Gene polymorphic site related to thyroid cancer and application of gene polymorphic site

By using targeted gene multiplex PCR amplification chip and next-generation sequencing technology to detect multiple pathogenic gene mutations and fusion genes in thyroid nodule samples, the problem of differentiating between benign and malignant thyroid nodules has been solved, and the accuracy and efficiency of diagnosis have been improved.

CN122012703APending Publication Date: 2026-05-12SHANGHAI ANJIA BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI ANJIA BIOTECHNOLOGY CO LTD
Filing Date
2017-06-06
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Current technology is insufficient to effectively differentiate between benign and malignant thyroid nodules, leading to a large number of benign nodules being misdiagnosed as malignant, increasing the medical burden and delaying the treatment of malignant nodules.

Method used

Using targeted gene multiplex PCR amplification chip technology combined with next-generation sequencing, multiple pathogenic gene mutations and fusion genes in thyroid nodule samples were detected. By targeting and amplifying cDNA, the presence of specific molecular markers in thyroid nodules was identified.

Benefits of technology

This improves the sensitivity and specificity of the differential diagnosis of benign and malignant thyroid nodules, reduces the false negative rate, and ensures that patients receive timely and appropriate treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005571069140000151
    Figure BDA0005571069140000151
  • Figure BDA0005571069140000161
    Figure BDA0005571069140000161
  • Figure BDA0005571069140000171
    Figure BDA0005571069140000171
Patent Text Reader

Abstract

The invention provides somatic mutation sites of thyroid cancer pathogenic genes and application of the somatic mutation sites, and particularly provides a group of mutation sites of thyroid cancer pathogenic genes, including GNAS gene mutation sites, NRAS gene mutation sites, TSHR gene mutation sites and the like. The gene mutation site provided by the invention can be used as a marker for identifying benign and malignant thyroid nodules.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This case is a divisional application of Chinese invention patent application filed on June 6, 2017, with application number CN 201710438578.9 and invention title "Somatic cell-specific mutation sites of genes related to thyroid nodules and their applications". Technical Field

[0002] This invention belongs to the field of biomedicine. Specifically, this invention relates to somatic cell-specific mutation sites of genes related to thyroid nodules and their applications. Background Technology

[0003] Thyroid nodules are one of the most common thyroid diseases in clinical practice. The prevalence of thyroid nodules detectable by palpation is approximately 4-7% in the adult population in the United States. However, using sensitive thyroid B-cell tests, the prevalence of thyroid nodules is as high as 50% in people over 65 years of age. A 2010 epidemiological survey of thyroid diseases in ten cities across my country, led by Professor Teng Weiping of the Chinese Medical Association's Endocrinology Society, found a prevalence of thyroid nodules as high as 18.6% in the Chinese population, suggesting that there are as many as 200 million people with thyroid nodules in China. Most thyroid nodules are benign and can be treated conservatively, but 5-10% are malignant and require early surgical intervention for a good prognosis. Therefore, a significant challenge for a thyroid specialist is differentiating between benign and malignant thyroid nodules to ensure timely and appropriate treatment for patients. If a large number of benign thyroid nodules that do not require surgery are not treated surgically, the high prevalence in such a large population will create a huge burden on medical insurance. Conversely, if true malignant tumors cannot be identified from a large number of benign nodules, treatment for these patients will be delayed, endangering their lives and health.

[0004] Currently, the main methods used in clinical practice to differentiate between benign and malignant thyroid nodules include thyroid ultrasound, radionuclide scanning, and fine-needle aspiration biopsy (FNAB). Among these, fine-needle aspiration biopsy is currently the gold standard for differentiating between benign and malignant thyroid nodules. According to the guidelines from the 2008 symposium on fine-needle aspiration pathology of thyroid nodules held by the National Cancer Institute, thyroid nodule cytological diagnosis is currently classified into the following categories: 1. Insufficient number of thyroid cells obtained from the aspiration, making diagnosis impossible; 2. Benign nodules; 3. Nodules that cannot be definitively diagnosed by pathological cytology; 4. Malignant thyroid nodules. In recent years, with the widespread use of ultrasound-guided fine-needle aspiration, the proportion of patients unable to be diagnosed due to insufficient cell count has significantly decreased, from as high as 15% previously to below 7% currently. After obtaining sufficient thyroid follicular cells through fine-needle aspiration, the benign or malignant nature of most thyroid nodules can be correctly diagnosed through cytopathological methods. Even in the best thyroid cytopathology laboratories internationally, 20-40% of successfully biopsied thyroid nodules cannot be determined as benign or malignant, meaning the pathology cannot confirm the nodule's status. Therefore, the proportion of patients who cannot be correctly diagnosed during thyroid fine-needle aspiration biopsies is as high as 30-50%, largely influenced by the skill level of the thyroid pathologists and biopsy technicians at each center. Summary of the Invention

[0005] The purpose of this invention is to provide a pathogenic gene mutation site for thyroid cancer and its application.

[0006] A first aspect of the invention provides the use of one or more gene mutation sites selected from the group (I) below and / or their detection reagents for preparing reagents or kits for differentiating between benign and malignant thyroid nodules, the group (I) including the following gene mutation sites:

[0007] GNAS gene:

[0008] NM_001077490:exon1:c.T1019C;

[0009] NRAS gene:

[0010] NM_002524:exon3:c.T284C;

[0011] TSHR gene:

[0012] NM_000369:exon10:c.A2098G.

[0013] In another preferred embodiment, group (I) further includes the following gene mutation sites:

[0014] CHEK2 gene:

[0015] NM_145862:exon11:c.A1250G.

