Periodontitis marker and application thereof
By using the circular RNA hsa_circ_0005737 as a biomarker for periodontitis, the challenges of early diagnosis and efficacy evaluation of periodontitis have been solved, achieving diagnosis with high specificity and sensitivity, and providing a therapeutic target to support gene and drug therapy.
Patent Information
- Application Number
- CN202610186530.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-10
- Publication Date
- 2026-05-12
AI Technical Summary
Current technologies cannot achieve early, non-invasive, highly specific, and highly sensitive diagnosis of periodontitis, make it difficult to distinguish between the active and quiescent phases of the disease, and lack effective means of evaluating treatment efficacy and prognosis.
Circular RNA hsa_circ_0005737 was used as a periodontitis biomarker. Its expression level was detected by specific amplification primer pairs. It was applied to the diagnosis, prognosis assessment and efficacy monitoring of periodontitis. Kits and drug compositions containing this biomarker were developed to intervene in its expression level.
This enables early warning of periodontitis, improves the specificity and sensitivity of diagnosis, provides therapeutic targets, and lays the foundation for gene therapy and drug treatment of periodontitis.
Smart Images

Figure CN122012693A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biomedical detection technology and plant quarantine technology, and more specifically to a periodontitis marker and its application. Background Technology
[0002] Periodontitis is a chronic inflammatory disease caused by dental plaque biofilm, characterized by progressive destruction of periodontal supporting tissues (including the gingiva, periodontal ligament, alveolar bone, and cementum), ultimately leading to tooth loosening and loss. Periodontitis is a leading cause of tooth loss in adults worldwide and is closely associated with a variety of systemic diseases, such as diabetes, cardiovascular disease, and rheumatoid arthritis.
[0003] Currently, the clinical diagnosis and assessment of periodontitis mainly rely on traditional clinical examination methods, such as probing depth, clinical attachment loss, bleeding index, and imaging examinations (such as X-rays). However, these methods have significant limitations:
[0004] Highly subjective and lagging: Clinical examination results are influenced by the operator's experience and mainly reflect existing tissue damage, making it impossible to provide early warning of the disease or accurately determine the active phase.
[0005] Invasiveness and limitations: Imaging examinations involve radiation exposure and are difficult to perform frequently; while microbial testing can identify pathogens, it is cumbersome, time-consuming, and costly, and the oral microbiota is complex, so the correlation between the detection of single or multiple pathogens and disease activity is not absolute.
[0006] Humoral markers lack specificity: Some inflammatory factors in gingival crevicular fluid or saliva (such as IL-1β, IL-6, TNF-α, MMPs, etc.) have been studied as potential markers, but their levels are easily affected by other oral or systemic inflammations, resulting in low specificity and poor stability.
[0007] Therefore, developing a novel biomarker that can achieve early, non-invasive, highly specific, and highly sensitive diagnosis, and effectively distinguish between the active and quiescent phases of the disease, as well as assess efficacy and prognosis, is a key issue that urgently needs to be addressed in the clinical diagnosis and treatment of periodontitis.
[0008] Circular RNAs (circRNAs) are a class of non-coding RNA molecules that lack a 5' cap and a 3' poly(A) tail and form a closed circular structure via covalent bonds. Due to their circular structure, circRNAs are less susceptible to degradation by exonucleases, making them more stable than linear RNAs in vivo. Recent studies have shown that circRNAs exhibit tissue / disease-specific expression patterns and participate in the regulation of cellular physiological and pathological processes through various mechanisms, including acting as microRNA (miRNA) sponges, interacting with RNA-binding proteins, and regulating gene transcription or translation. These characteristics make circRNAs highly promising next-generation biomarkers for disease diagnosis and therapeutic targets.
[0009] However, there are currently no clear reports on specific circRNAs as biomarkers for the specific diagnosis and prognostic assessment of periodontitis, and their use in guiding treatment. Therefore, developing a circRNA biomarker that can achieve early, non-invasive, highly specific and sensitive diagnosis, and effectively distinguish between the active and quiescent phases of the disease, as well as assess treatment efficacy and prognosis, is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0010] In view of this, the present invention develops a periodontitis marker and its application.
[0011] The primary objective of this application is to provide a periodontitis biomarker, said biomarker being a circular RNA hsa_circ_0005737, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0012] Another object of this application is to provide the use of the circular RNA hsa_circ_0005737 in the preparation of products for diagnosing periodontitis.
[0013] Another object of this application is to provide the use of the circular RNA hsa_circ_0005737 in the preparation of products for assessing periodontitis activity, severity, or prognosis.
[0014] Another object of this application is to provide the use of the circular RNA hsa_circ_0005737 in the preparation of products for monitoring the efficacy of periodontitis treatment.
