Genetic transformation method of dendrobium nobile without genotype dependence and application of genetic transformation method

Abstract

The invention relates to a genotype-dependence-free dendrobium nobile genetic transformation method and application, and belongs to the technical field of genetic engineering. Comprising the following steps: taking embryonic calluses, protocorms or protocorm-like bodies of dendrobium nobile as explants; introducing the binary vector carrying the target gene into agrobacterium to prepare an infection solution, and infecting the explant; after co-culture, transferring to a culture medium containing a screening agent to obtain a resistant explant; and carrying out differentiation and rooting culture to obtain a transgenic plant. By systematically optimizing a plant growth regulator combination, an agrobacterium strain type, an infection mode and an auxiliary screening mode, an efficient and stable genetic transformation system which does not depend on a specific genotype and takes multiple types of explants as receptors is established for the first time, and the problems that a traditional method is high in genotype dependency and limited in tissue type are solved; the method shows good applicability and repeatability in a plurality of dendrobium hybrids, and provides a general technical platform for gene function research and molecular breeding.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a genotype-independent method for genetic transformation of Dendrobium nobile and its application. Background Technology

[0002] Dendrobium nobile ( Phalaenopsis- type Dendrobium hybrids, Den-Phals, are composed of the genus Dendrobium (… Dendrobium Phalaenopsis orchid section Phalaenopsis Dendrobium is a type of horticultural cultivar bred through hybridization and selection among different species within the Orchidaceae family. Dendrobium nobile is the second largest genus in the family Orchidaceae. Autumn Dendrobium has vibrant colors and unique flower shapes, and a long post-harvest viewing period. Its hybrids are widely used as cut flowers and potted ornamental plants, making it an important part of the global tropical flower industry. Furthermore, some Dendrobium hybrids have a long history of use in traditional Asian herbal medicines, further enhancing their economic value.

[0003] However, with the rapid development of the floriculture industry, the main cultivated varieties on the market are still those with single flower colors and highly repetitive genetic backgrounds, which severely restricts the ornamental appeal and commercial competitiveness of Dendrobium nobile. Traditional breeding has played an important role in variety improvement, but due to factors such as the long juvenile period of Dendrobium nobile, limited spontaneous genetic variation, and a narrow germplasm resource gene pool, conventional breeding methods are difficult to achieve efficient genetic improvement. In contrast, genetic engineering breeding has the advantages of targeted improvement of specific traits and a short breeding cycle, and is expected to overcome the above bottlenecks.

[0004] To date, despite numerous research reports on transgenic breeding of *Dendrobium nobile*, problems such as low transformation efficiency, complex operations, and strong genotype dependence are prevalent. Currently, only a few *Dendrobium* species have achieved stable transformation of exogenous genes and trait improvement. Whether it's gene modification (GM) or CRISPR / Cas-based gene editing (GE) technology, successful application highly depends on a stable and efficient genetic transformation platform. Over the past thirty years, although a few studies have achieved transgenic improvement of traits such as flower color and shape in *Dendrobium nobile*, and in recent years there have been genome-targeted editing studies in *Dendrobium officinale* (… D. officinale ), D. While there have been reports of successful applications of CRISPR / Cas genome editing in 'Chao Praya Smile' and other Phalaenopsis species, the fundamental reason for the lack of efficient and universal genetic transformation systems is the absence of such systems in Dendrobium nobile.

[0005] In recent years, several functional genes related to ornamental traits and stress response have been identified in *Dendrobium nobile*, and preliminary functional analyses have been conducted using multi-omics analysis, transient overexpression, dsRNA silencing, and virus-induced gene silencing (VIGS). While these methods provide feasible pathways for gene function research, the lack of a stable genetic transformation system makes it difficult to apply these genes to practical breeding. Currently, only a few *Dendrobium* species have established genetic transformation systems, and the transformation efficiency is generally low. Notably, most studies use "resistance explant rate" rather than "transgenic line acquisition rate" as the statistical indicator of transformation efficiency, and resistance rates vary significantly among different varieties, for example... D. The nobile rate is 0.5% to 18%. D. The percentage of officinale ranges from 5% to 46.2%. Given the highly heterogeneous genetic background of commercially available Dendrobium officinale, establishing a separate transformation system for each variety is neither practical nor economical. Therefore, developing a systematic, efficient, and genotype-independent genetic transformation method is of great significance for advancing molecular breeding research on Dendrobium officinale.

