Sucrose non-fermentation 1 related protein kinase gene RkSnf1 and application thereof

Abstract

The invention discloses a sucrose non-fermentation 1 related protein kinase gene RkSnf1. A coding nucleotide sequence of the sucrose non-fermentation 1 related protein kinase gene RkSnf1 is shown as SEQ ID NO: 2; according to the invention, a knockout gene RkSnf1 plasmid is constructed according to the gene and is transferred into rhodosporidium rhodosporicola YM25235, and an experimental result shows that the total carotenoid synthesis amount of an obtained RkSnf1 gene knockout strain is remarkably increased compared with that of wild rhodosporidium rhodosporicola YM25235, and the result shows that a gene knockout engineering bacterium constructed based on the gene provided by the invention can be used for synthesis of carotenoid; the method has important theoretical significance and potential economic value for research on regulation and control of carotenoid synthesis.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a sucrose non-fermentable protein kinase 1 gene. RkSnf1 and its role in promoting the growth of Rhodotorula rubrum ( Rhodosporidium kratochvilovae Applications in the production of carotenoids. Background Technology

[0002] Carotenoids are a general term for an important class of natural pigments, belonging to the terpenoid family. They possess multiple conjugated double bonds and are generally yellow, orange, or red in color. The structure of carotenoids is based on isoprene units; most typical carotenoid chemical structures contain 40 carbon atoms, formed by the polymerization of eight isoprene units. Carotenoids have a wide variety of biological functions. They are precursors to vitamin A in the human body, but humans and animals cannot synthesize them themselves; therefore, ingesting carotenoids can enhance human immunity. In addition, carotenoids also have coloring, antioxidant, anti-apoptotic, and anti-cancer effects. Microbial cells sense and transduce external stimuli through signal transduction pathways, synthesizing metabolites such as unsaturated fatty acids and carotenoids that help microorganisms resist adverse environments.

[0003] In yeast, sucrose non-fermentation 1 (SNF1)-associated protein kinase (SnRK) is homologous to the mammalian AMPK protein complex. It is a trimer composed of the Snf1 catalytic subunit, the Snf4 regulatory subunit, and one protein from the Gal83 / Sip1 / Sip2 family. In the absence of glucose, it promotes microbial respiratory metabolism, glycogen accumulation, and gluconeogenesis by inhibiting the transcription factor Mig1 or by stimulating the transcription activators Cat8 and Sip4. Besides participating in the desuppression of glucose-controlled genes, SNF1-associated protein kinase is involved in various physiological processes, including meiosis and sporulation, senescence, autophagy, and biofilm formation. SNF1-associated protein kinase is also involved in lipid metabolism in yeast. It can activate transcription factors, enhance the expression of fatty acid oxidation-related genes, thereby enhancing fatty acid β-oxidation, and plays an important role in the regulation of intracellular acetyl-CoA homeostasis and global histone acetylation. Studies have shown that SNF1-associated protein kinase is also involved in yeast's response to environmental stresses, such as heat shock, alkaline pH, and salt stress.

[0004] The Snf1 subunit is the catalytic core of SNF1-related protein kinases, possessing protein kinase activity and playing a crucial role in energy metabolism, stress response, and carbon source utilization in yeast cells. It contains a typical serine / threonine protein kinase domain, helping cells maintain homeostasis and survival by regulating carbon metabolism, gene expression, and activating stress response pathways. The Snf1 subunit plays a vital role in carbon metabolism. It phosphorylates various metabolic enzymes and regulates transcription factor expression and carbon metabolism pathways. Under low glucose conditions, the Snf1 subunit inhibits glycolysis by phosphorylating glycolysis-related enzymes, reducing glucose consumption. It can also activate key enzymes in the gluconeogenesis pathway, promoting the conversion of non-carbohydrate substances into glucose. Furthermore, the Snf1 subunit regulates fatty acid metabolism, inhibiting fatty acid synthesis and promoting fatty acid oxidation to provide energy for the cell. Summary of the Invention

[0005] This invention provides a sucrose non-fermentation 1-related protein kinase gene. RkSnf1 This gene was derived from *Rhodotorula rubrum* (…). Rhodosporidium kratochvilovae The sucrose non-fermentation 1-related protein kinase was isolated from YM25235; the genomic nucleotide sequence of this sucrose non-fermentation 1-related protein kinase is shown in SEQ ID NO:1 (2877bp), its encoding nucleotide sequence is shown in SEQ ID NO:2 (2331bp), and the amino acid sequence encoded by this gene is shown in SEQ ID NO:3. The *Rhodotorula rubrum* (YM25235) was used to isolate this sucrose non-fermentation 1-related protein kinase. Rhodosporidium kratochvilovae Genes RkSnf1 Knockout of this gene promotes the synthesis of carotenoids in Rhodotorula rubrum.