[0015] Another object of this application is to provide a reagent combination for the diagnosis, prognostic assessment and / or efficacy monitoring of periodontitis, the reagent combination comprising a reagent for specifically detecting the expression level of hsa_circ_0005737 in a sample, the nucleotide sequence of the circular RNA hsa_circ_0005737 being shown in SEQ ID NO: 1.
[0016] As a preferred technical solution, the reagent includes a primer pair for specifically amplifying the circular RNA hsa_circ_0005737, the primer pair sequences of which are shown in SEQ ID NO: 4 and SEQ ID NO: 5.
[0017] As a preferred technical solution, the sample is one or more clinical biological samples selected from serum, plasma, whole blood, saliva, gingival crevicular fluid, oral swabs, pus, body fluids, periodontal tissue, and paraffin sections.
[0018] Another object of this application is to provide a kit for the diagnosis, prognostic assessment and / or efficacy monitoring of periodontitis, said kit comprising the aforementioned reagent combination.
[0019] Another object of this application is to provide a pharmaceutical composition for the prevention, relief and / or treatment of periodontitis, said pharmaceutical composition comprising an active ingredient capable of downregulating the expression level of said circular RNA hsa_circ_0005737.
[0020] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects: This application is the first to discover and verify that hsa_circ_0005737 (nucleotide sequence SEQ ID NO.3) is specifically highly expressed in periodontitis, showing significant differences from normal tissue. As a diagnostic marker, it exhibits high specificity and sensitivity. Furthermore, circRNA expression changes may occur in the early stages of the disease, and its detection holds promise for early warning of periodontitis, preceding obvious clinical symptoms and radiographic changes.
[0021] Good stability: The circular structure of circRNA makes it less susceptible to degradation, and its stability in samples is better than that of linear RNA and some proteins, which is beneficial to the accuracy and reproducibility of detection.
[0022] Providing new therapeutic targets: Functional experiments showed that intervening in the expression of hsa_circ_0005737 can affect the osteogenic differentiation and inflammatory response of periodontal ligament stem cells, suggesting that it can provide a therapeutic target and important basis for clinical applications such as gene therapy and drug therapy for periodontitis, and lay the foundation for the development of new therapeutic drugs (such as nucleic acid drugs targeting circRNA). Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0024] Figure 1 This is a schematic diagram and nucleotide sequence of the circular RNA structure of hsa_circ_0005737 described in this invention.
[0025] Figure 2 Figure showing the expression of hsa_circ_0005737 in normal periodontal tissues and periodontitis tissues detected by fluorescence in situ hybridization (FISH).
[0026] Figure 3 Figure A shows the expression of hsa_circ_0005737 in normal and inflammation-induced human periodontal ligament stem cells detected by FISH technology; Figure B shows the changes in the relative expression level of hsa_circ_0005737 in human periodontal ligament stem cells at different time points after inflammation induction detected by RT-qPCR technology. P<0.05, P<0.01, P<0.001).
[0027] Figure 4 A and Figure 4 B represents the bar charts for verifying the knockdown and overexpression efficiency of hsa_circ_0005737 by RT-qPCR; where si-NC: small interference control group; si-1#-hsa_circ_0005737: small interference sequence group 1; si-2#-hsa_circ_0005737: small interference sequence group 2; si-3#-hsa_circ_0005737: small interference sequence group 3; OE-NC: blank plasmid control group; OE-has_circ_0005737: has_circ_0005737 overexpression plasmid group.
[0028] Figure 5Transcriptome sequencing analysis results of human periodontal ligament stem cells after hsa_circ_0005737 knockdown; where A is the TPM violin plot (NC-1, 2, and 3 represent three replicates of the negative control siRNA, and si-1, 2, and 3 represent three replicates of the siRNA targeting hsa_circ_0005737 knockdown); B is the PCA analysis plot (NC represents the negative control siRNA group, and si represents the siRNA group targeting hsa_circ_0005737 knockdown); C is the sample correlation heatmap (NC-1, 2, and 3 represent three replicates of the negative control siRNA, and si-1, 2, and 3 represent three replicates of the siRNA targeting hsa_circ_0005737 knockdown); 1, 2, and 3 represent three repeats of siRNA targeting hsa_circ_0005737 knockdown; D is the GO enrichment analysis plot (Down represents the genome downregulated after transfection with siRNA targeting hsa_circ_0005737 knockdown, Normal represents the genome unchanged after transfection with siRNA targeting hsa_circ_0005737 knockdown, and Up represents the genome upregulated after transfection with siRNA targeting hsa_circ_0005737 knockdown); E is the differentially expressed gene volcano plot; F is the KEGG pathway enrichment analysis plot; G is the GSEA analysis plot.
[0029] Figure 6 The images show the results of ALP staining and alizarin red staining; where A represents the results of ALP staining and alizarin red staining in different groups under non-inflammatory conditions; and B represents the results of ALP staining and alizarin red staining in different groups under inflammatory conditions.
