Death-related gene MuNICE3 of megthrips vulgaris and application of death-related gene MuNICE3

Abstract

The invention discloses a lethal related gene MuNIC E3 of megthrips vulgaris and application of the lethal related gene MuNIC E3. The nucleotide sequence of the lethal related gene MuNIC E3 is shown as SEQ ID NO: 1. It is found that common megthrips can die when being fed with the dsRNA of the MuNICE3 gene, and the dsRNA has a good lethal effect on common megthrips at different development stages, and is significantly superior to dsRNA of other insect lethal related genes. The invention further establishes a method for preventing and treating the common megthrips, which can be used for efficiently preventing and treating the common megthrips and provides a new thought and a new way for efficiently and environment-friendly preventing and treating the common megthrips.

Description

Technical Field

[0001] This invention relates to the field of pest and disease control technology, specifically to a lethal gene MuNICE3 of the common thrips and its application. Background Technology

[0002] The common thrips, *Megalurothrips usitatus* (Bagnall), belongs to the order Thysanoptera, family Thripidae, and genus *Megalurothrips*. This pest causes serious damage to a variety of crops, mainly legumes such as cowpeas, green beans, and broad beans, as well as other crops such as tomatoes, loofahs, and corn. Its occurrence and damage are particularly severe in Hainan, Guangdong, and Guangxi provinces.

[0003] Currently, field control of common thrips mainly relies on chemical control. However, the common thrips are highly elusive, leading farmers to increase pesticide dosage and frequency during control, resulting in varying degrees of resistance to commonly used pesticides. Furthermore, chemical control not only kills beneficial organisms such as natural enemies and pollinators, but some synthetic insecticides are also difficult to degrade, posing a serious threat to the ecological environment. Agricultural control methods such as strengthening field management, cleaning crop residues, and crop rotation can only prevent common thrips in the early stages of crop growth; their effectiveness is very limited for field control when common thrips infestation has already occurred in the later stages of crop growth. Therefore, there is an urgent need for a low-cost, fast-acting, and environmentally friendly method for controlling common thrips.

[0004] RNA interference (RNAi) is a gene silencing technology triggered by endogenous or exogenous double-stranded RNA (dsRNA). It inhibits the expression of target genes by specifically degrading intracellular mRNA. RNAi technology can control key genes involved in pest development or important behaviors, indirectly hindering normal growth and reproduction, and even directly causing pest death, thereby achieving pest control goals. It is a novel, green, and environmentally friendly control method with broad application prospects. Obtaining highly effective and safe lethal target genes is crucial for pest control using RNAi technology.

[0005] The NICE3 gene plays a crucial role in the epidermal formation process during insect growth and development. Currently, research on this gene in insects is relatively limited, while its study in mammals is more extensive. In humans, NICE3 is part of the epidermal differentiation complex (EDC), which contains numerous genes essential for human epidermal maturation. However, the specific function of NICE3 in humans remains unclear; it may also play an important role in the maintenance and differentiation of human hematopoietic stem cells. In Lantang pigs, qPCR analysis of NICE3 gene expression in multiple tissues showed that the highest expression was observed in the longissimus dorsi muscle, suggesting its potential involvement in muscle development. In the red flour beetle (Tribolium castaneum), RNA interference with the NICE5 gene within the NICE3 gene family via injection resulted in a 10% mortality rate 11 days after injection into pupae, and an 80% mortality rate 11 days after injection into larvae. This indicates that RNAi interference with genes in the NICE gene family may have a lethal effect on insects.

[0006] Studies have shown that dsRNA has the highest RNAi interference efficiency in Coleoptera and Orthoptera, while RNAi is more difficult to achieve in Lepidoptera. Increasing research indicates that RNAi efficiency is also low in Thysanoptera. In palm thrips, the lethality of dsTpAPN2 and dsTpAPN3 was less than 15%, and there was no significant difference compared to the control group dsGFP. However, when dsTpAPN2 and dsTpAPN3 were loaded with star polycation (SPc) material, the lethality of palm thrips was only 23.3% and 30.0%, respectively. This indicates that RNAi efficiency for thrips pests is low. Currently, no highly efficient RNAi method for thrips has been developed. Summary of the Invention

[0007] The purpose of this invention is to overcome the above-mentioned shortcomings of the prior art and provide a lethal gene MuNICE3 of common thrips and its application.

