Medicago sativa salt tolerance and biomass related molecular marker method and breeding application
By using KASP molecular markers related to branch number, plant height, and salt tolerance in alfalfa, the problems of long breeding cycles and inaccurate screening in traditional breeding methods have been solved, achieving an efficient and accurate breeding process and cultivating high-yielding and superior varieties adapted to saline-alkali land.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF BOTANY CHINESE ACAD OF SCI
- Filing Date
- 2026-01-30
- Publication Date
- 2026-05-12
AI Technical Summary
Traditional alfalfa breeding relies on field phenotypic observation, which is time-consuming and easily affected by environmental factors. It is difficult to quickly aggregate superior genes and lacks precise screening methods for salt tolerance traits, resulting in low breeding efficiency and failing to meet the demand for high-yield and high-quality varieties.
We developed KASP molecular markers related to branch number, plant height, and salt tolerance in alfalfa, accurately identified key SNP sites through genome-wide association analysis, and achieved efficient screening by combining competitive allele-specific PCR technology.
This has enabled an efficient and accurate breeding process, shifting from phenotypic selection to genotypic selection, shortening the breeding cycle, improving selection efficiency, and cultivating high-yielding and superior varieties adapted to saline-alkali land.
Smart Images
Figure CN122012775A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the technical field of related molecular marker methods, and particularly relates to molecular marker methods and breeding applications for salt tolerance and biomass related to alfalfa. Background Technology
[0002] Alfalfa, as a high-quality legume forage, plays an irreplaceable role in livestock production due to its core agronomic traits, namely biomass and leaf-to-stem ratio, which determine yield and feed quality. Traditional breeding methods mainly rely on field phenotypic observation and screening, which is not only time-consuming but also easily affected by environmental factors such as climate and soil, resulting in insufficient selection accuracy and difficulty in rapidly aggregating superior genes, thus failing to meet the urgent demand for high-yield and high-quality varieties in large-scale production. Furthermore, the genetic background of traits related to leaf-to-stem ratio and biomass is complex, making it difficult for conventional breeding to precisely target and regulate key genetic loci, severely restricting the efficiency and progress of variety improvement.
[0003] Soil salinization has become a significant ecological problem restricting sustainable agricultural development globally, significantly limiting the planting area and production potential of alfalfa. With the expansion of irrigated agriculture and changes in the ecological environment, the area of saline-alkali land continues to expand, making the cultivation of salt-tolerant alfalfa varieties crucial for ensuring the stable development of the forage industry. Traditional salt-tolerant breeding mainly relies on natural variation screening or hybridization breeding, which suffers from bottlenecks such as long cycles, low selection efficiency, and difficulty in synergistically improving desirable traits like salt tolerance and high yield. Furthermore, it lacks early and rapid screening methods, making it impossible to accurately identify salt-tolerant genotypes in the early stages of breeding. Although molecular marker-assisted selection technology offers a possibility to overcome the limitations of traditional breeding, currently, there is a scarcity of highly efficient and specific molecular markers related to salt tolerance, leaf-to-stem ratio, and biomass in alfalfa, and a mature technical system has not yet been established to support breeding practices. Therefore, there is an urgent need to develop precise and targeted molecular marker tools. Summary of the Invention
[0004] The purpose of this invention is to address the aforementioned technical problems by providing a method for molecular markers related to salt tolerance and biomass in alfalfa and their breeding applications.
[0005] In view of this, the present invention provides a method for molecular markers related to salt tolerance and biomass in alfalfa, including the KASP molecular marker KFZBJ_2 related to the number of branches in alfalfa; The molecular marker corresponds to the SNP site Chr2_5456171 on the Chr2 chromosome of alfalfa, and its primer set includes primer X, primer Y, and a universal primer, with the following sequences: Primer X: GAAGGTGACCAAGTTCATGCTAAGTCTAGACTGCATGGTCAAGG; Primer Y: GAAGGTCGGAGTCAACGGATTCAAGTCTAGACTGCATGGTCAAGA; Universal primer: CTAAATTATCTGATCAAGATCTGACGACTT.
[0006] Preferred markers include the KASP molecular marker KFZBJ_3, which is associated with alfalfa plant height; The molecular marker corresponds to the SNP site Chr1_26013590 on the Chr1 chromosome of alfalfa, and its primer set includes primer X, primer Y, and universal primers, with the following sequences: Primer X: GAAGGTGACCAAGTTCATGCTATAGTCCCGGGGCAGACTCAAAT; Primer Y: GAAGGTCGGAGTCAACGGATTAGTCCGGGGCAGACTCAAAC; Universal primer: GGTAATGAGTGTAACAAAGCCATTGACTT.
