Primer and probe for detecting BaEV gene in cell as well as detection method and application of primer and probe

Abstract

The invention belongs to the technical field of molecular biology, and mainly provides a primer and a probe for detecting BaEV genes in cells as well as a detection method and application of the primer and the probe. In particular to a primer composition for amplifying a Beav gene. The composition comprises a Beav-F2 primer with a nucleotide sequence of SEQ ID NO: 1 and a Beav-R2 primer with a nucleotide sequence of SEQ ID NO: 2. The kit can sensitively and accurately detect BaEV gene residues in HSC, NK, CAR-NK and resting T cells, can well evaluate the potential risk of RCL at a BaEV-LVs cell level, and can be used for industrial production.

Description

Technical Field

[0001] This invention belongs to the technical field of molecular biology, and in particular relates to primers and probes for detecting the BaEV gene in cells, as well as their detection methods and applications. Background Technology

[0002] Cell therapy technology has become a rapidly developing anti-tumor treatment technology in recent years due to its safety and wide applicability. However, in practical applications, cell therapy products using lentiviruses as vectors still pose certain safety risks. The main reason is that lentiviruses can still produce replicative viruses, i.e., replication-competent lentiviruses (RCLs). Given the potential dangers of RCLs, the CDE, FDA, EU, and NMPA have successively issued relevant documents requiring RCL control at different stages of production and application, including cell banks for virus production, terminal cells, viral vectors, and transduced cells.

[0003] There are two common choices for the envelope protein of lentiviral vectors. The first is the vesicular stomatitis virus envelope protein pseudotyped lentivirus (VSV-G-LVs), which is mainly used for T cell modification. The second is the baboon endogenous retrovirus (BaEV-LVs), which is mainly used for gene modification of difficult-to-transduct cells such as hematopoietic stem cells (HSCs), natural killer cells (NKs), and resting T cells.

[0004] Currently, there is considerable research on the potential dangers of recurrent clotting (RCL) at the cellular level in VSV-G-LVs, and many methods are available for reference. Patent CN118621064A provides a method for detecting RCL in BaEV enveloped lentivirus samples using a combination of traditional indicator cell culture and RT-QPCR. However, research on methods for detecting RCL at the cellular level in BaEV-LVs is scarce. Therefore, developing a method for detecting RCL at the cellular level in BaEV-LVs is a technical challenge for those in the field. Summary of the Invention

[0005] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a specific BaEV gene target, especially primers and probes targeting the BaEV gene, which can sensitively and accurately detect BaEV gene residues in HSC, NK, CAR-NK, and resting T cells, and effectively assess the potential danger of RCL at the cellular level of BaEV-LVs.

[0006] In a first aspect, this application provides a primer composition for amplifying the Beav gene, the composition comprising primers named Beav-F2 and Beav-R2, respectively; The nucleotide sequence of the Beav-F2 primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the Beav-R2 primer is shown in SEQ ID NO: 2.

[0007] On the other hand, this application provides a composition for detecting the Beav gene in a test sample, comprising the primer composition of claim 1 and the probe BaEV-P2, wherein the nucleotide sequence of the probe BaEV-P2 is shown in SEQ ID NO: 3.

[0008] On the other hand, this application provides a method for detecting BaEV gene residues in a test sample, the method comprising amplifying the test sample using any of the compositions or kits described above.

[0009] On the other hand, this application provides the use of the above-described composition and kit in detecting the Beav gene in test samples, for quality control, or for detecting cell therapy products.

[0010] The beneficial effects of this application are as follows: This application utilizes a specific BaEV gene target to sensitively and accurately detect BaEV gene remnants in HSCs, NK cells, CAR-NK cells, and resting T cells, effectively assessing the potential risk of RCL at the cellular level in BaEV-LVs. The amplification efficiency for BaEV gene remnant detection ranges from 85% to 110%, with R² ≥ 0.990, and the detection results are stable and reliable. This method has undergone methodological validation, demonstrating strong specificity, high accuracy, and good reproducibility. It can be used for quality studies, release testing, stability studies, and comparability studies of cell therapy products, and has broad market application prospects. Attached Figure Description

[0011] Figure 1 The image shows the amplification curve of the Beav gene primers and probes.