[0030] Figure 7 The results are from Western Blot experiments; A, B, C, and D are Western Blot results of has_circ_0005737 overexpression and knockdown on osteogenic-related indicators of human periodontal ligament stem cells in normal and inflammatory microenvironments; E, F, G, and H are Western Blot results of has_circ_0005737 overexpression and knockdown on NLRP3 inflammasome-related protein of human periodontal ligament stem cells in normal and inflammatory microenvironments.
[0031] Figure 8 The results are from cell immunofluorescence experiments; A represents the fluorescence staining results of osteogenic-related markers; B represents the fluorescence staining results of NLRP3 inflammasome-related protein.
[0032] Figure 9 A shows the expression of circRNA in a mouse periodontitis model detected by FISH; B shows the effect of circRNA overexpression and knockdown on the level of periodontal inflammation in mice detected by HE staining; C shows the three-dimensional reconstruction image of the mouse maxilla using Micro-CT; and D shows the quantitative statistical bar chart of alveolar bone loss (CEJ-ABC distance) in each group of mice. P<0.01).
[0033] Figure 10 The vector plasmid maps for pSLenti-EF1-F2A-Puro-CMV-S-hsa circ 0005737-WPREe and the blank control plasmid GL109 pSLenti-EF1-F2A-Puro-CMV-MCS-WPREe are shown. Detailed Implementation
[0034] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0035] Example 1 A periodontitis biomarker, wherein the biomarker is a circular RNA hsa_circ_0005737, and the circBase genomic coordinates are as follows: chr1:120539619-120548211 (reference gene version: hg19) Figure 1 The specific nucleotide sequence of hsa_circ_0005737 is as follows: , SEQID NO.1.
[0036] Example 2 Validation of hsa_circ_0005737 expression in clinical tissues of periodontitis With the approval of the Ethics Committee of the Affiliated Stomatological Hospital of Nanchang University (Ethics Approval No.: 2024086) and after obtaining informed consent from the patients, periodontal tissues surgically removed from patients with periodontitis and normal periodontal tissues corresponding to healthy teeth extracted for other reasons were collected at the Affiliated Stomatological Hospital of Nanchang University. The expression level of hsa_circ_0005737 was verified using a fluorescence in situ hybridization (FISH) kit (BioXin Biotech). The specific process is as follows: (1) Sample pretreatment: Paraffin sections need to be baked on a 60℃ drying machine for 30 minutes to fully soften the paraffin, and then the dewaxing and dehydration steps are completed; (2) Permeation treatment: In order to ensure effective penetration of the probe, a key permeation treatment is carried out. The probe is immersed in a permeation solution prepared with 0.5% Triton X-100 and left to stand at room temperature for 10 minutes. (3) Slide preparation: After permeation, the cell structure is stabilized by refixing with 1% paraformaldehyde at room temperature for 10 minutes. Then, the cells are dehydrated by gradients of 70%, 80%, 90% and 100% ethanol for 5 minutes each, and finally dried at room temperature to complete the slide preparation. (4) Preparation of hybridization reaction solution: Before entering the hybridization stage, add 20-40 μL of prehybridization solution (fluorescence in situ hybridization (FISH) kit product) to the tissue area and incubate at 37°C for 30 minutes to effectively block non-specific binding sites; at the same time, prepare the hybridization reaction solution by mixing the fluorescently labeled probe (designed and synthesized by Biosensor Biotechnology Co., Ltd., sequence: AAGCCTCTGGACATCTGGAAGGCAGTTGC, SEQ ID NO.2) with the special hybridization solution (fluorescence in situ hybridization (FISH) kit product) at a precise volume ratio of 1:39. (5) Hybridization incubation: The hybridization solution was applied to the sample and subjected to a co-mutation process at 73°C for 8 minutes. Then, the sample was quickly transferred to a constant temperature environment at 37°C for a hybridization incubation of up to 20 hours. (6) Washing: The probe was thoroughly washed in sequence with 25% formamide / 2×SSC solution preheated at 53°C, 2×SSC solution containing 0.1% NP-40 preheated at 42°C, and 0.2×SSC solution preheated at 42°C to remove unbound and non-specifically bound probes. (7) Finally, the samples were stained with DAPI solution for 10 minutes in the dark to clearly mark the cell nuclei, and then mounted with anti-fluorescence attenuation mounting medium. The samples were then placed under a fluorescence microscope for observation and image acquisition.
[0037] Result: As Figure 2 As shown (red signal represents the expression level of hsa_circ_0005737 in periodontal tissue, blue represents the staining level of cell nuclei in periodontal tissue), compared with normal periodontal tissue (Control), the red fluorescence signal of hsa_circ_0005737 in periodontitis tissue was significantly enhanced, indicating that the expression level of has_circ_0005737 in periodontitis tissue was significantly higher than that in normal tissue.