[0007] Preferably, the primer set includes the KASP molecular marker KFZBJ_24, which is associated with alfalfa plant height. This molecular marker corresponds to the SNP site Chr3_73727583 on the alfalfa Chr3 chromosome. Its primer set includes primer X, primer Y, and a universal primer, with the following sequences: Primer X: GAAGGTGACCAAGTTCATGCTCAGAKYGGCGTTSGTAAATTTA; Primer Y: GAAGGTCGGAGTCAACGGATTAGAKYGGCGTTSGTAAATTTG; Universal primer: GTCTCCRCTTCTCCTTTCAAG.
[0008] Preferably, the primer set includes the KASP molecular marker KFZBJ_25, which is associated with salt tolerance in alfalfa. This molecular marker corresponds to the SNP site Chr2_27368015 on the Chr2 chromosome of alfalfa. Its primer set includes primer X, primer Y, and a universal primer, with the following sequences: Primer X: GAAGGTGACCAAGTTCATGCTCGCTTCTTAGCTTTGAAACTTT; Primer Y: GAAGGTCGGAGTCAACGGATTCGCTTCTTAGCTTTGAAACTTG; Universal primer: GCTAAAGATTGATTCAAAACTGACC.
[0009] Application of molecular markers related to salt tolerance and biomass in alfalfa, including parent selection and progeny screening in high-yield or salt-tolerant alfalfa breeding.
[0010] Preferably, the high-yield breeding uses a multiple linear regression model Y=-139.6855+1.9929×number of branches+2.5566×plant height to predict the dry weight of alfalfa plants.
[0011] Preferably, the KFZBJ_24 marker is used to screen plants with the AG salt-tolerant allele at the NYL2 locus, and the KFZBJ_25 marker is used to screen plants with the GG salt-tolerant allele at the NYL1 locus.
[0012] The beneficial effects of this invention are: By precisely identifying key SNP loci associated with branching number, plant height, and salt tolerance in alfalfa through genome-wide association analysis, specific KASP molecular markers were successfully developed. Utilizing competitive allele-specific PCR technology, efficient and precise screening of target traits was achieved. These markers are highly targeted and reliable in genotyping, effectively overcoming the technical bottlenecks of traditional breeding methods that rely on phenotypic observation, such as lengthy cycles, low efficiency, and high selectivity. They provide directly applicable molecular targets for molecular design breeding of alfalfa, shifting the breeding process from "phenotypic selection" to "genotypic selection."
[0013] This molecular marker system and its supporting detection procedures are highly practical. They can be widely applied not only to parent selection and progeny identification in conventional alfalfa hybridization breeding, but also, when combined with gene editing technology, to directionally improve plant architecture and salt stress response pathways, accelerating the breeding process and reducing breeding costs. Under the challenges of complex environments, salt tolerance-related markers help cultivate varieties adapted to saline-alkali land, while high-yield-related markers promote the aggregation of superior agronomic traits. This provides core technical support for enhancing the environmental adaptability and production potential of alfalfa, and is of great significance for promoting the upgrading of forage breeding technology and ensuring sustainable forage production. Attached Figure Description
[0014] Figure 1 KASP molecular markers associated with alfalfa biomass and salt tolerance; A is the molecular marker for the number of branches in alfalfa, KFZBJ_2, with an accuracy of 67.2% (n=94). B is a polymeric marker for alfalfa plants, with KFZBJ_3 having an accuracy of 89% (n=94). C is a molecular marker related to salt tolerance in alfalfa, with an accuracy of 93.3% (n=94) for KFZBJ_24. D is a molecular marker related to salt tolerance in alfalfa, with an accuracy of 94.2% (n=94) for KFZBJ_25. Figure 2 To validate the polymeric marker KFZBJ_3 in alfalfa plant population 3; Plants carrying the C:C haplotype had a greater plant height than plants carrying the T:T haplotype (n=44, P<0.05). Detailed Implementation
[0015] The technical solutions of the embodiments of this application will be clearly described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this application. All other embodiments obtained by those skilled in the art based on the embodiments of this application are within the scope of protection of this application.