[0012] Figure 2 The image shows the standard curve for Beav gene detection. Detailed Implementation

[0013] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0014] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "an", "a" and "this" include the plural forms.

[0015] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0016] In a first aspect, this application provides a primer composition for amplifying the Beav gene, the composition comprising a Beav-F2 primer and a Beav-R2 primer; The nucleotide sequence of the Beav-F2 primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the Beav-R2 primer is shown in SEQ ID NO: 2.

[0017] On the other hand, this application provides a composition for detecting the Beav gene in a test sample, comprising the primer composition of claim 1 and the probe BaEV-P2, wherein the nucleotide sequence of the probe BaEV-P2 is shown in SEQ ID NO: 3.

[0018] In a specific embodiment, the 5' end of the probe BaEV-P2 is connected to a fluorescent group or a quenching group, and the 3' end of the probe BaEV-P2 is connected to a fluorescent group or a quenching group; in a specific embodiment, the 5' end of the probe BaEV-P2 is connected to a fluorescent group, and the 3' end of the probe BaEV-P2 is connected to a quenching group.

[0019] In a specific embodiment, the fluorescent group is selected from at least one of FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, Alexa Fluor series, BODIPY series, LCRED640, LCRED705, Quasar705, or TexasRed; in a specific embodiment, the fluorescent group is selected from FAM. In a specific embodiment, the quenching group is selected from at least one of TAMRA, BHQ1, BHQ2, BHQ3, MGB, and Dabcy1; preferably, the quenching group is selected from TAMRA.

[0020] In a specific embodiment, nucleotide A at position 1 of SEQ ID NO: 3 is attached to a fluorescent group, and nucleotide A at position 22 of SEQ ID NO: 3 is attached to a quenching group.

[0021] In specific embodiments, the test sample is selected from nucleic acid extracts or cell culture materials; in specific embodiments, the nucleic acid extract is prepared from animal cells; in specific embodiments, the animal cells include somatic cells, stem cells, and / or immune cells; in specific embodiments, the somatic cells include fibroblasts, keratinocytes, hepatocytes, pancreatic β cells, chondrocytes, cardiomyocytes, retinal pigment epithelial cells, and dopaminergic neurons; in specific embodiments, the immune cells include αβ T cells, γδ T cells, regulatory T cells, tumor-infiltrating lymphocytes, double-negative T cells, virus-specific T cells, dendritic cells, macrophages, cytokine-induced killer cells, lymphokine-activated killer cells, B lymphocytes, NK cells, constant NKT cells, CAR-NK cells, CAR-T cells, TCR-T cells, CAR-Macrophage, CAR-Treg cells, engineered DC cells, and / or resting T cells; in specific embodiments, the stem cells include embryonic stem cells, induced pluripotent stem cells, mesenchymal stem cells, and bone marrow mesenchymal stem cells. The cell culture medium includes adipose-derived mesenchymal stem cells, umbilical cord mesenchymal stem cells, dental pulp stem cells, placental mesenchymal stem cells, amniotic / chorionic mesenchymal stem cells, menstrual blood-derived mesenchymal stem cells, hematopoietic stem cells, neural stem cells, endothelial progenitor cells, cardiac stem cells, liver stem cells / progenitor cells, epidermal stem cells, and / or cancer stem cells. In a specific embodiment, the cell culture medium includes animal cells. In a specific embodiment, the cell culture medium further includes animal cell culture medium and animal cell metabolites. In a specific embodiment, the metabolites include primary metabolites and / or animal cell secondary metabolites.

[0022] In a specific embodiment, the mass ratio of the Beav-F2 primer to the Beav-R2 primer is 1:0.2-5; in a specific embodiment, the mass ratio is 1:1.

[0023] In a specific embodiment, the mass ratio of the Beav-F2 primer, the Beav-R2 primer, and the probe BaEV-P2 is 1:0.2-5:0.1-2.5; in a specific embodiment, the mass ratio is 2:2:1.

[0024] On the other hand, this application provides a kit for detecting the copy number of the Beav gene in a test sample, the kit comprising any of the compositions described above.