[0038] Example 3 Validation of hsa_circ_0005737 expression in periodontal ligament stem cells in an inflammatory microenvironment With the approval of the Ethics Committee of the Affiliated Stomatological Hospital of Nanchang University (Approval No.: 2024086) and after obtaining informed consent from patients, normal periodontal ligament tissue corresponding to healthy teeth extracted for other reasons was collected at the Affiliated Stomatological Hospital of Nanchang University. Primary periodontal ligament stem cells were extracted using the tissue block method, digested with trypsin, and passaged to obtain fourth-generation periodontal ligament stem cells for later use. The fourth-generation periodontal ligament stem cells were induced for 5 days in a culture medium containing lipopolysaccharide (LPS, 10 µg / mL) and tumor necrosis factor-α (TNF-α, 10 ng / mL) to establish an in vitro inflammation model. Cells cultured in normal culture medium served as a control. The expression level of hsa_circ_0005737 was detected using fluorescence in situ hybridization (FISH) and RT-qPCR, respectively. FISH test: (1) The cells grown on the coverslip were fixed with 4% paraformaldehyde at room temperature for 20 minutes to maintain the cell morphology and the integrity of the nucleic acid; (2) Permeabilize the cell membrane with 0.5% Triton X-100 solution for 15 minutes to form pores in the cell membrane, which will facilitate the entry of subsequent probes; then perform short-term post-fixation with 1% paraformaldehyde for 10 minutes to ensure that the cell structure remains stable during the subsequent high-temperature hybridization process; (3) The cell samples were dried by a series of ethanol gradient dehydration processes; (4) Before formal hybridization, the sample needs to be pre-hybridized for 30 minutes at 37°C with a special blocking buffer to block non-specific binding sites and reduce background signal.
[0039] (5) Subsequently, the fluorescently labeled hybridization probe (sequence: AAGCCTCTGGACATCTGGAAGGCAGTTGC, SEQ ID NO.3) was precisely mixed with the hybridization solution at a ratio of 1:39 and denatured at 73°C for 5 minutes to make both the double-stranded DNA probe and the dissected target DNA become single-stranded. (6) Then, hybridization incubation was carried out in a constant temperature and humidity chamber at 37°C for 16-20 hours to ensure that the probe and the complementary target sequence were fully combined.
[0040] (7) After hybridization, in order to remove unbound and non-specifically bound probes, a series of rigorous gradient elutions are required: first, wash with 2×SSC strict washing solution containing 25% formamide at 53°C; then wash with 2×SSC washing solution containing 0.1% NP-40 at 42°C; and finally, perform low-salt strict washing with 0.2×SSC at 42°C.
[0041] RT-qPCR detection: (1) RNA extraction 1) After completely discarding the cell culture supernatant, add 500 μl of Buffer SRL to each well of the 6-well plate to fully cover the cell surface, and then use a pipette to repeatedly blow the cells to detach them.
[0042] 2) Add 100 μl of RNase-free ddH2O to the lysis buffer, vortex thoroughly, centrifuge at 12000 rpm (13400×g) for 3-5 min, and carefully aspirate about 500 μl of the supernatant. Add 0.5 times the volume of anhydrous ethanol to the supernatant and mix thoroughly.
[0043] 3) Transfer the entire mixture to an RNA purification column (FastPure RNA Columns VI). Each column is pre-installed in a 2 ml collection tube. Centrifuge at 12,000 rpm (13,400 × g) for 30 seconds and discard the waste liquid.
[0044] 4) Add 700 μl of Buffer RWA (with anhydrous ethanol added) to the purification column (FastPure RNA Columns VI), centrifuge at 12000 rpm (13400×g) for 30 sec, and discard the waste liquid.
[0045] 5) Add 500 μl of Buffer RWB (with anhydrous ethanol added) to the purification column (FastPure RNA Columns VI), centrifuge at 12,000 rpm (13400×g) for 2 min, and carefully remove the adsorption column from the collection tube to avoid contact with the filtrate and contamination.
[0046] 6) Carefully transfer the purification column (FastPure RNA Columns VI) to a new 1.5 ml RNase-free Collection Tubes centrifuge tube, add 20-100 μl of RNase-free ddH2O to the center of the adsorption column, incubate at room temperature for 1 min, and centrifuge at 12000 rpm (13400×g) for 1 min to elute the RNA.
[0047] (2) circRNA reverse transcription PCR The circRNA reverse transcription kit used in this experiment was manufactured by Nanjing Novizan Biotechnology Co., Ltd. After measuring the RNA concentration, reverse transcription was performed according to the instructions. The procedure is as follows: 1) Removal of gDNA Prepare the mixture shown in Table 1 in RNase-free centrifuge tubes, gently mix with a pipette, and incubate at 42°C for 2 minutes to completely remove genomic DNA.