[0016] In another preferred embodiment, group (I) further includes the following gene mutation sites:

[0017] PIK3CA gene:

[0018] NM_006218:exon12:c.1818 bit missing C.

[0019] In another preferred embodiment, group (I) further includes the following gene mutation sites:

[0020] GNAS gene:

[0021] NM_016592:exon1:c.C205A, NM_016592:exon1:c.C216T.

[0022] In another preferred embodiment, group (I) further includes the following gene mutation sites:

[0023] TSHR gene:

[0024] NM_000369:exon10:c.A2252G.

[0025] In another preferred embodiment, group (I) further includes the following gene mutation sites:

[0026] BRAF gene:

[0027] NM_004333:exon15:c.T1799A.

[0028] In another preferred embodiment, the objects to be tested include: humans or non-human mammals (such as livestock, poultry, laboratory animals, etc.).

[0029] In another preferred embodiment, the reagents include primers, probes, chips, or antibodies.

[0030] In another preferred embodiment, the kit contains one or more reagents selected from the group consisting of:

[0031] (A) Specific primers for gene detection;

[0032] (B) Specific probes for gene detection;

[0033] (C) Chip used for gene detection;

[0034] (D) Specific antibodies used to detect amino acid mutations corresponding to mutated genes.

[0035] In another preferred embodiment, the reagent or kit is used for real-time quantitative PCR detection.

[0036] In another preferred embodiment, the annealing temperature in the real-time quantitative PCR is between 60-67°C, and the length of the PCR amplification product is 80-300 bp.

[0037] In another preferred embodiment, the annealing temperature of the fluorescent probe in the real-time quantitative PCR is between 60-70°C.

[0038] In another preferred embodiment, the probe is modified with chemical groups at both ends, with a fluorescent excitation group at the 5' end and a fluorescent quenching group at the 3' end.

[0039] In another preferred embodiment, the detection is an auxiliary detection.

[0040] A second aspect of the present invention provides a kit comprising detection reagents for one or more gene mutation sites selected from the group consisting of:

[0041] GNAS gene:

[0042] NM_001077490:exon1:c.T1019C;

[0043] NRAS gene:

[0044] NM_002524:exon3:c.T284C;

[0045] TSHR gene:

[0046] NM_000369:exon10:c.A2098G.

[0047] In another preferred embodiment, the kit further includes reagents for detecting the following gene mutation sites:

[0048] CHEK2 gene:

[0049] NM_145862:exon11:c.A1250G.

[0050] In another preferred embodiment, the kit further includes reagents for detecting the following gene mutation sites:

[0051] PIK3CA gene:

[0052] NM_006218:exon12:c.1818 bit missing C.

[0053] In another preferred embodiment, the kit further includes detection reagents for one or more gene mutation sites selected from the group consisting of:

[0054] GNAS gene:

[0055] NM_016592:exon1:c.C205A, NM_016592:exon1:c.C216T.

[0056] In another preferred embodiment, the kit further includes reagents for detecting the following gene mutation sites:

[0057] TSHR gene:

[0058] NM_000369:exon10:c.A2252G.

[0059] In another preferred embodiment, the kit further includes detection reagents for one or more gene mutation sites selected from the group consisting of:

[0060] BRAF gene:

[0061] NM_004333:exon15:c.T1799A, NM_004333:exon11:c.G1338A,

[0062] NM_004333:exon15:c.A1801G;

[0063] CHEK2 gene:

[0064] NM_145862:exon10:c.C1024T;

[0065] NRAS gene:

[0066] NM_002524:exon3:c.C181A, NM_002524:exon3:c.A182G;

[0067] AKT1 gene:

[0068] NM_001014431:exon3:c.G49A;

[0069] PPM1D gene:

[0070] NM_003620:exon1:c.C262T;

[0071] PTEN gene:

[0072] NM_000314:exon5:c.C328T;

[0073] RET gene:

[0074] NM_020630:exon11:c.T1888C, NM_020630:exon16:c.T2753C;

[0075] TP53 gene:

[0076] NM_001126115:exon3:c.C265T, NM_000546:exon8:c.G814T.

[0077] In another preferred embodiment, the kit further includes detection reagents for one or more fusion genes selected from the group consisting of:

[0078] ETV6-NTRK3 fusion gene:

[0079] ETV6{ENST00000396373}:r.1_737_NTRK3{ENST00000394480}:r.1719_19984;

[0080] NCOA4-RET fusion gene:

[0081] NCOA4{ENST00000452682}:r.1_1014_RET{ENST00000355710}:r.2369_5659;

[0082] CCDC6-RET fusion gene:

[0083] CCDC6{ENST00000263102}:r.1_535_RET{ENST00000355710}:r.2369_5659.

[0084] In another preferred embodiment, the detection reagent is:

[0085] (A) Specific primers for gene detection;

[0086] (B) Specific probes for gene detection;

[0087] (C) Chip used for gene detection;

[0088] (D) Specific antibodies used to detect amino acid mutations corresponding to mutated genes.

[0089] A third aspect of the present invention provides a method for in vitro detection of the presence of gene mutations in a sample, comprising the steps of:

[0090] (a) Amplifying polynucleotides in the sample using specific primers to obtain amplification products; and

[0091] (b) Detect the presence of one or more of the following gene mutations in the amplification products:

[0092] GNAS gene:

[0093] NM_001077490:exon1:c.T1019C, NM_016592:exon1:c.C205A,

[0094] NM_016592:exon1:c.C216T;

[0095] NRAS gene:

[0096] NM_002524:exon3:c.T284C;

[0097] TSHR gene:

[0098] NM_000369:exon10:c.A2098G, NM_000369:exon10:c.A2252G.

[0099] In another preferred embodiment, the detection is non-diagnostic.

