water; the reaction program was: 95℃ for 5 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 60 s, 30 cycles; 72℃ for 7 min. After agarose gel electrophoresis, the amplified products were sent to Qingke Biotechnology Co., Ltd. for sequencing. Sequencing was compared with known largemouth bass sequences.
[0063] The results are as follows Figure 7 The amplification from the cell shown cox1 and cytb The target gene fragments were 458 bp and 939 bp in size, respectively. The sequencing results were compared with those of largemouth bass in NCBI. cox1 and cytb Sequence comparison revealed a 99% consistency.
[0064] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A culture medium for culturing largemouth bass liver cell lines, characterized in that, Including primary culture media; The primary culture medium is a DMEM / F-12 basal medium containing the following components at concentrations: 18%–22% fetal bovine serum (FBS), 4.5–5.5 μg / mL human FGF, and 3.5%–4.5% of a primary antibiotic compound solution. The first antibiotic compound solution includes 390~410 U / mL penicillin, 0.38~0.42 mg / mL streptomycin and 180~220 μg / mL amphotericin B.
2. The culture medium for culturing largemouth bass liver cell lines according to claim 1, characterized in that, The primary culture medium is a DMEM / F-12 basal medium containing the following components: 20% fetal bovine serum (v / v), 5 μg / mL human FGF, and 4% first antibiotic compound solution (v / v). The first antibiotic compound solution comprises 400 U / mL penicillin, 0.4 mg / mL streptomycin, and 200 μg / mL amphotericin B.
3. The culture medium for culturing largemouth bass liver cell lines according to claim 1, characterized in that, It also includes subculture media; The passage medium is a DMEM / F-12 basal medium containing the following components at concentrations: 18%–22% fetal bovine serum and 1.8%–2.2% second antibiotic compound solution (by volume). The second antibiotic compound solution includes 180-220 U / mL penicillin, 0.18-0.22 mg / mL streptomycin, and 90-110 μg / mL amphotericin B.
4. The culture medium for culturing largemouth bass liver cell lines according to claim 3, characterized in that, The passage medium was a DMEM / F-12 basal medium containing the following components: 20% fetal bovine serum and 2% second antibiotic compound solution (volume concentration). The second antibiotic compound solution includes 200 U / mL penicillin, 0.2 mg / mL streptomycin, and 100 μg / mL amphotericin B.
5. The culture medium for culturing largemouth bass liver cell lines according to any one of claims 1 to 4, characterized in that, It also includes cell cryopreservation solutions; The cell cryopreservation solution comprises fetal bovine serum and DMSO in a volume ratio of 8-12:0.8-1.
2.
6. A method for establishing a liver cell line of largemouth bass, characterized in that, Includes the following steps: Largemouth bass liver tissue fragments were cultured in the primary culture medium described in any one of claims 1 to 5 to obtain a cell monolayer. After preparing single cells from the cell monolayer, the cells are passaged in the culture medium described in any one of claims 1 to 5 to obtain the largemouth bass liver cell line.
7. The method for establishing according to claim 6, characterized in that, The primary culture temperature is 27~29℃, and the time is 10~15 days; the primary culture is carried out in 5% CO2. The primary culture medium was changed daily.
8. The method for establishing according to claim 6, characterized in that, The subculture was performed every 2 days. The number of generations in the subculture includes 10 to 120 generations; Generations 1 through 10 are passed down in a 1:1 ratio; After the 10th generation, the generations are passed down in a 1:2 ratio.
9. The method for establishing according to any one of claims 6 to 8, characterized in that, The largemouth bass liver cell line also includes preservation in a cell preservation solution; The cell preservation solution is the cell preservation solution in the culture medium described in claim 5.
10. The method for establishing according to claim 9, characterized in that, The largemouth bass liver cell line includes cell resuscitation; The cell resuscitation process includes thawing in a water bath, separating the cells, and resuspending them in a passage culture medium. The water bath melting temperature is 36~38℃, and the time is 50~70 s.