[0048] Table 1. Mixture Proportioning Relationship
[0049] 2) Preparation of the reverse transcription reaction system Prepare the reverse transcription reaction system according to Table 2, gently mix with a pipette, and then carry out the reverse transcription reaction according to the following procedure: incubate at 50°C for 15 minutes to synthesize cDNA, and then heat at 85°C for 5 seconds to inactivate the reverse transcriptase.
[0050] Table 2 Reverse transcription reaction system
[0051] (3) circRNA qPCR Prepare the mixture shown in Table 3 in an 8-tube PCR array of RNase-free PCR. Add the prepared reaction mixture to the 8-tube array, with three replicate wells for each sample. Perform amplification using the three-step method (Table 4) as per the manufacturer's instructions. Use GAPDH as the internal control gene, following the 2... -ΔΔCT The formula calculates the relative expression level of a gene.
[0052] Table 3. Mixture Proportioning Relationship
[0053] Table 4 Three-step amplification method
[0054] Table 5. Sequences of circRNA amplification primers and internal reference primers
[0055] Results analysis: Figure 3 A FISH result showed that (red signal represents the expression level of hsa_circ_0005737 in human periodontal ligament stem cells, and blue represents the staining level of cell nuclei in human periodontal ligament stem cells), the red signal of hsa_circ_0005737 in the inflammation-induced group was stronger than that in the normal control group.
[0056] Figure 3B-RT-qPCR results showed (green represents the relative expression level of hsa_circ_0005737 in normal human periodontal ligament stem cells, pink represents the relative expression level of hsa_circ_0005737 in inflamed human periodontal ligament stem cells, with GAPDH as an internal control) that from day 3 of inflammation induction, the relative expression level of hsa_circ_0005737 was significantly higher than that in the control group (P<0.05), and continued to increase over time. This indicates that inflammatory stimulation can induce upregulation of hsa_circ_0005737 expression.
[0057] Example 4 Validation of overexpression and knockdown efficiency of hsa_circ_0005737 The has_circ_0005737 overexpression plasmid was designed and synthesized by Heyuan Biotechnology Co., Ltd., and the siRNA targeting and knocking down has_circ_0005737 was designed and synthesized by Gemma Biotechnology Co., Ltd.
[0058] Cell transfection: When the density of human periodontal ligament stem cells reached 70%-80%, the cells were transfected with the has_circ_0005737 overexpression plasmid (the plasmid used in this study was designed and synthesized by Heyuan Biotechnology Co., Ltd., and the specific preparation method was as follows: the target gene was inserted into the GL109 vector, and the target gene sequence was: SEQ ID NO.).8; Vector structure: pSLenti-EF1-F2A-Puro-CMV-S-hsa circ 0005737-WPREe; upstream and downstream cloning restriction enzyme sites: EcoRle, BamHle) and blank control plasmid (vector structure: GL109 pSLenti-EF1--F2A-Puro-CMV-MCS-WPREe; upstream and downstream cloning restriction enzyme sites: EcoRle, BamHle), vector structure map as shown. Figure 10 As shown.
[0059] In addition, three siRNAs targeting and knocking down has_circ_0005737, and a blank control siRNA were transfected. The siRNA sequences are as follows (S: forward sequence; AS: reverse sequence):
[0060] Four hours after transfection, the culture medium was replaced with one containing lipopolysaccharide (LPS, 10 µg / mL) and tumor necrosis factor-α (TNF-α, 10 ng / mL).
[0061] Efficiency verification: 48 hours after transfection, cells were collected and RNA was extracted. The expression level of hsa_circ_0005737 was detected by RT-qPCR (same method as in Example 2).
[0062] Result: As Figure 4 As shown in A and 4B, compared with their respective negative control groups (OE-NC or si-NC), the expression level of hsa_circ_0005737 was significantly increased in cells transfected with the OE-hsa_circ_0005737 plasmid; the expression level of hsa_circ_0005737 was significantly decreased in cells transfected with siRNA#1 (knockdown efficiency >70%), while the knockdown effects of siRNA#2 and #3 were not significant. Therefore, siRNA#1 (named si-hsa_circ_0005737) was selected for subsequent knockdown experiments.
[0063] Example 5 Effects of hsa_circ_0005737 knockdown on periodontal ligament stem cell transcriptome To investigate the function of hsa_circ_0005737, human periodontal ligament stem cells were transfected with si-NC and si-hsa_circ_0005737 in an inflammatory microenvironment, with three replicates per group. Two days later, the cells were treated with RNA lysis buffer and sent for transcriptomics sequencing.