[0100] In another preferred embodiment, step (b) further includes detecting the presence of the following gene mutations in the amplification product:

[0101] CHEK2 gene:

[0102] NM_145862:exon11:c.A1250G.

[0103] In another preferred embodiment, step (b) further includes detecting the presence of the following gene mutations in the amplification product:

[0104] PIK3CA gene:

[0105] NM_006218:exon12:c.1818 bit missing C.

[0106] If one or more gene loci are present, the thyroid nodule is considered malignant.

[0107] In another preferred embodiment, the sample is derived from a person.

[0108] In a fifth aspect, the present invention provides an isolated gene polynucleotide sequence, said polynucleotide sequence being a fragment derived from a gene selected from the group consisting of: NRAS gene, GNAS gene, PIK3CA gene, CHEK2 gene, and TSHR gene, and said nucleotide sequence having a gene mutation site selected from the group consisting of:

[0109] NRAS gene:

[0110] NM_002524:exon3:c.T284C;

[0111] GNAS gene:

[0112] NM_001077490:exon1:c.T1019C, NM_016592:exon1:c.C205A,

[0113] NM_016592:exon1:c.C216T;

[0114] PIK3CA gene:

[0115] NM_006218:exon12:c.1818 bit missing C;

[0116] CHEK2 gene:

[0117] NM_145862:exon11:c.A1250G;

[0118] TSHR gene:

[0119] NM_000369:exon10:c.A2098G, NM_000369:exon10:c.A2252G.

[0120] In another preferred embodiment, the polynucleotide sequence is 30-1000 bp in length; preferably 50-500 bp.

[0121] The present invention also provides the use of polynucleotide sequences, which can be used as positive controls (standards).

[0122] A sixth aspect of the invention provides the use of one or more genes selected from the group consisting of and / or their detection reagents for preparing reagents or kits for differentiating between benign and malignant thyroid nodules:

[0123] AKT1 gene, BRAF gene, CHEK2 gene, GNAS gene, NRAS gene, PIK3CA gene, PPM1D gene, PTEN gene, RET gene, TP53 gene, TSHR gene, ETV6-NTRK3 fusion gene, NCOA4-RET fusion gene, and CCDC6-RET fusion gene.

[0124] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Detailed Implementation

[0125] Through extensive and in-depth research, the inventors unexpectedly obtained a set of mutation sites related to thyroid cancer-causing genes. Experimental results show that the gene mutation sites provided by this invention can serve as markers for differentiating between benign and malignant thyroid nodules.

[0126] Before describing this invention, it should be understood that the invention is not limited to the specific methods and experimental conditions described, as such methods and conditions can be varied. It should also be understood that the terminology used herein is intended only to describe particular embodiments and is not intended to be limiting; the scope of the invention will be limited only by the appended claims.

[0127] While any methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of this invention, preferred methods and materials are exemplified herein.

[0128] In this field, accurate preoperative diagnosis of thyroid nodules to provide patients with appropriate and timely treatment has always been a hot topic in thyroid research. With advancements in molecular biology techniques, molecular diagnostics has gradually gained attention in the differential diagnosis of benign and malignant thyroid nodules. The theoretical basis for the molecular differential diagnosis of benign and malignant nodules is based on the fact that some pathogenic genes for thyroid cancer only exhibit specific somatic mutations or fusion genes in the cancerous tissue of cancer patients. These mutations or new fusion genes are not present in the normal cells of the patient or in the thyroid tissue of non-thyroid cancer patients. Therefore, these molecular markers are highly specific in the differential diagnosis of benign and malignant thyroid cancer. For example, it has been found that 100% of patients with thyroid nodules carrying the Val600Glu mutation at amino acid position 600 of the BRAF gene have malignant nodules. While these gene mutations have excellent specificity in differentiating between benign and malignant thyroid nodules, the mutation frequency of each pathogenic gene in thyroid cancer patients is low. Therefore, relying solely on molecular mutation testing of a single gene can be significant for diagnosing positive cases, but negative results can lead to missed diagnoses of many true thyroid cancer patients, delaying treatment. To overcome this challenge in molecular diagnosis of thyroid cancer, simultaneous mutation testing of multiple genes contributing to thyroid cancer is necessary to improve the specificity of differentiating between benign and malignant thyroid nodules and reduce the false negative rate.

[0129] However, to simultaneously detect somatic mutations and novel fusion genes of multiple thyroid cancer-specific pathogenic genes in thyroid nodule samples, several scientific and technical challenges need to be overcome to achieve clinical application goals:

[0130] First, although numerous pathogenic gene mutations for thyroid cancer have been reported in the literature, it remains unclear which of these reported mutated genes are truly pathogenic and which are not. Second, among the currently reported pathogenic genes for thyroid cancer, it is unknown which gene combinations have a high positive rate and a low possibility of missed diagnoses in the differential diagnosis of thyroid nodules. Identifying such a group of pathogenic gene combinations for thyroid cancer will be crucial in differentiating between benign and malignant thyroid nodules.

[0131] Second, because the pathogenic gene mutations (mutations and fusion genes) in thyroid cancer occur in somatic cells within thyroid cancer cells, diagnosis requires fine-needle aspiration of thyroid nodule cells. However, the number of cells obtained through fine-needle aspiration is very small (generally 10-200 cells). Detecting a large number of gene mutations and fusion genes in such a small number of cells using traditional first-generation sequencing is impossible. New detection technologies are needed to establish molecular diagnostic methods based on combinatorial markers.