[0008] The first objective of this invention is to provide a lethal gene, MuNICE3, for common thrips.

[0009] The second objective of this invention is to provide a dsRNA for controlling common thrips.

[0010] The third objective of this invention is to provide a method for controlling common thrips.

[0011] The fourth objective of this invention is to provide a kit for controlling common thrips.

[0012] The fifth objective of this invention is to provide the application of the aforementioned dsRNA in the control of common thrips.

[0013] The sixth object of the present invention is to provide the application of the dsRNA in the preparation of products for the prevention and control of common thrips.

[0014] To achieve the above objectives, the present invention is implemented through the following solution:

[0015] This invention claims protection for a lethal gene MuNICE3 in common thrips, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0016] It also seeks to protect a dsRNA for controlling common thrips that targets the lethal gene MuNICE3.

[0017] Preferably, the nucleotide sequence of the dsRNA is as shown in SEQ ID NO:2.

[0018] More preferably, the 5' end and / or 3' end of the dsRNA also have a promoter sequence.

[0019] More preferably, the promoter sequence is a T7 promoter sequence, and the nucleotide sequence of the T7 promoter is shown in SEQ ID NO:4.

[0020] As a specific implementation, the nucleotide sequence of the dsRNA is shown in SEQ ID NO:5.

[0021] The present invention also claims a method for controlling common thrips by feeding common thrips any of the described dsRNAs.

[0022] The present invention also claims a kit for controlling common thrips, containing dsRNA for any of the claims.

[0023] Preferably, it also contains an in vitro transcription reagent.

[0024] This invention also claims protection for the following applications

[0025] The application of the dsRNA in the control of common thrips.

[0026] The application of the dsRNA in the preparation of products for the prevention and control of common thrips.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] This invention discovers that feeding common thrips with dsRNA targeting MuNICE3 can induce mortality in common thrips, and this effect is significant for both second-instar nymphs and adult females, demonstrating a clear advantage over dsRNAs targeting other insect lethal genes. Furthermore, a method for controlling common thrips has been established, which is highly effective and provides a new approach and method for efficient and environmentally friendly control of this pest. Attached Figure Description

[0029] Figure 1 The mortality rate of common thrips adults after feeding on insect lethal gene dsRNA;

[0030] Figure 2 The mortality rate of dsMuNICE3 against second instar nymphs of common thrips is shown in the figure. The values ​​in the figure are mean ± standard error, and different letters indicate significant differences between groups (Tukey, P<0.05).

[0031] Figure 3 The effect of dsMuNICE3 feeding on the silencing efficiency of MuNICE3 in second instar nymphs (A) and adult females (B) of the common thrips; the values ​​in the figure are mean ± standard error, and different letters indicate significant differences between groups (Tukey, P<0.05).

[0032] Figure 4 The expression patterns of the MuNICE3 gene in different developmental stages (A) and tissues (B) of the common thrips are shown. 1st represents the first instar nymph; 2nd represents the second instar nymph; Pre-p represents the prepupa; Ps-p represents the pseudopupa; F represents the female adult; M represents the male adult; CT represents the cuticle; OV represents the ovary; MG represents the midgut; and SG represents the salivary gland. The values ​​in the figure are mean ± standard error, and different letters indicate significant differences between groups (P < 0.05). Detailed Implementation

[0033] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0034] The common thrips was collected in Sanya City, Hainan Province in 2018 and reared with fresh cowpeas in an artificial incubator with a temperature of 26℃, a relative humidity of 70%, and an L:D ratio of 12:12.

[0035] The bioassay device for common thrips is made using a disposable dip box. A hole is made at the top of the dip box (to ensure ventilation), and it is sealed with gauze (to prevent the insects from escaping).