[0006] To achieve the above-mentioned objectives of the present invention, the technical solution of the present invention is as follows: 1. The genome of *Rhodotorula rubrum* strain YM25235 was extracted using the CTAB method. Using the genome as a template, primers were then applied... RkSnf1 -F、 RkSnf1 -R, the sucrose non-fermentable protein kinase 1 gene was obtained by PCR amplification. RkSnf1 The sequences were obtained by designing gRNAs using the CRISPR online website and conducting comprehensive evaluations on the website, resulting in gRNA1 and gRNA2 sequences. 2. Primers were synthesized by Sangon Biotech Co., Ltd. based on the sequences of gRNA1 and gRNA2. RkSnf1 -sgRNA1-F, RkSnf1 -sgRNA1-R, RkSnf1 -sgRNA2-F, RkSnf1 -sgRNA2-R; using plasmid pRU2034 as a template, pRGEcoRI-F, RkSnf1sgRNA1 fragment 1 was obtained by amplification with sgRNA1-R; [The following text appears to be incomplete and requires further context:] RkSnf1 sgRNA1-F and pRUGPD1-EcoRI-R amplification yielded sgRNA1 fragment 2; sgRNA1 fragment 1 and fragment 2 were ligated into the enzyme-digested pRU2034 vector to obtain... RkSnf1 Gene knockout plasmid pRU2034 / RkSnf1-sgRNA1; Using pRU2034 as the template, and employing pRGEcoRI-F, RkSnf1 sgRNA2-R amplification yielded sgRNA2 fragment 1; [The following text appears to be incomplete and requires further context:] RkSnf1 sgRNA2 fragment 2 was obtained by amplification with sgRNA2-F and pRUGPD1-EcoRI-R; sgRNA2 fragment 1 and fragment 2 were ligated into the enzyme-digested pRU2034 vector to obtain RkSnf1 Gene knockout plasmid pRU2034 / RkSnf1-sgRNA2; 3. Using PEG-mediated protoplast transformation to... RkSnf1 Gene knockout plasmids pRU2034 / RkSnf1-sgRNA1 and pRU2034 / RkSnf1-sgRNA2 were transformed into strain YM25235 / RkURA3∆, and transformants were screened to obtain RkSnf1 The gene knockout strain YM25235 / RkSnf1Δ was cultured, and the carotenoid content was extracted and determined.

[0007] Advantages and technical effects of this invention: This invention provides a novel sucrose non-fermentation 1-related protein kinase gene. RkSnf1 A gene knockout plasmid was constructed based on this gene and transformed into *Rhodotorula rubrum* YM25235. Experimental results showed that... RkSnf1 Compared with wild-type Rhodotorula rubrum yeast YM25235, the gene knockout strain showed a significant increase in total carotenoid synthesis, indicating that the gene knockout engineered strain constructed based on the gene provided in this invention can be used for carotenoid synthesis. This invention has important theoretical significance and potential economic value for the study of regulating carotenoid synthesis. Attached Figure Description