[0064] Sequencing and bioinformatics analysis: Sequencing was performed using the Illumina NovaSeq platform. Raw data underwent quality control, alignment, and gene quantification. Expression levels were normalized using TPM. Figure 5 A). Principal component analysis (PCA) showed significant differences between groups. Figure 5 B). High correlation between samples ( Figure 5 C).
[0065] Differential expression and functional enrichment: Differentially expressed genes (DEGs) were screened based on |log2(FoldChange)|>1 and P-value<0.05. Volcano plots showed that a large number of genes exhibited altered expression. Figure 5 E). GO functional enrichment analysis and KEGG pathway enrichment analysis were performed on DEGs. Figure 5 (D, 5F) revealed that differentially expressed genes were significantly enriched in biological processes and pathways related to periodontal tissue repair and inflammation, including extracellular matrix tissue, skeletal phylogeny, inflammatory response, Wnt signaling pathway, and PI3K-Akt signaling pathway. Gene set enrichment analysis (GSEA) further confirmed these pathway alterations. Figure 5 G). These results suggest that hsa_circ_0005737 is involved in regulating osteogenic differentiation and inflammatory responses of periodontal ligament stem cells.
[0066] Example 6 Effects of hsa_circ_0005737 on osteogenic differentiation capacity of periodontal ligament stem cells Experimental groups: The following groups were set up: OE-NC (inflammation + empty vector plasmid), OE-hsa_circ_0005737 (inflammation + overexpression plasmid), si-NC (inflammation + si-NC), and si-hsa_circ_0005737 (inflammation + knockdown of siRNA). A control group for the above groups was also set up under non-inflammatory conditions.
[0067] Osteogenesis induction: Four hours after cell transfection, the medium was replaced with osteogenic induction medium (α-MEM medium containing 10% fetal bovine serum, 10 mM β-glycerophosphate sodium, 50 µg / mL ascorbic acid and 100 nM dexamethasone). The medium was changed every 3 days.
[0068] ALP staining: ALP staining was performed 7 days after induction. After cell fixation, cells were incubated in BCIP / NBT working solution in the dark for 30 minutes; a blue color indicated a positive result.
[0069] Alizarin Red staining: Alizarin Red staining was performed 21 days after induction. After cell fixation, the cells were stained with 2% Alizarin Red S (pH 4.2) for 10 minutes. Orange-red calcium nodules were considered positive.
[0070] Result: As Figure 6 A (Results of ALP and Alizarin Red staining in different groups under non-inflammatory conditions) and Figure 6B (Results of ALP and Alizarin Red Staining in Different Groups under Inflammatory Conditions) shows that under inflammatory conditions, compared with the OE-NC group, the OE-hsa_circ_0005737 group showed deeper ALP staining, and more and redder Alizarin Red stained calcified nodules, indicating that overexpression of hsa_circ_0005737 enhanced the osteogenic differentiation capacity of cells under inflammatory conditions. Conversely, the ALP activity and calcified nodule formation in the si-hsa_circ_0005737 group were weaker than those in the si-NC group, indicating that knockdown of hsa_circ_0005737 weakened osteogenic differentiation capacity. Under non-inflammatory conditions, overexpression of hsa_circ_0005737 also showed a trend of promoting osteogenic differentiation.
[0071] Example 7 Effects of hsa_circ_0005737 on the expression of osteogenic and inflammation-related proteins (Western Blot) (1) Cells were lysed using cell lysis buffer, followed by centrifugation to collect the supernatant. Protein concentration was determined using the BCA method.
[0072] (2) After the proteins were separated by 10% SDS polyacrylamide gel electrophoresis, they were transferred to a PVDF membrane using a wet transfer device.
[0073] (3) Use Anti-RUNX2 (item number PB0171, Boster, 1:1000). Anti-OPN (Catalog No. BM4208, Boster, 1:1000); Anti-OCN (Item No. DF12303, Affinity, 1:1000); Anti-β-actin (Catalog No. GB15003-100, Servicebio, 1:4000); Anti-NLRP3 (Cat#DF7438, Affinity, 1:1000); Anti-Caspase1 (Cat#22915-1-AP, Proteintech, 1:5000); Anti-ASC (Cat#10500-1-AP, Proteintech, 1:10000); Anti-α-Tubulin (Catalog No. 80762-1-RR, Proteintech, 1:10000); Anti-METTL3 (catalog number R382974, Zenbio, 1:1000), diluted at the recommended ratio, incubated overnight at 4°C.
[0074] (4) After washing three times with TBST (product number G0004, Servicebio), the membrane was incubated with the corresponding secondary antibody (product number GB23303, Servicebio, dilution ratio 1:10000).
[0075] (5) Protein bands were detected and developed by chemiluminescence, and the band intensity was quantitatively analyzed using ImageJ software. The target protein signal was normalized using β-actin or α-Tubulin as an internal reference.