[0036] Example 1: Effect of lethal gene dsRNA on the survival rate of common thrips

[0037] I. Experimental Methods

[0038] 1. Design of primers for insect lethal gene dsRNA

[0039] Based on 10 genes reported as lethal in *Tribolium castaneum* (see Table 1 below for relevant information) (Reference: Schmitt-Engel, C., Schultheis, D., Schwirz, J. et al. Thei Beetle large-scale RNAi screen reveals gene functions for insect development and physiology. Nat Commun 6, 7822 (2015). https: / / doi.org / 10.1038 / ncomms8822), the sequences of homologous genes in *Tribolium castaneum* were obtained by comparing and utilizing sequences on ibeetle-base (https: / / ibeetle-base.uni-goettingen.de / ). dsRNA primers were designed for each gene and GFP (control). Relevant information for each gene and primer is shown in Table 2 below.

[0040] Table 1. Information related to lethal genes.

[0041]

[0042] Table 2. dsRNA primers for lethal genes

[0043]

[0044] 2. In vitro synthesis of dsRNA

[0045] Using the dsRNA primers for lethal genes and GFP listed in Table 2, PCR amplification was performed on common thrips cDNA and pUC-GFP-AT plasmid containing the GFP encoding gene, respectively.

[0046] The PCR reaction system consisted of: 35 μL ddH2O, 50 μL Taq MasterMix, 5 μL template, 5 μL upstream primer (10 μM), and 5 μL downstream primer (10 μM).

[0047] PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min.

[0048] After the reaction was completed, the PCR products were detected by 1% agarose gel electrophoresis and then recovered using the SanPrep column DNA gel recovery kit (Shanghai Sangon Biotech) as a template for dsRNA synthesis.

[0049] Using MEGAscript TM The T7 kit (Thermo Fisher Scientific, Waltham, MA, USA) was used for in vitro transcription to synthesize dsRNA.

[0050] The in vitro transcription synthesis system for dsRNA consists of: Reaction Buffer 5 μL, ATP Solution 5 μL, GTP Solution 5 μL, CTP Solution 5 μL, UTP Solution 5 μL, dsRNA template 1 μg, Enzyme mix 5 μL, and ddH2O 50 μL.

[0051] After mixing the above system, incubate it in a PCR instrument at 37°C for 4 hours.

[0052] After the reaction was complete, 2.5 μL of TURBO DNase was added to remove residual template DNA, and then the reaction was performed according to MEGAscript. TM The T7 kit instructions were used to purify dsRNA. After dissolving the dsRNA in 50 μL of ddH2O, the dsRNA was stored at -80°C to obtain dsRNA targeting lethal genes and GFP as shown in Table 1.

[0053] dsRNA quality was assessed using 1.5% agarose gel electrophoresis and the NanoGFPDrop One instrument. C dsRNA concentration was determined using a spectrophotometer.

[0054] 3. Effect of dsRNA on the survival rate of common thrips

[0055] Lethality of dsRNA against lethal-related genes and GFP in Table 1 was determined using common female thrips:

[0056] The lethal genes and GFP dsRNAs were RNAi-treated by feeding, with 3 biological replicates for each dsRNA and 20 organisms per biological replicate.

[0057] The specific method is as follows:

[0058] Cowpea seeds were soaked on ice for 30 minutes with 500 ng / μL of candidate target gene and GFP dsRNA. After soaking, they were dried and fed to common thrips in a bioassay device made from a disposable feed container. Cowpea seeds soaked in dsRNA were fed continuously for 48 hours (the seeds were replaced every 24 hours). After 48 hours, cowpea pods that had not been soaked in dsRNA were fed (the pods were replaced every 24 hours). The plants were then placed in an artificial climate chamber (temperature 26℃, relative humidity 70%, L:D = 12:12) and the survival rate of common thrips was observed and counted for 7 consecutive days. The mortality rate was also calculated.

[0059] II. Experimental Results

[0060] Survival rates of common large thrips were determined using RNAi treatment via feeding. All dsRNA lethality rates were below 34%, with the highest being for the MuNICE3 gene, reaching 33.33%, a significant difference compared to the control group dsGFP. Except for the MuNICE3 gene, the mortality rates of other lethal genes showed no significant difference compared to the control group dsGFP. Figure 1 (F) 9,20 =3.694, P<0.01).