[0025] In a specific embodiment, the kit further includes a DNA polymerase; in a specific embodiment, the DNA polymerase includes any one or more of Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4, and Klenow.

[0026] In a specific embodiment, the kit further includes a PCR reaction solution; preferably, the PCR reaction solution contains dNTPs, Mg2+ solution and / or nuclease-free water.

[0027] In a specific embodiment, the kit further includes a Beav gene standard and / or an internal reference gene; in a specific embodiment, the concentration of the Beav gene in the Beav gene standard is 2E+06 to 20 copies / μL; in a specific embodiment, the concentration is 2E+06 copies / μL, 2E+05 copies / μL, 2E+04 copies / μL, 2E+03 copies / μL, 2E+02 copies / μL, and 20 copies / μL.

[0028] In a specific embodiment, the kit further includes a DNA extraction solution; in a specific embodiment, the DNA extraction solution includes SDS (sodium dodecyl sulfonate), NaCl (sodium chloride), Tris-HCl, EDTA (ethylenediaminetetraacetic acid), and / or DTT (dithiothreitol).

[0029] On the other hand, this application provides a method for detecting BaEV gene residues in a test sample, the method comprising amplifying the test sample using any of the compositions or kits described above.

[0030] In a specific embodiment, the method further includes the following steps: (1) Obtain the test sample; (2) Prepare the reaction system and perform qPCR; (3) Steps for assessing the residual status of BaEV gene in the test sample based on fluorescence signal: a. If two-thirds or more of the tested samples showed no amplification signal or the mean BaEV gene copy number of the tested samples was less than 10 copies / reaction, the BaEV gene test result was deemed negative. b. If the BaEV gene copy number is not less than 10 copies / reaction in two-thirds of the tested samples being evaluated, the BaEV gene test result is considered positive. In specific implementations, the PCR reaction amplification efficiency is effective at 85%–110%, with R² ≥ 0.99; otherwise, re-amplification is required.

[0031] In a specific implementation, the absence of amplified signal means the absence of a Ct value. The absence of Ct value is displayed as NA (Non-Amplified).

[0032] In a specific implementation, the absence of a Ct value indicates the absence of an amplified signal. The absence of an amplified signal means that the Ct value is displayed as NA.

[0033] In a specific implementation, the number of test samples being evaluated is 3n, where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0034] In a specific implementation, the method further includes step c. If the BaEV gene test result is positive, then the parallel sample or backup sample of the test sample is evaluated using steps a and / or b, and the result of this evaluation is taken as the final result.

[0035] In a specific implementation, the backup sample to be tested is a backup of the sample to be tested.

[0036] In a specific implementation, the test sample is prepared from the sample to be tested.

[0037] In a specific implementation, the backup test sample is prepared from the backup test sample.

[0038] In a specific implementation, the method for preparing the test sample or backup test sample includes the following steps: 1) collecting cells; in a specific implementation, the method further includes 2) mixing the cells with DNA extraction solution; In specific implementation, the method further includes 3) obtaining DNA; In practice, the method further includes 4) purifying the DNA.

[0039] In specific implementation, the method for preparing the test sample or backup test sample includes the following steps: 1) collecting cells; 2) obtaining DNA.

[0040] In specific implementation, the preparation method of the test sample or backup test sample includes the following steps: 1) mixing cells with DNA extraction solution, 2) obtaining DNA.

[0041] In specific implementation, the preparation method of the test sample or backup test sample includes the following steps: 1) collecting cells; 2) mixing cells with DNA extraction solution; 3) obtaining DNA.

[0042] In a specific embodiment, the cells are collected by centrifugation. The centrifugation speed can be 400-600g, and the centrifugation time can be 4-6 minutes. For example, the centrifugation speed can be 400g, 450g, 500g, 550g, or 600g, and the centrifugation time can be 4min, 4.5min, 5min, 5.5min, or 6min.

[0043] In a specific embodiment, the DNA extraction solution includes SDS (sodium dodecyl sulfonate), NaCl (sodium chloride), Tris-HCl, EDTA (ethylenediaminetetraacetic acid), and DTT (dithiothreitol).

[0044] In a specific implementation, the above method includes assessing the residual status of the BaEV gene by comparing the detection results of the amplified BaEV gene with the detection limit.