[0132] Third: Gene mutations in thyroid cancer mainly fall into two categories: somatic gene mutations and the appearance of new fusion genes in tumor cells. Traditional methods for detecting these two types of mutations rely on the sample's DNA and mRNA, respectively. This requires collecting sufficient amounts of thyroid nodule tissue twice. This is difficult to perform in routine clinical diagnosis. Therefore, how to utilize a single, small biopsy sample to detect a large number of these gene mutations is a bottleneck for the practical application of combinatorial molecular markers.

[0133] Therefore, this invention mainly addresses the bottlenecks in the molecular diagnosis of the above three thyroid nodules, and has the following originality:

[0134] First, we selected 19 pathogenic genes for papillary thyroid carcinoma, 8 different fusion genes, and common genes in undifferentiated and poorly differentiated carcinomas such as TP53 and CTNNB1, as well as the RET gene in medullary thyroid carcinoma, as molecular markers. Through targeted amplification of cDNA from these mutated regions, combined with next-generation sequencing technology, we detected gene mutations and fusion genes in thyroid cancer, thyroid adenoma, or normal thyroid tissue. We found that this group of combined molecular markers had an overall positive rate as high as 81% in the Chinese thyroid cancer population, making them a group of molecular markers with excellent diagnostic value. The combination of the 11 most commonly mutated core genes and 8 different fusion genes could achieve a diagnostic positive rate of over 93%.

[0135] Secondly, based on Fludigam's target gene multiplex PCR amplification chip technology, a specific combination of multiplex target gene amplification techniques was developed, solving the problem of simultaneously targeting and amplifying multiple genes in trace samples. Simultaneously, using next-generation sequencing technology, the multiplex PCR primers were analyzed to determine the presence of specific gene mutations or new fusion genes in each sample. This overcomes the technical bottleneck of simultaneously detecting multiple gene variations in trace samples.

[0136] Furthermore, this invention selects mRNA as the target gene amplification object for the detection of gene variants using combinatorial molecular markers. This achieves the goal of detecting both gene mutations and fusion genes in the same sample, making its clinical application possible. Simultaneously, using mRNA as a template for gene variant detection allows for the evaluation of the quality of the biopsy sample and provides an objective assessment of the reliability of the diagnosis.

[0137] Combinations of multiple molecular markers can be used to differentiate between benign and malignant thyroid nodules. For example, using BRAFV600E, RAS, RET / PTC1, RET / PTC3, and the PAX8 / PPAR fusion gene as molecular markers can significantly increase the diagnostic capability for benign and malignant thyroid nodules. The sensitivity of this combination of molecular markers for differentiating between benign and malignant thyroid nodules can reach 62%, and the specificity can reach 99.7%. When combined with pathological cytology, the sensitivity for differentiating between benign and malignant thyroid nodules can be increased from 44% using pathological cytology alone to 80%. The main reason for the relatively low sensitivity of these molecular markers is that not all pathogenic genes for thyroid cancer have yet been identified. In thyroid cancer patients, the frequency of mutually exclusive mutations between different genes is mostly around 70% for the aforementioned common pathogenic genes. Therefore, using combinations of hotspot sites of currently common pathogenic genes as molecular markers for differentiating between benign and malignant thyroid nodules has significant limitations.

[0138] To improve the sensitivity of molecular marker diagnosis, the first step is to identify the pathogenic genes or molecular markers of thyroid cancer. According to the 2008 American Institute for Cancer Research (AIC) diagnostic criteria for thyroid cytology, thyroid cancer is currently classified into four types: papillary carcinoma (follicular carcinoma is now included in this pathological type, classified as a variant of papillary carcinoma), poorly differentiated carcinoma, undifferentiated carcinoma, and medullary thyroid carcinoma. The most common type is papillary thyroid carcinoma, accounting for over 95% of all thyroid cancers. The pathogenic genes may differ among different types of thyroid cancer, and the mutation frequency of the same pathogenic gene also varies in different types of thyroid cancer. For example, the BRAF gene is a common mutated gene in papillary thyroid carcinoma, while the TP53 gene is a frequently mutated gene in poorly differentiated and undifferentiated carcinomas. More than 50% of patients with undifferentiated carcinoma carry the TP53 gene mutation, but mutations in the TP53 gene are rarely found in papillary thyroid carcinoma. Mutations in the RET gene are very common in patients with medullary thyroid carcinoma. For example, the mutation rate is as high as 95% in familial medullary thyroid carcinoma, and 40-50% in sporadic medullary thyroid carcinoma. A large-scale whole-genome exome sequencing study of papillary thyroid carcinoma published in Cell in 2014 provided exciting prospects for the differential diagnosis of benign and malignant thyroid nodules using combinatorial molecular markers. Through whole-genome exome sequencing of 496 cases of papillary thyroid carcinoma, they identified five pathogenic genes for thyroid cancer, including three potentially novel pathogenic genes; and discovered various types of fusion gene variants formed by eight genes with other different genes. In these thyroid cancers, 73.6% of the samples carried mutations in at least one of the five pathogenic genes, and 89.8% of the samples carried either pathogenic gene mutations or fusion gene variants. Approximately 10% of thyroid cancers showed neither point mutations in the five pathogenic genes nor any of the identified fusion gene variants. They then analyzed chromosomal amplification and deletion variants in these tumor samples using SNP microarray and other technologies. They found that large-segment amplification and deletion of chromosomal regions (Arm-level chromosomal variations) were very common in thyroid cancer samples. Specifically, 22q chromosome deletion occurred in approximately 14.4% of thyroid cancer patients, while large-segment amplification of 1q chromosome accounted for 14.8%. If these arm-level amplification and deletion variants were used as molecular markers, the number of patients carrying at least one of the three types of variants—pathogenic gene mutation, fusion gene variation, or arm-level chromosomal amplification and deletion—would increase to 96.6%. This indicates that if we could use these three different types of variants for molecular diagnosis of thyroid nodules, the diagnostic sensitivity could potentially reach over 95%, making it the most reliable diagnostic method currently available for differentiating benign from malignant thyroid nodules.