[0016] This invention relates to the field of molecular breeding technology for high-yield alfalfa, specifically disclosing two KASP molecular markers based on branch number and plant height traits and their application in high-yield alfalfa breeding. Through phenotypic analysis of 306 alfalfa germplasm resources, the applicant established for the first time a multiple linear regression model with branch number and plant height as the core predictive indicators (Y=-139.6855+1.9929×branch number+2.5566×plant height, R²=0.6066, p<0.0001), which can explain 60.66% of the variation in dry weight per alfalfa plant. Based on genome-wide association analysis, SNP loci significantly associated with branch number and plant height were identified on chromosomes Chr2 and Chr1, respectively, and two KASP molecular markers, KFZBJ_2 (Chr2) and KFZBJ_3 (Chr1), were developed accordingly. These markers, used in competitive allele-specific PCR, enable efficient and accurate screening of high-yielding alfalfa plants from breeding populations, with genotyping accuracy exceeding 89%. This invention overcomes the limitations of traditional yield phenotype screening methods, which are characterized by long cycles and low efficiency. This technology provides operable molecular targets for high-yield molecular design breeding of alfalfa. It is not only applicable to parental selection and progeny screening in conventional hybridization breeding but can also be combined with gene editing technology to directionally improve plant architecture. This has significant application value for breeding new alfalfa varieties with both high biomass and excellent agronomic traits.
[0017] This invention relates to the field of alfalfa salt-tolerant molecular breeding technology, specifically disclosing two KASP molecular markers for alfalfa salt tolerance based on the NYL1 and NYL2 gene loci and their applications. With the increasing soil salinization and the expansion of irrigated agriculture, alfalfa salt-tolerant breeding has become a key direction for ensuring sustainable forage production. Traditional breeding methods are time-consuming and inefficient, necessitating breakthroughs in molecular marker-assisted selection technology. This invention, through genome-wide association analysis, identified major gene loci NYL1 and NYL2 on chromosomes Chr2 and Chr3, respectively, that are significantly associated with salt tolerance. The TG single nucleotide polymorphism at the NYL1 locus and the AG SNP at the NYL2 locus are highly correlated with the alfalfa salt-tolerant phenotype. Based on these two functional SNPs, this invention designed and developed a specific KASP molecular marker system, comprising allele-specific primers and fluorescent probe combinations targeting NYL1-T / G and NYL2-A / G variations. Verification showed that the NYL1 marker achieved a 98% accuracy rate in genotyping the salt-tolerant allele (GG type), while the NYL2 marker achieved a 93.3% accuracy rate in genotyping the salt-tolerant allele (AA type). These molecular markers provide a precise tool for salt-tolerant molecular design breeding of alfalfa. They can be applied to evaluating the salt tolerance of germplasm resources, background selection in backcross breeding, and can be combined with gene editing technology to directionally improve salt stress response pathways. This has significant practical value for breeding high-yielding and high-quality alfalfa varieties adapted to saline-alkali lands.
[0018] Constructing the experimental workflow for the KASP detection platform; DNA quality control: Testing the purity and integrity of DNA samples.
[0019] Basic purity testing: The purity and concentration of DNA samples were determined using a spectrophotometer. 260 / 280: 1.8-2.2; 260 / 230 >= 1.0.
[0020] DNA integrity: DNA integrity is determined by agarose gel electrophoresis, where the main DNA band is clearly visible.
[0021] DNA dilution: DNA is diluted in samples that have passed quality inspection, with a concentration range of 5-50 ng.
[0022] PCR reaction components, system, and PCR reaction procedure: PCR reaction components; Master mix; FAMTM and HEXTM special fluorescent resonance energy transfer groups; Modified Taq enzymes can effectively amplify allele-specific bases; Optimized reaction buffer; Primer Mix; Two allele-specific primers (usually forward sequences) are used, each containing an unlabeled adapter sequence at its 5' end.
[0023] A universal primer (usually a reverse sequence); PCR reaction system: After the DNA is aliquoted into PCR reaction vessels, it needs to be dried. The drying method varies depending on the PCR system used. The LGC platform, for example, dries the aliquoted DNA in an oven at 65°C. o Place at C for 30 min until the DNA is completely dry; KASP detection PCR reaction system;
[0024] PCR reaction procedure: Denaturation at 94°C for 15 minutes; Enrich template DNA containing SNP sites;
[0025] Fluorescence signal amplification;
[0026] Optional step: If the genotype is not obvious, five more cycles can be added for amplification;
[0027] Reading of fluorescence signals; After the KASP detection PCR reaction program is completed, place the 384-well plate or tape onto the Omega fluorescence signal reader and Araya respectively to convert the fluorescence signal into analyzable values, and then perform genotyping analysis using the Kraken™ analysis software provided by LGC.
[0028] Reagents;
[0029] Main instruments:
[0030] Main consumables;
[0031] The specific sequence information of primers and probes includes the specific primer pair sequences for PCR labeling and the complete sequences of KASP-labeled probe combinations (forward probes and reverse probes);
[0032] KASP molecular marker validation (94 different GWAS populations, including different varieties from home and abroad, one strain of each was selected; genotyping accuracy is shown in [reference needed]). Figure 1 ).