[0006] This study systematically optimized key parameters for Agrobacterium-mediated genetic transformation of Dendrobium nobile, including explant type, Agrobacterium strain, infection concentration and mode, and screening strategy. A stable and reproducible genetic transformation system independent of explants was successfully established, with an average transformation efficiency of approximately 20% (based on the rate of transgenic line acquisition). The stable integration and expression of exogenous genes were verified through eGFP fluorescence observation, PCR analysis, and NPTII protein detection. The establishment of this platform provides crucial technical support for the validation of functional genes in Dendrobium nobile and its molecular breeding applications, such as genome editing and multi-gene aggregation breeding. Summary of the Invention

[0007] The purpose of this invention is to provide a genotype-independent genetic transformation method for Dendrobium nobile and its application. As an important ornamental flower in tropical regions, Dendrobium nobile currently lacks an efficient and genotype-independent genetic transformation system, which limits its genetic engineering breeding progress.

[0008] Based on the previously established regeneration system, this study systematically optimized the combination of plant growth regulators to improve the proliferation and differentiation of embryogenic callus (ECs), protocorms, and protocorms-like cells (PLBs), and established a genetic transformation method mediated by Agrobacterium rhizogenes. The study found that the Agrobacterium strain is a key factor affecting transformation efficiency, with Agrobacterium rhizogenes K599 showing the best performance among the compared strains. Meanwhile, the use of negative pressure-assisted transformation combined with eGFP fluorescence-assisted screening significantly improved transformation efficiency and reduced the chimerism rate of transgenic plants. eGFP fluorescence observation, NPTII protein detection, and PCR analysis confirmed that the exogenous gene had been integrated into the genome and stably expressed in leaf tissues. The average transformation efficiencies of ECs, PLBs, and protocorms reached 19.09%, 19.16%, and 14.48%, respectively, with the fastest time from explant transformation to obtaining transgenic plants being only 131 days. The establishment of this system provides important technical support for the analysis of functional genes and the genetic improvement of ornamental traits in Dendrobium nobile.

[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a genotype-independent method for genetic transformation of Dendrobium nobile, comprising the following steps: (1) Explant preparation: select embryogenic callus, protocorm or protocormoid of Dendrobium nobile as explants; (2) Agrobacterium infection: A binary vector carrying the target gene is introduced into Agrobacterium to prepare an Agrobacterium infection solution, which is then used to infect the explants; (3) Co-culture: The infected explants were placed in a co-culture medium for co-culture; (4) Screening culture: The co-cultured explants were transferred to a screening medium containing screening agents, and resistant explants were obtained by screening with the help of visual screening marker genes; (5) Differentiation and rooting: eGFP-expressing resistant explants were transferred to differentiation medium to induce shoot differentiation, and then transferred to rooting medium to induce rooting, thus obtaining transgenic plants.

[0010] Preferably, the Agrobacterium in step (2) is strain K599 or other types of Agrobacterium rhizogenes.

[0011] Preferably, the infection in step (2) is negative pressure assisted infection, with a negative pressure condition of -0.08 to -0.10 MPa and an infection time of 20 to 35 min.

[0012] Preferably, the OD of the Agrobacterium infection solution described in step (2) is... 600 The value is 0.6~0.8.

[0013] Preferably, the screening agent in step (4) is G418 with a concentration of 30~50 mg / L.

[0014] Preferably, the temperature for co-culturing in step (3) is 22~23 ℃ and the co-culturing time is 2~4 days.

[0015] Preferably, the screening culture medium in step (4) also contains the antibacterial agent termethin, with a concentration of 100~400 mg / L.

[0016] Preferably, the binary vector carries an eGFP reporter gene or other visual reporter gene, and positive explants are screened by eGFP fluorescence expression in step (4).

[0017] Preferably, the Dendrobium nobile hybrid is D. 'Sonia Hiasakul' or other Dendrobium nobile hybrids.

[0018] This invention provides the application of the method in Dendrobium nobile genetic engineering breeding, functional gene verification, or genome editing.