[0061] The nucleotide sequence of MuNICE3 is shown in SEQ ID NO:1, the nucleotide sequence of the designed MuNICE3 dsRNA is shown in SEQ ID NO:2, the nucleotide sequence of the GFP dsRNA (dsGFP) is shown in SEQ ID NO:3, and the 5' and 3' ends of the designed dsMuNICE3 and dsGFP are also equipped with T7 promoter sequences for in vitro transcription (the nucleotide sequence of which is shown in SEQ ID NO:4); that is, the nucleotide sequence of the dsMuNICE3 dsRNA (dsMuNICE3) used to feed common thrips is shown in SEQ ID NO:5, and the nucleotide sequence of the dsGFP used to feed common thrips is shown in SEQ ID NO:6.

[0062] SEQ ID NO:1

[0063] AGGGAGCTGGACTGGGGCTGGACGGTGACGGTTAGAGCGGGCTCGTCAGCGGGAATCATGGTGGAACAGCTCTCGGGCGTGACGGTGGTCATCTTCATAGCATGCGGGGTGCTCACCGTGTTCCTGCTCTTCATCTTCGGCAAGAGGCAGATCATGAGGTTCGCCCTGCGCTCGCGGAGGGGCCCGCACGTCACGCTCGGGCACGGAGCAGAAAAGGGGTTGAGAATGGAACTGGAACGGAGATTAGATGTCATCTCTCGAATTGTCCATGAAGCAAAACTTATCAATGAGGATGATGCTCGATACATTTTGCCTCCTGGCTCATCTTTTCCGCCATATTATTACCGGCTCAAGGCTGTCGATGATGTGAAGACTCTTGAAGCTGAGATTCTTAAACAAGATACTTCACTGCATCGCTATCCTACGGAAAACCTGCGAGCCTTCTTGCTGTCTTCTTTAGCTGCTCCACTTGATGGCTCAGGGCAAAAGATGGTTCACCAATTCTGTGACATGTACGAACACGCTCGTCATGACCCAGCAGATTTTGGTGATGAGGAGTATCAAGCTTATTCTAGACTCCTGATAAAACTCATGGATGCGGCAAAATTACTGAAGTCATTCCCCAACAGCAGAAAGACAAGTCCCAACAGAACACCTGTCCGCAGACCTCCAGATATGTCAAAAAGTAGGAATAACATGGTGGATGTAAAACTGCAGCTAAGAGATGAAAATTTATCAAGGCCGAGTACCCTTACCGTCCCTGCAGGAGAAGTGGATAGCAGTGAAACACCTGTATGA;

[0064] SEQ ID NO:2:

[0065] GGGTTGAGAATGGAACTGGAACGGAGATTAGATGTCATCTCTCGAATTGTCCATGAAGCAAAACTTATCAATGAGGATGATGCTCGATACATTTTGCCTCCTGGCTCATCTTTTCCGCCATATTATTACCGGCTCAAGGCTGTCGATGATGTGAAGACTCTTGAAGCTGAGATTCTTAAACAAGATACTTCACTGCATCGCTATCCTACGGAAAACCTGCGAGCCTTCTTGCTGTCTTCTTTAGCTGCTCCACTTGATGGCTCAGGGCAAAAGATGGTTCACCAATTCTGTGACATGTACGAACACGCTCGTCATGACCCAGCAGATTTTGGTGATGAGGAGTATCAAGCTTATTCTAGACTCCTGATAAAACTCATGGATGCGGC;

[0066] SEQ ID NO:3:

[0067] AAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAA;

[0068] SEQ ID NO:4

[0069] taatacgactcactataggg;