[0139] The emergence of new molecular biology techniques, such as multiplex PCR amplification of target genes combined with next-generation sequencing, has made it possible to simultaneously detect multiple gene variations using a small amount of RNA extracted from thyroid biopsy cells as a template. This simplifies and facilitates the detection of combinatorial molecular markers while ensuring that potential gene mutations are not missed. Fluidigm's targeted amplification chips can target and amplify multiple mutated genes and perform next-generation sequencing library construction. A single chip can simultaneously perform PCR amplification on 450 to 1500 primer pairs from 48 samples, meeting the diagnostic needs of molecular markers for thyroid cancer.

[0140] Therefore, this invention employs Fluidigm's target gene multiplex PCR amplification chip technology, selecting 19 pathogenic genes currently identified for papillary thyroid carcinoma, 8 different fusion genes, and common genes in undifferentiated and poorly differentiated carcinomas such as TP53 and CTNNB1, as well as the RET gene in medullary thyroid carcinoma, as molecular markers. Through targeted amplification of cDNA from these variant regions, combined with next-generation sequencing technology, the presence of variations in these molecular markers in thyroid nodules is identified, thereby enabling differential diagnosis of benign and malignant thyroid nodules. Ultimately, a number of new gene polymorphic sites associated with malignant thyroid nodules were discovered, as detailed in Table 1.

[0141] Table 1

[0142] Gene name mutation site BRAF NM_004333:exon15:c.T1799A CHEK2 NM_145862:exon11:c.A1250G:p.N417S GNAS NM_001077490:exon1:c.T1019C:p.L340P GNAS NM_016592:exon1:c.C205A:p.H69N GNAS NM_016592:exon1:c.C216T:p.G72G NRAS NM_002524:exon3:c.T284C:p.L95P PIK3CA NM_006218:exon12:c.1818delC:p.Y606fs TSHR NM_000369:exon10:c.A2098G:p.K700E TSHR NM_000369:exon10:c.A2252G:p.K751R

[0143] The gene sequence numbers in Table 1 refer to the GRCh37 / hg19 version.

[0144] BRAF gene

[0145] The protein encoded by the BRAF gene belongs to the raf family of serine / threonine kinases. It plays a regulatory role in the MAPK / ERK pathway, participating in cell division, differentiation, and secretion. BRAF gene mutations are believed to be associated with the development of various cancers, including non-Hodgkin's lymphoma, colorectal cancer, malignant melanoma, thyroid cancer, and non-small cell lung cancer. Furthermore, studies have shown that BRAF gene mutations are associated with cardiomyopathy.

[0146] The sequence fragment of the BRAF gene (NM_004333) with the mutation at position 1799 is as follows: CCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAG[T / A]GAAATCTCGATGGAG TGGGTCCCATCAGTTTGAACAGTTGT (SEQ ID NO.1)

[0147] In a preferred embodiment of the present invention, the primer pair used to detect the BRAF gene mutation site at position 1799 is as follows:

[0148] BRAF-E15-F GGAGCCTTGTATATAGACGG SEQ ID NO.2 BRAF-E15-R TGTATGTTCTAACAGGCACC SEQ ID NO.3

[0149] NRAS gene

[0150] The NRAS gene is an oncogene that encodes a membrane protein that can shuttle between the Golgi apparatus and the cell membrane. The NRAS protein possesses intrinsic GTPase activity, which can be activated by guanine nucleotide exchange factor and inhibited by GTPase-activated proteins. Point mutations in the NRAS gene are believed to be associated with the development of somatic cell rectal cancer, follicular thyroid cancer, autoimmune lymphoproliferative syndrome, Noonan syndrome, and leukemia.

[0151] GNAS gene

[0152] GNAS is a protein-coding gene involved in the G protein-coupled receptor (GPCR) and polypeptide ligand-binding receptor signaling pathways, participating in the activation of adenylate cyclase and various cellular responses. Multiple transcriptional versions of this gene exist. GNAS gene mutations are associated with pseudohypoparathyroidism, hereditary osteodystrophy, McCune-Albright syndrome, progressive osteodystrophy, polyostotic fibrous dysplasia, and some pituitary tumors.

[0153] TSHR gene

[0154] The TSHR gene encodes a membrane protein that is primarily involved in thyroid cell metabolism. It acts as a receptor for thyroid-stimulating hormone (TSH) and can be activated by adenylate cyclase. Diseases associated with TSHR include congenital hypothyroidism and non-autoimmune hyperthyroidism.

[0155] CHEK2 gene

[0156] The CHEK2 gene plays a crucial role in regulating cell cycle processes, particularly in DNA damage and replication. It encodes a protein that acts as a cell cycle checkpoint regulator and is considered a tumor suppressor gene. Mutations in this gene are associated with Li-Fraumeni syndrome, a familial, highly clustered cancer phenotype characterized by TP53 mutations. Furthermore, carrying this gene mutation increases the risk of sarcomas, breast cancer, and brain tumors.

[0157] PIK3CA gene

[0158] The PIK3CA gene is an oncogene belonging to the PI3Ks family. It is responsible for coordinating various cellular functions, including survival and proliferation. Mutations in this gene are associated with the development of tumors such as cervical cancer.

[0159] The main advantages of this invention are:

[0160] (1) For the first time, a group of gene polymorphic sites that can serve as markers for differentiating between benign and malignant thyroid nodules were revealed, with high specificity;

[0161] (2) The combination of molecular markers (mutated gene sites) according to the present invention has good diagnostic value for the Chinese thyroid cancer population, and can make the positive rate of diagnosis as high as 90% or more.