[0019] Compared with the prior art, the present invention has the following beneficial effects: This invention establishes a genetic transformation system for Dendrobium nobile that is independent of specific genotypes and has broad adaptability, achieving for the first time highly efficient and stable transformation using embryogenic callus, protocorms, and protocorms as recipients. By systematically optimizing the combination of plant growth regulators, Agrobacterium strains, and infection methods, the system significantly enhances the transformation capacity for different explants, effectively overcoming the technical bottlenecks of strong genotype dependence and tissue type limitations in traditional methods. This system demonstrates good applicability and reproducibility in multiple varieties, providing a universal technical platform for gene function research and molecular breeding of Dendrobium nobile.

[0020] In terms of technical approach, this invention significantly improves transformation efficiency and the yield of transgenic plants by introducing three core innovative methods: Agrobacterium rhizogenes K599 strain, eGFP fluorescence-assisted screening, and negative pressure vacuum-assisted infection. Real-time visual screening with eGFP effectively reduces the proportion of chimeras and the false positive rate, significantly improving the screening efficiency of positive tissues. Negative pressure treatment overcomes the infection barrier of dense tissues, achieving highly efficient transformation of protocorms and protocormoids. The overall transformation efficiency has increased from 1.96% in the original method to 19.16%, with a maximum of 25%. Furthermore, the time from infection to obtaining complete transgenic plants is only 131 days, significantly shortening the transformation cycle and demonstrating good operability and timeliness.

[0021] The transformation system established in this invention is not only applicable to functional genomics research and genetic improvement of important ornamental traits in Dendrobium nobile, but also provides a referable technical paradigm for the genetic transformation of other Dendrobium species and even perennial monocotyledonous ornamental plants. Through this platform, targeted improvement of target traits such as flower color, flower shape, and disease resistance can be achieved efficiently, promoting the industrial application of Dendrobium nobile genetic engineering breeding and genome editing technologies, and possessing significant scientific value and commercial prospects. Attached Figure Description

[0022] Figure 1 eGFP-assisted screening is used for the production of high-efficiency transgenic plants; (A) Schematic diagram of the pZH84 vector. LB and RB: Left and right boundaries of T-DNA; P Ghubi :cotton( Gossypium hirsutum ubiquitin protein promoter; nptII Neomycin phosphotransferase II gene; T CaMV35S : Cauliflower mosaic virus 35S RNA terminator; P ScBV Sugarcane baculovirus promoter; eGFP Enhanced green fluorescent protein gene; T ocs Octopus alkaloid synthase terminator; attp , lox and RS2 All of these are recombinase recognition sites.

[0023] (B) Schematic diagram of eGFP-assisted screening, showing how to efficiently identify transgenic tissues during Agrobacterium-mediated transformation.

[0024] (C) Screening for transgenic lines that regenerated after three months. Transformation vector: pZH84.

[0025] (D) Small plants under bright field and excitation light. WT: wild-type plant; eGFP: pZH84 vector transgenic plant.

[0026] (E) PCR identification of resistant regenerated plants. M: Marker; S-: D. Wild-type plants of the 'Sonia Hiasakul' variety; A-: D. Wild-type plants of the 'Nobile Woman' variety. S1-S8: D. 'Sonia Hiasakul' resistant plants; A1-A9: D. 'Nobile Woman' resistant plant. Scale bar = 1 cm.

[0027] Figure 2 Transformation efficiency of different Agrobacterium strains; scale bar = 2 mm.

[0028] Figure 3 Transformation efficiency under different explant types, vacuum permeation, and Agrobacterium strains; scale bar = 2 mm.

[0029] Figure 4(A) NPTII protein was detected using NPTII test strips. WT: wild-type plants; ECs-, PLBs-, and PCs-derived lines: transgenic plants regenerated from embryogenic callus (ECs), protocormoids (PLBs), and protocormoids (PCs) explants, respectively.

[0030] (B) PCR amplification analysis of three leaves randomly selected from each transgenic plant. M: DNA marker; S- and A-: wild-type plants; EC-1 / 2 / 3 / 4 / 5: transgenic plants regenerated from embryogenic callus (ECs); PLB-1 / 2 / 3 / 4 / 5: transgenic plants regenerated from protocorms (PLBs); PC-1 / 2 / 3 / 4 / 5: transgenic plants regenerated from protocorms (PCs).