[0033] The KFZBJ_3 polymeric marker has been validated in the Zhongmu 3 alfalfa population, as shown below. Figure 2 As shown; Salt tolerance molecular markers were designed based on the NaCl stress phenotype during the seedling stage. A small-scale survival comparison (n=36) was conducted on saline-alkali land using salt-tolerant haplotypes. Plants carrying the salt-tolerant haplotype (genotype 3 or 4 at the NYL1 locus) had a significantly higher survival rate (38.9%) than plants carrying the salt-intolerant haplotype (genotype = 0) (11.1%), approximately three times that of the latter. (Further experiments will be conducted to expand the experiment).
[0034] The embodiments of this application have been described above with reference to the accompanying drawings. Unless otherwise specified, the embodiments and features in the embodiments of this application can be combined with each other. This application is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of this application without departing from the spirit and scope of the claims, and all of these forms are within the protection scope of this application.
Claims
1. A molecular marker method for salt tolerance and biomass-related properties in alfalfa, characterized by: Including the KASP molecular marker KFZBJ_2, which is associated with the number of branches in alfalfa; The molecular marker corresponds to the SNP site Chr2_5456171 on the Chr2 chromosome of alfalfa, and its primer set includes primer X, primer Y, and a universal primer, with the following sequences: Primer X: GAAGGTGACCAAGTTCATGCTAAGTCTAGACTGCATGGTCAAGG; Primer Y: GAAGGTCGGAGTCAACGGATTCAAGTCTAGACTGCATGGTCAAGA; Universal primer: CTAAATTATCTGATCAAGATCTGACGACTT.
2. The method for molecular markers related to salt tolerance and biomass in alfalfa according to claim 1, characterized in that: Including the KASP molecular marker KFZBJ_3, which is associated with alfalfa plant height; The molecular marker corresponds to the SNP site Chr1_26013590 on the Chr1 chromosome of alfalfa, and its primer set includes primer X, primer Y, and universal primers, with the following sequences: Primer X: GAAGGTGACCAAGTTCATGCTATAGTCCCGGGGCAGACTCAAAT; Primer Y: GAAGGTCGGAGTCAACGGATTAGTCCGGGGCAGACTCAAAC; Universal primer: GGTAATGAGTGTAACAAAGCCATTGACTT.
3. The method for molecular markers related to salt tolerance and biomass in alfalfa according to claim 1, characterized in that: This includes the KASP molecular marker KFZBJ_24, which is associated with salt tolerance in alfalfa. This marker corresponds to the SNP site Chr3_73727583 on the Chr3 chromosome of alfalfa. Its primer set includes primer X, primer Y, and a universal primer, with the following sequences: Primer X: GAAGGTGACCAAGTTCATGCTCAGAKYGGCGTTSGTAAATTTA; Primer Y: GAAGGTCGGAGTCAACGGATTAGAKYGGCGTTSGTAAATTTG; Universal primer: GTCTCCRCTTCTCCTTTCAAG.
4. The method for molecular markers related to salt tolerance and biomass in alfalfa according to claim 1, characterized in that: This includes the KASP molecular marker KFZBJ_25, which is associated with salt tolerance in alfalfa. This marker corresponds to the SNP site Chr2_27368015 on the Chr2 chromosome of alfalfa. Its primer set includes primer X, primer Y, and a universal primer, with the following sequences: Primer X: GAAGGTGACCAAGTTCATGCTCGCTTCTTAGCTTTGAAACTTT; Primer Y: GAAGGTCGGAGTCAACGGATTCGCTTCTTAGCTTTGAAACTTG; Universal primer: GCTAAAGATTGATTCAAAACTGACC.
5. The application of the alfalfa salt tolerance and biomass-related molecular marker method, based on the alfalfa salt tolerance and biomass-related molecular marker method according to any one of claims 1-4, characterized in that: The applications include parent selection and offspring screening in high-yield or salt-tolerant alfalfa breeding.
6. The application of molecular marker breeding for salt tolerance and biomass-related properties of alfalfa according to claim 1, characterized in that: In the high-yield breeding, the multiple linear regression model Y=-139.6855+1.9929×number of branches+2.5566×plant height was used to predict the dry weight of alfalfa plants.
7. The application of molecular marker breeding for salt tolerance and biomass-related properties of alfalfa according to claim 5, characterized in that: KFZBJ_24 markers were used to screen for plants with the AG salt-tolerant allele at the NYL2 locus, and KFZBJ_25 markers were used to screen for plants with the GG salt-tolerant allele at the NYL1 locus.