[0162] (3) When collecting clinical patient samples, only thyroid nodule puncture cells need to be collected and RNA extracted as a template. Gene mutations and fusion genes can be detected at the same time, which is clinically feasible.

[0163] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in *Molecular Cloning: A Laboratory Manual* by Sambrook J. et al. (translated by Huang Peitang et al., Beijing: Science Press, 2002), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. Unless otherwise specified, all experimental materials and reagents used in the following embodiments are commercially available.

[0164] method

[0165] This invention provides a targeted gene next-generation sequencing detection method for differentiating between benign and malignant thyroid nodules, and determines the appropriate surgical procedure and postoperative management for patients based on the molecular diagnostic results of thyroid nodules.

[0166] Specifically, this invention provides a targeted gene next-generation sequencing detection method for the differential diagnosis of thyroid nodules, comprising the following steps:

[0167] Step (1): Obtain information on known genes that may lead to thyroid cancer;

[0168] Step (2): Export gene sequences and coding information from the UCSC and NCBI databases;

[0169] Step (3): Use Mass ARRAY Assay Design software to design AA chip primers for these genes;

[0170] Step (4): The general steps of the AA chip experiment (which can be divided into 5 steps);

[0171] ① Sample loading: Use a multi-pipette to transfer the primers and template from the 96-well plate to 48.48.

[0172] On the Access Array IFC chip.

[0173] ② Loading: Place the chip into the Pre-PCR IFC Controller AX instrument, and the primers and template will be automatically mixed.

[0174] ③ Thermal cycling: PCR amplification reaction was performed using an FC1 Cycler instrument.

[0175] ④ Harvesting: PCR products were collected and harvested using a Post-PCR IFC Controller AX instrument.

[0176] ⑤ Recovery: Use a pipette to aspirate the PCR products from the sample loading site on the chip template.

[0177] Step (5): Analyze the sequencing results using BWA, SAMTOOLS and GATK software.

[0178] Step (6): All measured SNVs and indels are processed by ANNOVAR ( http: / / annovar.openbioinformatics.org / Function annotations and public database (ExAC, 1000 Genomes, dbSNP and ClinVar) filtering.

[0179] Step (7): SNVs that meet the following criteria are confirmed by Sanger sequencing: ① dual-duplicate SNV, alldepth>20, vaf>0.3; ② single-duplicate SNV, alldepth>1000, vaf>0.4; ③ dual-duplicate SNV, single-duplicate SNV is poorly measured, but dual-duplicate SNV is good (alldepth>1000).

[0180] Step (8): Indels meeting the criteria of ① double-duplicate INDELs with SNPs removed; ② single-duplicate INDELs with alldepth>25 and vaf≥0.4 and SNPs removed were confirmed by Sanger sequencing.

[0181] Preferably, the panel contains 19 genes, 8 fusion genes, and related internal reference genes associated with the pathogenesis of thyroid cancer, as detailed below:

[0182] Detection of SNVs in 19 genes: BRAF, HRAS, NRAS, KRAS, EIF1AX, PPM1D, CHEK2, RET, CTNNB1, TP53, AKT1, GNAS, PIK3CA, PTEN, TSHR, CDKN2A, AXIN1, IDH1, VHL

[0183] Eight fusion genes were detected: CCDC6 / RET, NCOA4 / RET, ETV6 / NTRK3, STRN / ALK, PAX8 / PPARG, TPM3 / NTRK3, EML4 / ALK, and PRKAR1A / RET.

[0184] Thyroid-specific genes and internal reference genes: TG, TPO, GAPDH, β-actin, 18S rRNA, 28S rRNA, Tublin, RPLPO (human macroribosomal protein), TFRC (transferrin receptor).

[0185] Preferably, the method used for Access Array TM The primer design software used for System amplification was Mass ARRAYAssay Design.

[0186] Preferably, the data analysis software after targeted sequencing is BWA, SAMTOOLS, or GATK.

[0187] Preferably, the criteria for screening SNVs are: ① Double-duplicate SNVs, alldepth>20, vaf>0.3; ② Single-duplicate SNVs, alldepth>1000, vaf>0.4; ③ Double-duplicate SNVs, single-duplicate measurements are poor, but duplicate measurements are good (alldepth>1000).

[0188] Preferably, the criteria for screening Indels are: ① Double-well Indels, remove SNPs; ② Single-well Indels, alldepth>25, vaf≥0.4, remove SNPs.

[0189] This invention is applicable to the definitive differential diagnosis of benign and malignant thyroid nodules, filling gaps and deficiencies in this field. It utilizes Access Array based on mutated and fusion genes that may lead to thyroid cancer. TMThe system established a combinatorial panel for next-generation sequencing of targeted genes. Through preliminary next-generation sequencing, data analysis, and Sanger sequencing validation of 123 thyroid cancer patients, mutations were detected in 11 out of 19 genes, including hotspot mutations BRAF V600E, NRAS:Q61R, Q61K, RET M918T, PTEN, TSHR, TP53, and AKT1. Fusion genes ETV6-NTRK3, NCOA4-RET, and CCDC6-RET were detected. The diagnostic rate of this combinatorial molecular marker application in 123 thyroid cancer patients was extremely high. Furthermore, multiple pathogenic gene mutations or the simultaneous presence of driver gene mutations and fusion genes were found in several patients, indicating that the pathogenesis of thyroid cancer is caused by the accumulation of multiple gene alterations and exhibits tumor heterogeneity, further confirming the necessity of precision medicine diagnosis for this type of disease. This invention is applicable to the differential diagnosis of benign and malignant thyroid nodules in clinical practice. It can perform high-throughput detection and can be promoted in clinical practice. It helps to comprehensively select treatment plans for patients, fully make up for the deficiencies and gaps in this field, and has great practical value.