[0031] Figure 5 A flowchart illustrating the genetic transformation of Dendrobium nobile mediated by Agrobacterium rhizogenes using various explants.

[0032] Figure 6 The pZH84 vector spectrum. Detailed Implementation

[0033] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0034] Example 1 1. Experimental Materials This study used Dendrobium nobile, including D. 'Sonia Hiasakul' and D. 'Noble Woman'.

[0035] 2. Experimental Methods 2.1 Growth conditions The culture temperature was 25–28℃, the photoperiod was 12 h light / 12 h dark, and the light intensity was 40–60 μmol m. - ² s - ¹. D. Tissue culture seedlings of 'Sonia Hiasakul' were obtained through in vitro regeneration of stem segments, while D.Seeds of 'Noble Woman' are obtained through self-pollination. Green capsules, collected 5–6 months after pollination, are sterilized with a 2% sodium hypochlorite solution for 15 min, then immersed in 75% ethanol for 30 s and flame-sterilized. Seeds are sown under aseptic conditions on SM medium and cultured at 25–28°C with a 12 h light / 12 h dark photoperiod. Protocorms (PCs) are obtained after one month. Stem segments are cut from test-tube seedlings or tissue culture seedlings and inoculated onto embryogenic callus induction medium (EIM) and cultured at 25–28°C in the dark to induce embryogenic callus (ECs), which are then transferred to embryogenic callus proliferation medium (EPM) for further proliferation. Protocormoids (PLBs) are induced using protocorms or young stem segments as explants, inoculated onto PLB induction medium (PLBM), and cultured at 25±1°C with a 12 h light / 12 h dark photoperiod for two months. The composition of all culture media is shown in Table 1.

[0036] 2.2 Overexpression vectors and genetic transformation The binary vector used for genetic transformation in this study was pZH84 (a gift from Dr. Yongxiang of the South China Botanical Garden, Chinese Academy of Sciences). The vector contains... Scbv Promoter-driven enhanced green fluorescent protein (eGFP) gene. The vector is introduced into... A.tumefaciens strains EHA105 and GV3101 and A. rhizogenes strain K599.

[0037] 2.3 Agrobacterium-mediated genetic transformation of ECs, PLBs, and PCs Before infection, ECs, PLBs, and PCs were pre-cultured in EPM medium for 7 days. Agrobacterium carrying the target plasmid was first streaked on Luria–Bertani (LB) solid medium containing the corresponding antibiotic and cultured at 28°C for 3 days. Then, a single colony was picked and inoculated into 2 mL of LB liquid medium and cultured until the logarithmic growth phase. 0.5 mL of the bacterial suspension was evenly spread onto LB solid medium containing the corresponding antibiotic and cultured for 1 day until the plate was confluent. The bacterial cells were scraped from the plate and resuspended in SUM liquid medium, and the bacterial concentration was adjusted to OD. 600 The concentration was 0.7. ECs, PLBs, and PCs were immersed in the bacterial solution for 30 min. During infection, PLBs and PCs were subjected to vacuum permeation using an AP-01P vacuum pump (Preeco, Shanghai, China); while ECs were infected without vacuum treatment. After infection, excess bacterial solution on the explant surface was blotted dry with sterile filter paper, and then placed on co-culture medium (COM) covered with sterile filter paper and co-cultured in the dark at 22–23°C for 3 days. The composition of all culture media is shown in Table 1.

[0038] 2.4 Screening and Regeneration of Transgenic Plants After co-culture, all explants were transferred to selection medium (SEPM) for induction of ECs or other resistant explants and cultured in the dark at 25±1℃. After 2–3 rounds of selection (4 weeks per round), the expected transgenic explants were obtained and confirmed by eGFP fluorescence observation. The resistant explants were then transferred to differentiation medium (DS) and cultured at 25±1℃ under 12 h light / 12 h dark conditions to induce shoot differentiation. Once resistant seedlings were formed, they were transferred to rooting medium (RS) for continued growth and development. The composition of all media is shown in Table 1.