[0008] Figure 1 for RkSnf1 A schematic diagram of the PCR amplification results of the gene. In the diagram: lane 1 is the DNA marker; lane 2 is the negative control; lane 3 is... RKSnf1 PCR amplification products of genes; Figure 2 A schematic diagram of the plasmid pRU2034 / RkSnf1-sgRNA1 for gene knockout. Figure 3 A schematic diagram of the plasmid pRU2034 / RkSnf1-sgRNA2 for gene knockout. Figure 4 This diagram illustrates the colony PCR verification results for the pRU2034 / RkSnf1-sgRNA1 and pRU2034 / RkSnf1-sgRNA2 knockout plasmids. In the diagram: Lane 1 is the DNA marker; Lanes 2-7 are the PCR products of transformants 1-6 of the pRU2034 / RkSnf1-sgRNA1 knockout plasmid; Lanes 8-13 are the PCR products of transformants 1-6 of the pRU2034 / RkSnf1-sgRNA2 knockout plasmid. Figure 5 PCR validation of gene knockout plasmid transformation in *Rhodotorula rubrum*; In the figure: Lane 1, DNA marker; Lane 2, blank control group (template ddH2O); Lane 3, PCR product (containing introns) using the YM25235 genome as a template; Lane 4, transformant YM25235 / RkSnf1 Δ-741; Figure 6 for RkSnf1 Results of gene deletion analysis; Figure 7 To knock out strain YM25235 / RkSnf1 Results of total carotenoid content analysis of Δ-741 and control strain YM25235. Detailed Implementation

[0009] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the reagents and methods used in the embodiments are all conventional reagents and conventional methods. In the examples below, plasmid pRU2034 and strain YM25235 / RkURA3∆ were prepared according to the method described in Xiong Chao’s “Study on the relationship between RkACS2 and Rhodotorula rubrum YM25235 carotenoid and lipid synthesis under glucose starvation stress [D]. Kunming University of Science and Technology, 2024.” SCD(UΔ) solid culture medium formula (1 L): 20 g glucose, 100 mL of 10× amino acid (UΔ) stock solution, 5 g ammonium sulfate, 1.7 g YNB, 18 g agar powder, add 900 mL ddH2O; Amino acids (UΔ) 10× stock solution (100mL): Cysteine ​​0.1g, Arginine 0.1g, Lysine 0.1g, Threonine 0.1g, Aspartic acid 0.05g, Isoleucine 0.05g, Phenylalanine 0.05g, Proline 0.05g, Serine 0.05g, Tyrosine 0.05g, Valine 0.05g, Methionine 0.05g, Tryptophan 0.1g, Histidine 0.05g, Leucine 0.1g, Adenine 0.1g; Citrate buffer: 0.58 g citric acid, 10.97 g mannitol, 0.58 g sodium citrate, bring to a final volume of 200 mL, pH 5.4, filtered through a 0.22 μm sterile membrane; PTC buffer: Tris-HCl 0.156g, anhydrous calcium chloride 1.108g, polyethylene glycol 3350 50g, bring to a final volume of 100mL, filter through a 0.22μm sterile membrane; STC buffer: 1.108 g anhydrous calcium chloride, 21.86 g sorbitol, 0.156 g Tris-HCl, bring to a final volume of 100 mL, sterilize at 115 °C for 20 min; Enzyme mixture: 0.03g of lysozyme (Guangdong Institute of Microbiology), 0.125g of snail enzyme (Solepro), diluted to 4mL with sodium citrate buffer, filtered through a 0.22 μm sterile membrane; CTAB genomic extraction solution: CTAB 4g, Tris-HCl 3.152g, EDTA (anhydrous) 1.169g, NaCl 16.3632g, diluted to 200mL, pH 8.0.

[0010] Example 1: Sucrose non-fermentable protein kinase 1 gene RkSnf1 Acquisition 1. The genome of *Rhodotorula rubrum* strain YM25235 was extracted using the CTAB method. Using this genome as a template, primers were then used... RkSnf1 -F:5'-ATGAGCAACCGCGTCCACC-3'、 RkSnf1 -R: 5'-TCATGCCGCCGAGGGAG-3', the gene fragment was obtained by PCR amplification. The PCR amplification system is as follows:

[0011] The PCR amplification conditions were: 95℃ pre-denaturation for 5 min, followed by 95℃ denaturation for 30 s, 62℃ annealing for 30 s, 72℃ extension for 3 min, for a total of 30 cycles, and a final extension at 72℃ for 10 min.

[0012] Analysis by agarose gel electrophoresis ( Figure 1 Sequencing yielded a fragment with a size of 2877 bp. RkSnf1Genomic nucleotide fragments.