[0070] SEQ ID NO:5

[0071] taatacgactcactatagggGGGTTGAGAATGGAACTGGAACGGAGATTAGATGTCATCTCTCGAATTGTCCATGAAGCAAAACTTATCAATGAGGATGATGCTCGATACATTTTGCCTCCTGGCTCATCTTTTCCGCCATATTATTACCGGCTCAAGGCTGTCGATGATGTGAAGACTCTTGAAGCTGAGATTCTTAAACAAGATACTTCACTGCATCGCTATCCTACGGAAAACCTGCGAGCCTTCTTGCTGTCTTCTTTAGCTGCTCCACTTGATGGCTCAGGGCAAAAGATGGTTCACCAATTCTGTGACATGTACGAACACGCTCGTCATGACCCAGCAGATTTTGGTGATGAGGAGTATCAAGCTTATTCTAGACTCCTGATAAAACTCATGGATGCGGCccctatagtgagtcgtatta;

[0072] SEQ ID NO:6

[0073] taatacgactcactatagggAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAAccctatagtgagtcgtatta。

[0074] Example 2: Effect of dsMuNICE3 on the survival rate of second instar nymphs of common thrips

[0075] I. Experimental Methods

[0076] RNAi treatment was performed on second-instar nymphs of the common large thrips using MuNICE3 and GFP dsRNA, respectively, via a feeding method. All treatments were performed in 5 biological replicates, with 10 nymphs per replicate. The specific methods were as follows:

[0077] Cowpea seeds were soaked on ice for 30 minutes in 500 ng / μL of dsMuNICE3 and dsGFP. After soaking, the seeds were dried and fed to a bioassay device for common thrips. The seeds soaked in dsRNA were fed continuously for 48 h (the soaked seeds were replaced every 24 h). After 48 h, the seeds were fed unsoaked cowpea pods (the pods were replaced every 24 h). The treated plants were then placed in an artificial climate chamber (temperature 26℃, relative humidity 70%, L:D = 12:12) and the survival of second instar nymphs of common thrips was observed and recorded for 7 consecutive days, and the mortality rate was calculated.

[0078] II. Experimental Results

[0079] See results Figure 2 The survival rate of second-instar nymphs of the common thrips was determined. The lethality rate of dsRNA ingested by MuNICE3 was 33.33%, which was significantly different from that of the control group dsGFP.

[0080] That is, dsMuNICE3 can cause the death of 33.33% of second-instar nymphs of the common thrips, demonstrating a significant lethal effect. Figure 2 (t(8)=-8.552,P<0.001).

[0081] Example 3: Effect of dsMuNICE3 on MuNICE3 gene expression in second instar nymphs and adult females of the common thrips.

[0082] I. Experimental Methods

[0083] RNAi treatment was performed on second-instar nymphs and adult females of the common thrips using MuNICE3 and GFP dsRNA, respectively, via a feeding method. The specific method was as follows:

[0084] Cowpea seeds were soaked on ice for 30 min each with 500 ng / μL of MuNICE3 and GFP dsRNA, respectively. After soaking, the seeds were air-dried and fed into a bioassay apparatus for common large thrips. The seeds were fed continuously for 48 h (the soaked seeds were replaced every 24 h). After 48 h of feeding, 40 second-instar nymphs and 40 adult females were collected in 1.5 mL RNase-free centrifuge tubes as one biological replicate, with three biological replicates. After flash freezing in liquid nitrogen, the samples were stored at -80°C.

[0085] Total RNA was extracted from the collected samples and reverse transcribed into cDNA. RT-qPCR was used to detect changes in dsMuNICE3 expression to reflect its silencing efficiency against second-instar and female adult common thrips. Primers for RT-qPCR are shown in Table 3 below.

[0086] Table 3:

[0087]

[0088] II. Experimental Results

[0089] The results are as follows Figure 3 As shown, RT-qPCR results indicated that feeding second-instar nymphs of the common thrips with dsMuNICE3 significantly suppressed the expression level of the MuNICE3 gene. Compared with the control group dsGFP, the MuNICE3 gene expression was downregulated by 2.528 times after feeding with dsMuNICE3. Figure 3 A)(t(4)=9.956,P<0.001); After feeding female adult common thrips with dsMuNICE3, the expression level of the MuNICE3 gene was significantly inhibited, downregulated by 1.589 times compared with the control group dsGFP. Figure 3 B)(t(6)=4.803,P<0.01).