[0039] 2.5 eGFP fluorescence detection The fluorescence of eGFP in transgenic lines was observed using a dual-wavelength fluorescence excitation source (Exc 440 nm, Em 500 nm; 3415RG, LUYOR, China). Under dark conditions, green fluorescence was observed in transgenic tissues, while red autofluorescence was observed in non-transgenic controls.

[0040] 2.6 DNA Extraction and Molecular Detection Genomic DNA was extracted from plant tissues using a plant genomic DNA extraction kit (DN1503, Aidlab, Beijing, China), and DNA quality was assessed by agarose gel electrophoresis. PCR amplification was performed under standard conditions using 2×PCRMix (GenStar, Shanghai, China) and specific primers eGFP-F: gggagcagtatgcaagtgga and eGFP-R: gagcgttattagttcgccg (as shown in SEQ ID NO: 2 and 3), with an expected fragment length of 2485 bp. Furthermore, the expression of NPTII protein in G418 resistant transgenic plants was further detected using a rapid nptII transgenic detection strip (AG-011-SLF, Agenefast, Tianjin, China).

[0041] 2.7 Statistical Analysis All experiments were performed in at least three independent biological replicates. Transformation efficiency = (eGFP fluorescently expressed and PCR-positive transgenic lines / total number of infected explants) × 100%, and data are presented as the mean of three replicates ± SD. Data visualization was performed using GraphPad Prism 9.5 software. Statistical analysis was performed using SPSS 25.0 software, and differences between treatments were tested using one-way ANOVA.

[0042] 3. Results 3.1 Establishment of a high-efficiency embryogenic callus (ECs) induction and regeneration system of Dendrobium nobile Previous studies have identified protocorms (PCs) and young stem segments as suitable for inducing embryogenic callus (ECs) in *Dendrobium nobile*. Among the plant growth regulators tested, 2,4-dichlorophenoxyacetic acid (2,4-D) showed the most significant induction effect. When explants were inoculated with MSD (MS + 30 g L... - ¹ Glucose + 3 g / L - ¹ Plant-based gel) + 0.5 mg L - ¹ KT + 0.1–2 mg L - ¹ When 2,4-D was added, the induction rate of ECs was 10%–50%, and the induction efficiency was significantly affected by the concentration of 2,4-D. During subculture, the original proliferation medium (MSD + 0.5 mg L) was used. - ¹IBA + 0.5 mg L - Differentiation will occur at ¹KT). Add 0.2 mg L - ¹ 2,4-D effectively stabilizes EC proliferation. Therefore, this modified medium was used in the genetic transformation screening stage. An optimized regeneration system was also established: MSD + 0.5 mg L - ¹IBA + 0.15 mg L - ¹ KT induces rapid shoot differentiation, 1 / 2 MSD (MS only, large and small doses are halved) + 0.5 mg L - ¹ Rooting can be induced on NAA medium. Among the varieties tested, D. 'Sonia Hiasakul' had the highest EC induction rate (50%), and was therefore selected for subsequent genetic transformation experiments.

[0043] 3.2 Establishing a genetic transformation system using embryogenic callus as explants Embryogenic callus has the ability to regenerate into complete plants, and Agrobacterium-mediated genetic transformation is one of the most widely used and economical methods. Previous studies have preliminarily determined optimal transformation conditions: [The text abruptly shifts to a different topic] D. After 3 days of pre-culture (Sonia Hiasakul), OD 600 =0.7 A.tumefaciens EHA105 bacterial suspension was inoculated for 20 min and co-cultured at 22–23℃ in the dark for 3 days. After 3 months of selection culture and 2 months of differentiation, resistant adventitious shoots were obtained, and PCR analysis was performed to further confirm the transgenic positive lines. Under this system, the average genetic transformation efficiency was 1.96%, and the shortest time from infection to regeneration of adventitious shoots was approximately 5 months.