[0190] In summary, the results of this project confirm the important role of combinatorial molecular markers based on next-generation sequencing technology in the diagnosis of benign and malignant thyroid nodules. Targeted next-generation sequencing of combinatorial molecular markers encompassing most thyroid cancer-causing genes can improve the diagnostic rate of thyroid malignancies, successfully compensating for the current shortcomings in thyroid cytological diagnosis, and guiding the improvement of diagnosis and treatment for patients with thyroid nodules. This avoids the waste of social medical resources and the potential risks of unnecessary diagnostic surgeries. Furthermore, the results of this study provide new insights into the role of gene diagnosis in clinical practice.

[0191] Example 1: Screening and identification of gene polymorphism sites related to benign and malignant thyroid nodules

[0192] Sample description: Thyroid fine-needle aspiration cells were used to extract RNA, which was then reverse transcribed to obtain a cDNA library.

[0193] Specific implementation steps:

[0194] Step (1): Based on possible thyroid cancer-causing genes, including mutated genes and fusion genes, and based on the gene sequence in GRCh37 / hg19 in UCSCGenome Browser, determine the chromosomal location, coding, gene size, and pseudogene status of the gene.

[0195] Step (2): According to Access Array TM Requirements for system amplification (target sequence size 240bp, with overlap), design primers, and add tag sequences.

[0196] Step (3): After primer synthesis, dilute the primers and press Access Array. TM For System amplification, prepare primer mixtures and divide them into 96-well plates.

[0197] Step (4): Preparation of amplification template, quantify to 50 ng / ul (less than 50 ng / ul is recorded as 50 ng / ul), prepare template mixture, and divide into 96-well plates.

[0198] Step (5): Use a pipette to transfer the primers and template from the 96-well plate onto the 48.48 Access Array IFC chip.

[0199] Step (6): Place the chip into the Pre-PCR IFC Controller AX instrument, the primers and templates are automatically mixed, and the PCR amplification reaction is performed using the FC1 Cycler instrument.

[0200] Step (7): Collect and harvest PCR products using the Post-PCR IFC Controller AX instrument (Note that the operation needs to be performed in a different room to prevent contamination).

[0201] Step (8): Prepare the barcode mixture, add the product diluted 1:100, and perform the PCR reaction.

[0202] Step (9): Purify the product with magnetic beads, run gel electrophoresis to confirm the barcode has been added, and then prepare for sequencing.

[0203] Step (10): NextSeq500 sequencing was performed, and the data were analyzed using BWA, SAMTOOLS and GATK software.

[0204] Step (11): The measured SNV and indel are processed by ANNOVAR ( http: / / annovar.openbioinformatics.org / Function annotations and public database (ExAC, 1000 Genomes, dbSNP and ClinVar) filtering.

[0205] Step (12): SNVs that meet the following criteria are confirmed by Sanger sequencing: ① dual-duplicate SNV, alldepth>20, vaf>0.3; ② single-duplicate SNV, alldepth>1000, vaf>0.4; ③ dual-duplicate SNV, single-duplicate SNV is poorly measured, but dual-duplicate SNV is good (alldepth>1000).

[0206] Step (13): Indels meeting the criteria of ① double-duplicate INDELs with SNPs removed; ② single-duplicate INDELs with alldepth>25 and vaf≥0.4 and SNPs removed were confirmed by Sanger sequencing.

[0207] This invention is applicable to molecular detection for the differential diagnosis of benign and malignant thyroid nodules, filling the gaps and deficiencies in this field. The principle is that, based on the pathogenic genes related to the pathogenesis of thyroid cancer that have been reported so far, primers are designed using Mass ARRAYAssay Design software. After multiplex PCR amplification of the targeted genes on a 48.48 Access Array IFC, next-generation sequencing analysis is performed, making high-throughput and broader gene diagnosis of this disease possible.

[0208] A study of 123 patients revealed mutations in 11 out of 19 genes (Table 2), and detected 3 fusion genes (Table 3), encompassing 115 mutations, with a diagnostic rate exceeding 93%. Further, more driver genes and fusion genes for thyroid cancer in the Chinese population can be aggregated into a single diagnostic panel, enabling more efficient and rapid gene testing of large numbers of samples. This invention is highly applicable to patients with thyroid nodules in the Chinese population, filling gaps and deficiencies in this field, and possesses significant practical value.

[0209] Table 2

[0210]

[0211]

[0212] Table 3

[0213] Fusion gene name Sequence information Number of patients with mutations ETV6-NTRK3 ETV6{ENST00000396373}:r.1_737_NTRK3{ENST00000394480}:r.1719_19984 10 NCOA4-RET NCOA4{ENST00000452682}:r.1_1014_RET{ENST00000355710}:r.2369_5659 3 CCDC6-RET CCDC6{ENST00000263102}:r.1_535_RET{ENST00000355710}:r.2369_5659 2

[0214] The tissue specificity of the gene mutations in this invention was analyzed. The results showed that each mutation site in this invention has excellent tissue specificity. The mutations were specifically detected in thyroid cancer tissues but rarely detected in normal somatic cells. Only one case of a thyroid adenoma showed a Q61K mutation in the NRAS gene. It is worth noting that although thyroid adenomas are benign diseases, their pathological morphology can sometimes be very similar to that of papillary thyroid carcinoma. Therefore, relying solely on pathology may sometimes lead to diagnostic errors. Specific results are shown in Table 4 below.

[0215] Table 4

[0216]

[0217] TA, Thyroid adenoma

[0218] NG, nodular goiter

[0219] PTC, papillary thyroid carcinoma.