[0090] Example 4: Expression of the MuNICE3 gene in different developmental stages and tissues of *Thrips maxima*

[0091] I. Experimental Methods

[0092] 1. Sample collection

[0093] The number of individuals sampled per replicate for different developmental stages of common thrips was as follows: 50 1st instar nymphs, 50 2nd instar nymphs, 30 prepupae, 30 pseudopupae, 20 female adults, and 20 male adults; three biological replicates were collected for each sample.

[0094] Meanwhile, when collecting different tissue samples, the midgut, ovary, salivary gland and epidermal tissue of female adult common thrips were dissected in centrifuge tubes containing Trizol, and three biological replicates were collected for each tissue sample.

[0095] All samples were placed in 1.5 mL RNase-free centrifuge tubes, rapidly frozen in liquid nitrogen, and stored at -80°C before RNA extraction.

[0096] 2. Extraction and synthesis of the first strand of RNA and cDNA

[0097] RNA was extracted from the above samples using the Trizol method. RNA quality was assessed using 1% agarose gel electrophoresis with the NanoDrop One instrument. C RNA concentration was measured using a spectrophotometer; OD values ​​of RNA in all samples were also measured. 260 / OD 230 The pH value was between 1.8 and 2.2. Using the PrimeScript™ RT reagent Kit with gDNA Eraser, total RNA was reverse transcribed into cDNA according to the instructions. The resulting cDNA was then diluted 10-fold for later use.

[0098] 3. RT-qPCR detection of MuNICE3 gene expression

[0099] Using MuGAPDH as an internal reference gene, the expression pattern of MuNICE3 gene in different developmental stages and tissues of common thrips was detected by RT-qPCR (primers are shown in Table 3).

[0100] RT-qPCR reaction system: 2.5 μL cDNA template, 2.5 μL each of primers F and R (10 μM), 25 μL TBGreen, and 17.5 μL ddH2O.

[0101] The RT-qPCR reaction program is as follows: initial denaturation stage: 95℃ denaturation for 30s; quantitative analysis stage: 95℃ denaturation for 5s, 60℃ annealing for 30s, 40 cycles; melting curve: 95℃: 5s (4.4℃ / s), 60℃ (2.2℃ / s), 95℃ (0.11℃ / s, 5 photos taken for every 1℃ increase).

[0102] The final result calculation uses 2 -△△Ct The calculation is performed using the method (Ct represents the cycle number).

[0103] II. Experimental Results

[0104] The MuNICE3 gene expression level was highest in female adult thrips, followed by that in pseudopupae; the expression levels were similar and low in 1st instar, 2nd instar, and male adults. Figure 4A)(F 5,12 =852.566, P<0.001).

[0105] The highest expression level of the MuNICE3 gene in different tissues of the common thrips was in the ovary, followed by the salivary glands, epidermis, and midgut. Figure 4 B)(F 3,8 =1899.741, P<0.001).

[0106] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A lethal gene MuNICE3 in common thrips, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

1.

2. A dsRNA for controlling common thrips, characterized in that, It targets the lethal gene MuNICE3 as described in claim 1.

3. The dsRNA according to claim 2, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO:

2.

4. The dsRNA according to claim 3, characterized in that, The dsRNA also has a promoter sequence at its 5' and / or 3' ends.

5. The dsRNA according to claim 3, characterized in that, The promoter sequence is the T7 promoter sequence, and the nucleotide sequence of the T7 promoter is shown in SEQ ID NO:

4.

6. A method for controlling common thrips, characterized in that, Feeding common thrips with the dsRNA as described in any one of claims 2 to 5.

7. A kit for controlling common thrips, characterized in that, It contains the dsRNA according to any one of claims 2 to 5.

8. The reagent kit according to claim 7, characterized in that, It also contains in vitro transcription reagents.

9. The application of the dsRNA according to claim 2 in the control of common thrips.

10. The use of the dsRNA according to claim 2 in the preparation of products for the prevention and control of common thrips.

Images