[0044] 3.3 Optimization of Agrobacterium-mediated inhibition and resistance screening system To mitigate the impact of Agrobacterium overgrowth on transformation efficiency, the inhibitory effects of carbenicillin (Carb) and termethin (TMT) on Agrobacterium EHA105 were systematically evaluated. Without the addition of antimicrobial agents, all explants were severely contaminated. Adding 200–300 mg / L of antimicrobial agent did not eliminate some contamination, but the contamination rate decreased to 0% when the concentration was increased to 400 mg / L. Compared to Carb, TMT exhibited a longer duration of inhibition, therefore it was selected as the antimicrobial agent for subsequent system construction (Table 2). Since Agrobacterium rhizogenes K599 is not sensitive to Carb, TMT was used as a universal antimicrobial agent, initially at 400 mg / L, and subsequently gradually reduced to 100 mg / L according to the screening cycle to reduce its inhibitory effect on explant growth.

[0045] Preliminary screening reagent sensitivity tests showed that Dendrobium nobile is highly sensitive to G418 but not sensitive to kanamycin. nptII The optimal screening agent for the gene is G418, with a suitable concentration range of 30–50 mg / L. Using a gradient screening strategy is beneficial for obtaining transforming lines stably.

[0046] 3.4 eGFP-assisted screening significantly improves transformation efficiency Because Dendrobium nobile embryogenic callus is highly prone to differentiation, in order to reduce the proportion of chimeras and improve the accuracy of positive identification, based on the established embryogenic callus genetic transformation system, a method was adopted using a reporter gene carrying eGFP (enhanced GFP) and... nptII pZH84 binary vector for screening marker genes (see schematic diagram) Figure 1 -A) Perform genetic transformation and pre-culture for 1 week. D. 'SoniaHiasakul' or D. 'Nobile Woman' embryogenic callus was used as explants. Infected with EHA105-pZH84 strain for 30 min, and co-cultured for 3 days before selection. eGFP fluorescent expression was observed after 3 weeks, enabling real-time observation and isolation of positive explants. Figure 1 B). After three rounds of selection (4 weeks each), most explants stably expressed eGFP ( Figure 1 C). After 2–3 months of differentiation, resistant adventitious shoots fully expressing eGFP were obtained. Figure 1 D). PCR results showed that all eGFP-expressing plants amplified the target band, while the non-fluorescent plants were all negative. Figure 1E). The results showed that resistant plants were not necessarily true transgenic lines, while all eGFP-expressing plants were true positives. Assisted screening based on fluorescent reporter genes significantly improved transformation efficiency, increasing it from 1.96% to 10.87% (E). Figure 2 This reduces the false positive rate and improves screening accuracy.

[0047] 3.5 The effect of Agrobacterium strains on the genetic transformation efficiency of Dendrobium nobile Strains are also a crucial factor affecting transformation efficiency. To compare the effects of different Agrobacterium strains on transformation efficiency, Agrobacterium rhizogenes K599, commonly used in current genetic transformation, and Agrobacterium tumefaciens EHA105 and GV3101, commonly used in horticultural plant genetic transformation, were selected. The transformation effects of three Agrobacterium strains—EHA105, GV3101, and K599—carrying the pZH84 binary vector were compared. The results showed significant differences in transformation efficiency among different strains. Figure 2 The average transformation efficiency mediated by EHA105 was 10.87%, while no eGFP-positive lines were obtained from GV3101. In contrast, the transformation efficiency mediated by Agrobacterium rhizogenes K599 was the highest, with an eGFP positivity rate of 19.09%.

[0048] The above results indicate that strain selection significantly affects transformation efficiency. Among them, K599 exhibits higher transformation ability in Dendrobium officinale genetic transformation and is the preferred strain for constructing a high-efficiency Dendrobium officinale transformation system.

[0049] 3.6 Negative pressure treatment significantly improves the genetic transformation efficiency of protocorms and protocorms. Given the difficulty in stably inducing embryogenic callus in some genotypes, the feasibility and efficiency of using protocorms and protocormoids as recipient materials for transformation were further evaluated. Compared to inducing embryogenic callus, some varieties more easily yield protocorms germinating from seeds and protocormoids induced from stem segments. The study used EHA105, GV3101, and K599 varieties carrying pZH84 to... D. 'Nobile Woman' protobulb and D. Conventional infection of 'Sonia Hiasakul' protocorms failed to yield eGFP-positive explants, resulting in a transformation efficiency of 0%. To improve exogenous gene delivery efficiency, explants were subjected to [further treatment] under conditions of OD600 = 0.7. The cells were treated with a negative pressure of 0.09 MPa for 30 min. The results showed that, in addition to the scratch treatment, the negative pressure-assisted infection increased the eGFP positivity rate of protocorms from 0% to 19.16%, and that of protocorms from 0% to 14.48%. Figure 3 B). Furthermore, significant differences remained between different strains: the transformation rate remained 0% after treatment with GV3101 and EHA105, while the transformation efficiency mediated by K599 was the highest. Figure 3 The above results demonstrate that negative pressure treatment can effectively overcome the limitations imposed by protocorms and protocorms on Agrobacterium infection, significantly improving transformation efficiency. Furthermore, it further verifies the advantages of Agrobacterium rhizogenes K599 in the genetic transformation of Dendrobium nobile.