[0013] Example 2: RkSnf1 Construction of gene knockout plasmids 1. Obtained according to Example 1 RkSnf1 Genomic nucleotide sequences were obtained, and gRNAs were designed using the CRISPR online platform. After designing and comprehensively evaluating the gRNAs on the platform, the sequences of gRNA1 and gRNA2 were obtained, as follows: gRNA1: 5'-GAAGAGGTTGCAGATCTGTG (TGG)-3', positive strand 1371-1390bp; gRNA2: 5'-GTGCAGTGGTGTCAGCACGG (CGG)-3', antisense strand 2337-2356bp; Primers were synthesized by Sangon Biotech Co., Ltd. based on the gRNA1 and gRNA2 sequences. RkSnf1 -sgRNA1-F, RkSnf1 -sgRNA1-R, RkSnf1 -sgRNA2-F, RkSnf1 -sgRNA2-R, primer sequence is as follows: pRG Eco R IF: 5'-TACTGAATTAACGCCGAATTG-3'; pRUGPD1- Eco R IR: 5'-AGAGAACAAGAATTCCGAAGTTATATTAAGGGTTGTC-3'; RkSnf1 -sgRNA1-F: 5'- GAGATCGTCGATGACCTCTGGTTTTAGAGCTAGAAATAGC -3'; RkSnf1 -sgRNA1-R: 5'- CAGAGGTCATCGACGATCTCAGGAGCTCGCCTGTATC -3'; RkSnf1 -sgRNA2-F: 5'- GTGCAGTGGTGTCAGCACGGGTTTTAGAGCTAGAAATAGC -3'; RkSnf1 -sgRNA2-R: 5'- CCGTGCTGACACCACTGCACAGGAGCTCGCCTGTATC -3'; 2. Using plasmid pRU2034 as a template, pRG was employed. Eco R IF, RkSnf1sgRNA1-R amplification yielded sgRNA1 fragment 1 (SEQ ID NO:4); [The following text appears to be incomplete and requires further context:] RkSnf1 sgRNA1 fragment 2 (SEQ ID NO:5) was obtained by amplification using sgRNA1-F and pRUGPD1-EcoRI-R; the amplification system is as follows: sgRNA1 fragment 1 amplification system:

[0014] The PCR amplification conditions were: 95℃ pre-denaturation for 5 min, followed by 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles, and a final extension at 72℃ for 10 min.

[0015] sgRNA1 fragment 2 amplification system:

[0016] The PCR amplification conditions were: 95℃ pre-denaturation for 5 min, followed by 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles, and a final extension at 72℃ for 10 min.

[0017] 3. The plasmid pRU2034 was digested with the restriction endonuclease EcoRI, recovered, and sgRNA1 fragments 1 and 2 were ligated into the digested pRU2034 vector using a one-step cloning method to obtain the desired results. RkSnf1 Gene knockout plasmid pRU2034 / RkSnf1-sgRNA1 ( Figure 2 ); The enzyme digestion system is as follows:

[0018] Gently mix the prepared solution, centrifuge briefly, and then let it stand at 37°C for 5 hours to react. The connection system is as follows:

[0019] React at 37°C for 30 minutes.

[0020] 4. Following the methods in steps 2 and 3, using pRU2034 as a template, and employing pRGEcoR IF, RkSnf1 sgRNA2-R amplification yielded sgRNA2 fragment 1 (SEQ ID NO:6); [The following text appears to be incomplete and requires further context:] RkSnf1 sgRNA2 fragment 2 (SEQ ID NO:7) was obtained by amplification with sgRNA2-F and pRUGPD1-EcoRI-R; sgRNA2 fragment 1 and fragment 2 were ligated into the enzyme-digested pRU2034 vector to obtain RkSnf1Gene knockout plasmid pRU2034 / RkSnf1-sgRNA2 ( Figure 3 ); 5. RkSnf1 Gene knockout plasmid transformed into E. coli and validated (1) Take out the competent Escherichia coli DH5α stored at -80℃, thaw it on ice, and take 50μL for later use; (2) Take 5 μL of each RkSnf1 Gene knockout plasmids pRU2034 / RkSnf1-sgRNA1 and pRU2034 / RkSnf1-sgRNA2 were added to competent DH5α bacterial suspension, gently tapped to mix, and then incubated on ice for 30 minutes. (3) Heat shock the mixture in a 42°C water bath for 45 seconds, then immediately place it on ice to cool for 2-3 minutes; (4) Add 900 μL of pre-cooled LB liquid medium to the above mixture and incubate at 37°C and 100 rpm for 1 hour; (5) Centrifuge at 5000 rpm for 5 minutes, discard 900 μL of supernatant, gently pipette to mix the bacterial pellet, spread the mixed bacterial solution evenly on LB solid medium containing Spe antibiotic, and incubate at 37°C upside down overnight. (6) Pick a single colony from the LB plate, add it to 10 μL of sterile ddH2O, mix by pipetting, place it in a PCR instrument, heat at 98℃ for 10 minutes, after the reaction is complete, centrifuge at 10000 rpm for 5 minutes, and take the supernatant as the template for colony PCR. (7) Using the supernatant as a template, PCR amplification was performed using primers pRGEcoR IF and pRUGPD1-EcoR I-R. The amplification system is as follows:

[0021] The PCR amplification conditions were as follows: PCR amplification was performed at 95℃ for 5 min, followed by denaturation at 95℃ for 1 min, annealing at 60℃ for 1 min, extension at 72℃ for 1 min, for a total of 30 cycles, and finally extension at 72℃ for 10 min.

[0022] The amplification products were verified by agarose gel electrophoresis, and the results are as follows: Figure 4 As shown, the fragment size is consistent with expectations, initially indicating... RkSnf1 Gene knockout plasmids pRU2034 / RkSnf1-sgRNA1 and pRU2034 / RkSnf1-sgRNA2 were successfully constructed. Single colonies, verified by colony PCR, were inoculated into LB liquid medium containing Spe antibiotic (100 μg / mL) and cultured overnight at 37°C with shaking at 160 rpm. Subsequently, 5 mL of the bacterial culture was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The primers used for sequencing were pRGEcoR IF and pRUGPD1-. Eco RI –R; the sequencing results are consistent with expectations, indicating RkSnf1 Gene knockout plasmids pRU2034 / RkSnf1-sgRNA1 and pRU2034 / RkSnf1-sgRNA2 were successfully constructed.

[0023] Example 3: RkSnf1 Obtaining gene knockout strains 1. Using protoplast transformation method to RkSnf1 Gene knockout plasmid transformed into auxotrophic strain YM25235 / RkURA3Δ (1) Select a single colony of the streaked activated auxotrophic strain YM25235 / RkURA3Δ, inoculate it into 5 mL of YPD liquid medium, and incubate at 30 °C and 160 rpm for 12 hours; (2) Take an appropriate amount of the above bacterial culture and inoculate it into 50 mL of YPD liquid culture medium. Incubate at 30℃ and 160 rpm until the OD600 value is approximately 0.58. (3) Centrifuge at 5000 rpm and 4℃, discard the supernatant and collect the bacterial cells; resuspend the bacterial cells in 10 mL of pre-cooled sodium citrate buffer, centrifuge again and discard the supernatant, repeat once, and then resuspend the bacterial cells in 1 mL of pre-cooled sodium citrate buffer. (4) Add 4 mL of enzyme mixture to the bacterial suspension and enzymatically hydrolyze it at 30 °C and 90 rpm for 2.5 hours to destroy the cell wall and obtain protoplasts; (5) After the enzymatic digestion is completed, centrifuge at 1300r and 4℃ for 11 minutes to collect the bacterial cells. Resuspend the bacterial cells in 10 mL of pre-cooled STC buffer, centrifuge again and discard the supernatant. Repeat once, and then resuspend the bacterial cells in 1 mL of STC buffer. Prepare pre-cooled 5 mL sterile centrifuge tubes and dispense 100 µL of bacterial suspension into each tube. (6) Add 3µg of equal amounts of mixed plasmid pRU2034 / RkSnf1-sgRNA1 and plasmid pRU2034 / RkSnf1-sgRNA2, and let stand on ice for 10 minutes. Then add 200µL of pre-chilled PTC buffer to each tube, and let stand on ice for 10 minutes. Repeat once, then add 800µL of pre-chilled PTC buffer, gently pipette to mix, and place in a 42℃ water bath for 30 minutes. (7) Add 2 mL of YPD medium containing 0.4 M sucrose and incubate at 30℃ and 90 rpm for 24 hours; (8) Then add 2 mL of 0.4 M sucrose YPD medium and incubate at 28 °C and 90 rpm for 24 h; (9) After incubation, the cells were collected by centrifugation at 1300r and 4℃ for 11 min. Most of the supernatant was discarded, and the cells were resuspended in the remaining supernatant and evenly spread on SCD(UΔ) solid medium. Uracil defects were used for screening. 2. RkSnf1 Screening of gene knockout strains (1) Transfer the colonies that can grow normally on SCD(UΔ) solid medium to a new SCD(UΔ) solid medium and number them. Then inoculate them into 5 mL of YPD liquid medium and incubate at 28 °C and 160 rpm for 12 hours. (2) Genomic DNA of the strain was extracted using the CTAB method; (3) Using the extracted genomic DNA as a template, primers were used. RkSnf1 -F and RkSnf1 -R is used for PCR amplification, and the PCR reaction system is as follows:

[0024] The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min, then 95℃ denaturation for 30 s, 62℃ annealing for 30 s, 72℃ extension for 3 min, for a total of 30 cycles, and finally 72℃ extension for 10 min.

[0025] After PCR amplification, the PCR products were separated by agarose gel electrophoresis; using strain YM25235 as a control, the results are as follows. Figure 5 As shown, the bands amplified by strain YM25235 were of normal size, while the bands amplified by the transformants were significantly smaller than those of the control. The size of the deleted fragment was similar to the distance between the two sgRNAs, suggesting... RkSnf1 The gene has been successfully knocked out.

[0026] Further verification was performed via genome sequencing. The PCR products were sent to Shanghai Bioengineering Biotechnology Co., Ltd. for sequencing, using primers [missing information]. RkSnf1 -F、 RkSnf1 -R; sequencing results are as follows Figure 6 As shown, sequencing results indicate that both RkSnf1sgRNA1 and RkSnf1sgRNA2 successfully guided the Cas protein to specifically recognize [the target protein]. RkSnf1 The corresponding sites on the gene were cut 3 bp upstream of the sgRNA1PAM sequence and 4 bp downstream of the sgRNA2PAM sequence, causing DNA breaks and a 953 bp deletion, thus successfully knocking out the gene. RkSnf1 , will genes RkSnf1The knockout strain was named YM25235 / RkSnf1 Δ-741.

[0027] Example 4: RkSnf1 Gene knockout strain YM25235 / RkSnf1 Δ-741 Carotenoid Content Analysis The positive transformant YM25235 / RkSnf1 Δ-741 was inoculated into 50 mL of YPD liquid medium and fermented at 28 °C and 160 rpm for 168 h. The cells were then collected by centrifugation at 4500 rpm for 6 min into 50 mL centrifuge tubes. The tubes were washed twice with pre-cooled ddH2O, and finally centrifuged at 4500 rpm for 8 min to completely remove the supernatant. The tube walls were gently tapped to ensure even adhesion of the cells to the inner wall. The tubes were then dried at 55 °C. The cells were then ground into powder. 0.4 g of the powder was used to extract total carotenoids using an acetone-methanol mixture (V:V:Methanol = 4:1). [The text abruptly ends here, likely due to an incomplete sentence or missing information.] The method described in Yang Wanzheng et al.'s "Improved Method for Determining Total Carotenoids in Seabuckthorn Oil by Ultraviolet Spectrophotometry [J]. Journal of Central University for Nationalities (Natural Science Edition), 2009, 18(03): 5-8" utilizes an ultraviolet-visible spectrophotometer, taking wild-type Rhodotorula rubrum strain YM25235 as a control, to measure absorbance at 450 nm and calculate the total carotenoid content. The total carotenoid synthesis of wild-type Rhodotorula rubrum strain YM25235 was 3.63±0.15 mg / g DCW, while the total carotenoid synthesis of the knockout strain YM25235RkSnf1Δ-741 was 6.04±0.64 mg / g DCW, significantly higher than that of wild-type Rhodotorula rubrum strain YM25235. Figure 7 As shown, the results indicate that knocking out RkSnf1 The gene can cause an increase in the total carotenoid content in the YM25235 strain of Rhodotorula rubrum.

Claims

1. A sucrose non-fermentation 1-related protein kinase gene RkSnf1 Its encoding nucleotide sequence is shown in SEQ ID NO:

2.

2. Knockout of the sucrose non-fermentable protein kinase 1 gene as described in claim 1 RkSnf1 In promoting the growth of Rhodotorula rubrum ( Rhodosporidium kratochvilovae Applications in the production of carotenoids.

Images