[0076] Figure 7 In the table, A and B represent validation of the effects of has_circ_0005737 overexpression and knockdown on osteogenic-related indicators in human periodontal ligament stem cells under inflammatory microenvironment; OE-NC: blank plasmid control group; OE-has_circ_0005737: has_circ_0005737 overexpression plasmid group; Si-NC: small interference control group; si-hsa_circ_0005737: small interference sequence group 1; the target protein signal was normalized using β-actin as an internal reference.
[0077] C and D validate the effects of has_circ_0005737 overexpression on osteogenic indicators of human periodontal ligament stem cells under normal and inflammatory microenvironments, respectively; OE-NC: blank plasmid control group; OE-has_circ_0005737: has_circ_0005737 overexpression plasmid group; Si-NC: small interference control group; si-hsa_circ_0005737: small interference sequence group 1; the target protein signal was normalized using β-actin as an internal reference.
[0078] E and F validate the effects of has_circ_0005737 overexpression and knockdown on the NLRP3 inflammasome core protein level in human periodontal ligament stem cells under inflammatory microenvironment; OE-NC: blank plasmid control group; OE-has_circ_0005737: has_circ_0005737 overexpression plasmid group; si-NC: small interference control group; si-hsa_circ_0005737: small interference sequence group 1; the target protein signal was normalized using α-Tubulin as an internal reference.
[0079] G and H validate the effect of has_circ_0005737 overexpression on the core protein level of NLRP3 inflammasome in human periodontal ligament stem cells under normal and inflammatory microenvironments; OE-NC: blank plasmid control group; OE-has_circ_0005737: has_circ_0005737 overexpression plasmid group; si-NC: small interference control group; si-hsa_circ_0005737: small interference sequence group 1; the target protein signal was normalized using α-Tubulin as an internal reference.
[0080] Results analysis: Under inflammatory conditions, overexpression of has_circ_0005737 promoted the expression of osteogenic genes (RUNX2, OPN, OCN), while knockdown of has_circ_0005737 inhibited the expression of osteogenic genes (RUNX2, OPN, OCN). After inflammation induction, osteogenic genes (RUNX2, OPN, OCN) were significantly downregulated, and overexpression of has_circ_0005737 rescued the downregulation of osteogenic genes. Under inflammatory conditions, overexpression of has_circ_0005737 suppressed the expression of NLRP3 inflammasome-related genes (NLRP3, Caspase1, ASC), while knockdown of has_circ_0005737 promoted the expression of NLRP3 inflammasome-related genes (NLRP3, Caspase1, ASC). Following inflammation induction, NLRP3 inflammasome-related genes (NLRP3, Caspase1, ASC) were significantly upregulated, while overexpression of has_circ_0005737 reduced the upregulation of NLRP3 inflammasome-related genes. P<0.05, P<0.01, P<0.001).
[0081] Example 8 Cellular immunofluorescence verification (1) The cell culture plates were fixed with 4% paraformaldehyde and permeated with 0.5% Tween-20 for 20 minutes. They were then washed with PBS 3 times, 5 minutes each time.
[0082] (2) After blocking with 5% bovine serum albumin for 30 minutes, the cells were washed three times with PBS for 5 minutes each time, and incubated with the corresponding primary antibody overnight at 4°C.
[0083] (3) Wash with PBST 3 times, 5 min each time, then add the corresponding fluorescent secondary antibody and incubate at room temperature in the dark for 2 hours.
[0084] (4) Wash with PBST 3 times, 5 min each time, and finally counterstain the cell nuclei with DAPI and acquire images by fluorescence microscope.
[0085] Results analysis: Figure 8 A shows that under inflammatory conditions, overexpression of has_circ_0005737 promotes the expression of osteogenic-related genes (RUNX2, OPN, OCN), while knockdown of has_circ_0005737 inhibits the expression of osteogenic-related genes (RUNX2, OPN, OCN). Figure 8 B shows that, under the validation conditions, overexpression of has_circ_0005737 inhibited the expression of NLRP3 inflammasome-related genes (NLRP3, Caspase1, ASC), while knockdown of has_circ_0005737 promoted the expression of NLRP3 inflammasome-related genes (NLRP3, Caspase1, ASC).
[0086] Example 9 Animal in vivo experiments verified To further verify the effect of has_circ_0005737 expression on periodontitis in vivo, mouse periodontitis tissues were injected with has_circ_0005737 homologous mouse circRNA overexpressing adeno-associated virus (OE), overexpressing empty adeno-associated virus (NC), knockdown adeno-associated virus, and knockdown empty adeno-associated virus.
[0087] (1) All animal experiments were approved by the Animal Experiment Ethics Committee of Nanchang University (Approval No.: NCULAE-20250820002). 26 male C57BL / 6J mice (7-8 weeks old, specific sterile grade) were provided by Hangzhou Ziyuan Experimental Animal Technology Co., Ltd.