[0050] 3.7 Verification of protein expression levels and genotype consistency in transgenic plants Plants identified as positive by eGFP fluorescence and PCR were further subjected to NPTII protein expression level detection. Leaves from embryogenic callus, protocorms, and transgenic plants obtained from protocorms were tested; all samples showed clear and specific bands on the NPTII resistance protein test strip. Figure 4 A) indicates that the exogenous gene achieves stable protein expression in the transgenic plants. To assess the genotypic consistency of the transgenic plants, five transgenic lines were randomly selected from different explants, and three leaves were randomly collected from each line to independently extract genomic DNA for PCR amplification. The results showed that all samples amplified a specific band of the expected size of 2485 bp (A). Figure 4 No negative or segregation phenomena were observed. This result indicates that the obtained transgenic plants have high genotypic consistency overall, suggesting that they are non-chimeric or transgenic plants containing only a very low proportion of chimeric tissue.

[0051] The specific amplified sequences, divided into segments, are as follows: a portion of the ScBV promoter region, the tobacco etched virus 5'UTR translation enhancer, the eGFP gene CDS region, other base sequences, and a portion of the ocs terminator sequence, as shown in SEQ ID NO: 1.

[0052] ctcgagattctcaacacaacatatacaaaacaaacgaatctcaagcaatcaagcattctacttctattgcagcaatttaaatcatttcttttaaagcaaaagcaattttctgaaaattttcaccatttacgaacgatagcc atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaa gcggccgctctaga gtcctgctttaatgagatatgcgagacgcctatgatcgcatgatatttgctttcaattctgttgtgcacgttgtaaaaaacctgagcatgtgtagctcagatccttaccg ccggtttcggttcattctaatgaatatatcacccgttatactatcgtatttttatgaataatattctccgttcaatttactgattgtaccctactacttatatgtacaatatt aaaatgaaaacaatatattgtgctgaataggtttatagcgacatctatgatagagcgccacaataacaaacaattgcgttttattattacaaatccaattttaaaaaaag cggcagaaccggtcaaacctaaaagactgattacataaatcttattcaaatttcaaaagtgccccaggggctagtatctacgacacaccgagcggcgaactaataacgctc 3.8 Establish an efficient and universal Agrobacterium rhizogenes-mediated genetic transformation system for Dendrobium nobile. By systematically optimizing the regeneration and screening system, a highly efficient genetic transformation system suitable for embryogenic callus (ECs), protocorms, and protocormoids (PLBs) was established. The transformation process is described in [link to documentation]. Figure 5 This system, with the aid of eGFP fluorescent marker gene screening, can significantly improve the acquisition rate of transgenic lines using embryogenic callus as explants; in bacterial culture OD... 600 Infected for 30 min under conditions of 0.7. Vacuum-assisted transformation at 0.09 MPa significantly improved the penetration of Agrobacterium rhizogenes into protocorms and protocormoids, increasing the transformation efficiency from 0% to 19.16%. eGFP fluorescence detection and PCR molecular identification confirmed that all positive explants stably transformed with the exogenous gene and differentiated into adventitious shoots. The regeneration rate of positive materials reached 100%, successfully rooting and yielding complete transgenic plants. The shortest transformation cycle was 131 days, with the highest transformation efficiency reaching 25%. Figure 2 The results show that this method has relatively high efficiency and stability in different types of explants, and can serve as a reliable technical platform for the genetic improvement of Dendrobium nobile.