[0220] FTC stands for Follicular Thyroid Carcinoma (which is included in PTC).

[0221] MTC, medullary thyroid carcinoma

[0222] PDTC, poorly differentiated thyroid cancer.

[0223] ATC, or undifferentiated thyroid carcinoma.

[0224] Example 2: Preparation and efficacy verification of the reagent kit

[0225] This embodiment provides a kit for detecting benign or malignant thyroid nodules.

[0226] This kit can detect gene mutations at the mutation sites in Table 2 and the fusion genes in Table 3 above.

[0227] Main reagents in the kit:

[0228] (1) Primers for amplification of polymorphic sites

[0229] Upstream primer (F) and downstream primer (R) (designed using Mass ARRAY Assay Design software);

[0230] (2) Sequencing primers for polymorphic sites

[0231] Sequencing primers (S) (designed according to conventional methods in the field);

[0232] (3) PCR main reagents: Pfu high-fidelity enzyme, 10× PCR Buffer, dNTP IXtur, ddH2O;

[0233] (4) Main reagents for pyrosequencing: 70% ethanol solution, magnetic beads, denaturation buffer, annealing buffer, binding buffer, washing buffer, substrate (ASP, luciferin), enzyme mixture (DNA polymerase, luciferase, adenosine triphosphate sulfatase, adenosine triphosphate diphosphatase), A / T / C / G bases.

[0234] Using the kit provided in this embodiment, 300 patients with thyroid nodules were tested. The specific method is as described in Example 1. A total of 176 patients were found to carry the gene mutation of the present invention. Finally, 184 patients were confirmed to have thyroid cancer by routine clinical methods, with a detection rate of over 95%. The specific test results are shown in Table 5.

[0235] Table 5. Results of targeted gene next-generation sequencing in 300 thyroid cancer patients

[0236]

[0237] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. The use of the gene mutation site of group (I) or its detection reagent, characterized in that, For the preparation of reagents or kits used to differentiate between benign and malignant thyroid nodules, group (I) includes the following gene mutation sites: GNAS gene: NM_016592:exon1:c.C205A; TSHR gene: NM_000369:exon10:c.A2252G; BRAF gene: NM_004333:exon15:c.T1799A.

2. The use as described in claim 1, characterized in that, Group (I) also includes the following gene mutation sites: GNAS gene: NM_016592:exon1:c.C216T; and / or Group (I) also includes the following gene mutation sites: TSHR gene: NM_000369:exon10:c.A2098G; and / or Group (I) also includes the following gene mutation sites: BRAF gene: NM_004333:exon11:c.G1338A.

3. The use as described in claim 1, characterized in that, The reagents mentioned include primers, probes, chips, or antibodies.

4. The use as described in claim 1, characterized in that, The subjects being tested include: humans or non-human mammals.

5. The use as described in claim 1, characterized in that, The kit contains one or more reagents selected from the group consisting of: (A) Specific primers for gene detection; (B) Specific probes for gene detection; (C) Chip used for gene detection; (D) Specific antibodies used to detect amino acid mutations corresponding to mutated genes.

6. A kit for differentiating benign from malignant thyroid nodules, characterized in that, The kit includes reagents for detecting the following gene mutation sites: GNAS gene: NM_016592:exon1:c.C205A; TSHR gene: NM_000369:exon10:c.A2252G; BRAF gene: NM_004333:exon15:c.T1799A.

7. The kit according to claim 4, characterized in that, The kit also includes reagents for detecting the following gene mutation sites: GNAS gene: NM_016592:exon1:c.C216T; and / or The kit also includes reagents for detecting the following gene mutation sites: TSHR gene: NM_000369:exon10:c.A2098G.

8. The kit according to claim 4, characterized in that, The kit also includes detection reagents selected from one or more gene mutation sites from the following group: BRAF gene: NM_004333:exon11:c.G1338A、 NM_004333:exon15:c.A1801G; CHEK2 gene: NM_145862:exon10:c.C1024T; NRAS gene: NM_002524:exon3:c.C181A, NM_002524:exon3:c.A182G; AKT1 gene: NM_001014431:exon3:c.G49A; PPM1D gene: NM_003620:exon1:c.C262T; PTEN gene: NM_000314:exon5:c.C328T; RET gene: NM_020630:exon11:c.T1888C, NM_020630:exon16:c.T2753C; TP53 gene: NM_001126115:exon3:c.C265T, NM_000546:exon8:c.G814T; And / or, the kit may further include detection reagents for one or more fusion genes selected from the group consisting of: ETV6-NTRK3 fusion gene: ETV6{ENST00000396373}:r.1_737_NTRK3{ENST00000394480}:r.1719_19984; NCOA4-RET fusion gene: NCOA4{ENST00000452682}:r.1_1014_RET{ENST00000355710}:r.2369_5659; CCDC6-RET fusion gene: CCDC6{ENST00000263102}:r.1_535_RET{ENST00000355710}:r.2369_5659.

9. The kit according to claim 4, characterized in that, The detection reagent is: (A) Specific primers for gene detection; (B) Specific probes for gene detection; (C) A chip used for gene detection; or (D) Specific antibodies used to detect amino acid mutations corresponding to mutated genes.

10. A method for non-diagnostic in vitro detection of gene mutations in a sample, characterized in that, Including the following steps: (a) Amplifying polynucleotides in the sample using specific primers to obtain amplification products; and (b) Detect the presence of the following combinations of gene mutations in the amplification products: GNAS gene: NM_016592:exon1:c.C205A; TSHR gene: NM_000369:exon10:c.A2252G; BRAF gene: NM_004333:exon15:c.T1799A.