[0088] (2) After one week of acclimatization at the animal experimental facility of Nanchang University, 26 mice were anesthetized by intraperitoneal injection of Zoltil 50 (60 mg / kg). Experimental periodontitis was induced by ligating the neck of the maxillary second molar with 5-0 suture.
[0089] (3) One week later, three mice from each of the non-ligated group (normal group) and the ligated group (periodontitis group) were randomly selected and euthanized. Maxilla bones were collected for micro CT analysis and hematoxylin-eosin (HE) staining to verify the successful establishment of the model.
[0090] (4) The remaining 20 periodontitis mice were re-anesthetized by intraperitoneal injection of Zoltil 50, fixed in a supine position, and the sutures were removed.
[0091] (5) The corresponding adeno-associated virus was injected into the maxillary first molar region by local injection (n=5 per group).
[0092] (6) One week after the virus injection, all mice were euthanized, the maxillae were collected, fixed with 4% paraformaldehyde, the alveolar bone defects were assessed by microCT, and the periodontal tissue response was assessed by HE staining.
[0093] Figure 9 In the text, Periodontitis represents the periodontitis group after suture ligation; OE-NC: control group injected with overexpressing empty vector adeno-associated virus; OE-cirRNA: group injected with has_circ_0005737 mouse homologous overexpressing adeno-associated virus; sh-NC: control group injected with knockdown empty vector adeno-associated virus; sh-cirRNA: group injected with has_circ_0005737 mouse homologous knockdown adeno-associated virus. Figure 9 In Figure A, the red signal represents the expression level of the mouse homologous circRNA molecule hsa_circ_0005737 in mouse periodontal tissue, and the blue signal represents the staining level of mouse periodontal tissue cell nuclei.
[0094] Figure 9 In section B, the area within the red dashed box represents the periodontal tissue between the second and third molars in the maxilla of a mouse. Figure 9 In C and D, the distance between the alveolar ridge crest and the cementoenamel junction between the second and third maxillary molars of the four groups of mice was measured.
[0095] result: Figure 9 A FISH study showed enhanced local circRNA signaling in the OE-cirRNA group and decreased signaling in the sh-cirRNA group. Figure 9 B H&E staining showed that, compared with the OE-NC group, the inflammation in the OE-cirRNA group was significantly reduced; while compared with the sh-NC group, the sh-cirRNA group showed further aggravation of inflammatory infiltration. Figure 9 Micro-CT images showed that, compared with the OE-NC group, the OE-cirRNA group had significantly reduced alveolar bone loss (smaller CEJ-ABC distance); while compared with the sh-NC group, the sh-cirRNA group showed further aggravated alveolar bone loss. This indicates that in vivo, upregulation of this circRNA can alleviate periodontal bone destruction, while downregulation aggravates the condition, clarifying its potential as a therapeutic target.
[0096] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.
[0097] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A periodontitis marker, characterized in that, The marker is a circular RNA hsa_circ_0005737, whose nucleotide sequence is shown in SEQ ID NO:
1.
2. The use of the circular RNA hsa_circ_0005737 according to claim 1 in the preparation of products for diagnosing periodontitis.
3. The use of the circular RNA hsa_circ_0005737 of claim 1 in the preparation of products for assessing periodontitis activity, severity, or prognosis.
4. The use of the circular RNA hsa_circ_0005737 according to claim 1 in the preparation of a product for monitoring the efficacy of periodontitis treatment.
5. A reagent combination for the diagnosis, prognostic assessment, and / or efficacy monitoring of periodontitis, characterized in that, The reagent combination contains reagents for specifically detecting the expression level of hsa_circ_0005737 in a sample, and the nucleotide sequence of the circular RNA hsa_circ_0005737 is shown in SEQ ID NO:
1.
6. The reagent combination according to claim 5, characterized in that, The reagents include primer pairs for specifically amplifying the circular RNA hsa_circ_0005737, the primer pair sequences of which are shown in SEQ ID NO: 4 and SEQ ID NO:
5.
7. The reagent combination according to claim 5 or 6, characterized in that, The sample is one or more clinical biological samples selected from serum, plasma, whole blood, saliva, gingival crevicular fluid, oral swabs, pus, body fluids, periodontal tissue, and paraffin sections.
8. A kit for the diagnosis, prognostic assessment, and / or monitoring of treatment efficacy in periodontitis, characterized in that, The kit comprises the reagent combination of any one of claims 5-7.
9. A pharmaceutical composition for the prevention, relief, and / or treatment of periodontitis, characterized in that, The pharmaceutical composition comprises an active ingredient capable of downregulating the expression level of the circular RNA hsa_circ_0005737 as described in claim 1.