[0053] This study addresses the long-standing bottlenecks in the genetic transformation of Dendrobium nobile, such as strong genotype dependence, low transformation efficiency, and the prevalence of chimeras. A Dendrobium nobile genetic transformation system with broad applicability and high stability has been established.

[0054] Regarding recipient materials, this study broke through the traditional method's dependence on a single explant type, for the first time simultaneously incorporating embryogenic callus, protocorms, and protocormoids into the recipient system. This flexibility effectively reduces dependence on specific genotypes, providing possibilities for the transformation of Dendrobium officinale materials with different genetic backgrounds. In terms of transformation technology, the study innovatively employed a combined strategy of Agrobacterium rhizogenes strain K599 and vacuum-assisted infection. Negative pressure treatment significantly enhanced the penetration ability of the bacterial solution in dense tissues, while the Ri plasmid unique to Agrobacterium rhizogenes may have further promoted T-DNA transport; the two synergistically significantly improved infection efficiency. Regarding the screening strategy, the strong fluorescent expression of the eGFP reporter gene in Dendrobium officinale tissues enabled real-time visual screening of transformed cells, significantly improving the accuracy of positive event detection and shortening the screening cycle. Addressing the chimerism issue, the study enhanced the competitive advantage of transformed cells during regeneration by optimizing the fine regulation of plant growth regulators (such as 2,4-D), effectively suppressing interference from untransformed cells. Meanwhile, drawing on the experience of crop improvement, it is pointed out that in the future, transcription factors that promote regeneration, such as DoERF5, or the MIR396-GRF / GIF module can be combined to further reduce the generation of chimeras from the perspective of cell fate regulation.

[0055] Ultimately, the system achieved a significant increase in average transformation efficiency from 1.96% to 19.16%, with some batches reaching as high as 25%. Furthermore, all the obtained transgenic lines differentiated normally into seedlings, demonstrating good stability and reproducibility. This achievement provides a scalable and efficient technological platform for the industrial-scale genetic improvement and functional gene verification of Dendrobium nobile.

[0056] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A genotype-independent genetic transformation method for Dendrobium nobile, characterized in that, Includes the following steps: (1) Explant preparation: select embryogenic callus, protocorm or protocormoid of Dendrobium nobile as explants; (2) Agrobacterium infection: A binary vector carrying the target gene is introduced into Agrobacterium to prepare an Agrobacterium infection solution, which is then used to infect the explants; (3) Co-culture: The infected explants were placed in a co-culture medium for co-culture; (4) Screening culture: The co-cultured explants were transferred to a screening medium containing screening agents, and resistant explants were obtained by screening with the help of visual screening marker genes; (5) Differentiation and rooting: eGFP-expressing resistant explants were transferred to differentiation medium to induce shoot differentiation, and then transferred to rooting medium to induce rooting, thus obtaining transgenic plants.

2. The method according to claim 1, characterized in that, The Agrobacterium mentioned in step (2) is strain K599 and other types of Agrobacterium rhizogenes.

3. The method according to claim 1, characterized in that, The infection described in step (2) is negative pressure assisted infection, with negative pressure conditions of -0.08 to -0.10 MPa and an infection time of 20 to 35 min.

4. The method according to claim 1, characterized in that, The OD of the Agrobacterium infection solution described in step (2) 600 The value is 0.6~0.

8.

5. The method according to claim 1, characterized in that, The screening agent mentioned in step (4) is G418, with a concentration of 30~50 mg / L.

6. The method according to claim 1, characterized in that, The temperature for co-culturing in step (3) is 22~23 ℃, and the co-culturing time is 2~4 days.

7. The method according to claim 1, characterized in that, The screening medium described in step (4) also contains the antibacterial agent termethin, with a concentration of 100~400 mg / L.

8. The method according to claim 1, characterized in that, The binary vector carries the eGFP reporter gene or other visual reporter genes, and positive explants are screened in step (4) by eGFP fluorescence expression.

9. The method according to claim 1, characterized in that, The Dendrobium nobile hybrid is D. 'Sonia Hiasakul' or D. 'Noble Woman' or other Dendrobium hybrids.

10. The application of the method as described in any one of claims 1 to 9 in the genetic engineering breeding, functional gene verification, or genome editing of Dendrobium nobile.

Images