[0045] In a specific embodiment, the amplification includes PCR. In a specific embodiment, the PCR includes conventional PCR, quantitative real-time PCR, reverse transcription PCR, nested PCR, multiplex PCR, and digital PCR. In a specific embodiment, the PCR includes quantitative real-time PCR. In a specific embodiment, the PCR amplification program includes the following: pre-denaturation: 95-98℃, 35 min; denaturation: 95-98℃, 15-30 s, 40-50 cycles; annealing and extension: 60-65℃, 60-65 s, 40-50 cycles.

[0046] In a specific embodiment, the test sample is selected from nucleic acid extracts or cell culture materials; in a specific embodiment, the nucleic acid extract is prepared from animal cells; in a specific embodiment, the animal cells include somatic cells, stem cells, and / or immune cells; in a specific embodiment, the somatic cells include fibroblasts, keratinocytes, hepatocytes, pancreatic β cells, chondrocytes, cardiomyocytes, retinal pigment epithelial cells, and dopaminergic neurons; in a specific embodiment, the immune cells include αβ T cells and γδ T cells. T cells, regulatory T cells, tumor-infiltrating lymphocytes, double-negative T cells, virus-specific T cells, dendritic cells, macrophages, cytokine-induced killer cells, lymphokine-activated killer cells, B lymphocytes, NK cells, constant NKT cells, CAR-NK cells, CAR-T cells, TCR-T cells, CAR-Macrophage, CAR-Treg cells, engineered DC cells, and / or resting T cells; in specific embodiments, the stem cells include embryonic stem cells, induced pluripotent stem cells, mesenchymal stem cells, bone marrow mesenchymal stem cells, adipose mesenchymal stem cells, and umbilical cord mesenchymal stem cells. The cell culture medium includes animal cells, dental pulp stem cells, placental mesenchymal stem cells, amniotic / chorionic mesenchymal stem cells, blood-derived mesenchymal stem cells, hematopoietic stem cells, neural stem cells, endothelial progenitor cells, cardiac stem cells, liver stem cells / progenitor cells, epidermal stem cells, and / or cancer stem cells. The nucleic acid extract contains impurities such as animal cell genomic DNA, RNA, and / or cell debris. In a specific embodiment, the cell culture medium includes animal cells. In a specific embodiment, the cell culture medium further includes animal cell culture medium and animal cell metabolites. In a specific embodiment, the metabolites include primary metabolites and / or animal cell secondary metabolites.

[0047] In a specific embodiment, the hematopoietic stem cells are cells that exist in the bone marrow and have the ability to self-renew and differentiate into all blood cells (including immune cells).

[0048] In a specific embodiment, the NK cells are natural killer cells.

[0049] In a specific embodiment, the CAR-NK cell is a cell in which a CAR (chimeric antigen receptor) is chimeric on the surface of an NK cell through genetic engineering technology.

[0050] In a specific embodiment, the resting T cells are mature T cells that have not yet been activated by a specific antigen. In a specific implementation, the animal cells include HSC cells, NK cells, CAR-NK cells, and / or resting T cells.

[0051] On the other hand, this application provides the use of the above-described composition and kit in detecting the Beav gene in test samples, for quality control, or for detecting cell therapy products.

[0052] In specific implementations, the method also includes amplifying the BaEV gene by polymerase chain reaction (PCR), quantitative real-time polymerase chain reaction (qPCR), reverse transcriptase-polymerase chain reaction (RT-PCR), real-time reverse transcriptase-polymerase chain reaction (rt RT-PCR), ligase chain reaction, or transcription-mediated amplification (TMA).

[0053] In specific implementation, the amplification program includes: pre-denaturation: 95-98℃, 35min; denaturation: 95-98℃, 15-30s, 40-50 cycles; annealing and extension: 60-65℃, 60-65s, 40-50 cycles.

[0054] In specific implementation, the amplification reaction system is as follows: the concentration of Beav-F2 is 0.1-0.5 μM, the concentration of Beav-R2 is 0.1-0.5 μM, and the concentration of probe BaEV-P2 is 0.1-0.5 μM.

[0055] In a specific implementation, the extraction method includes the following steps: 1) collecting cells; 2) mixing cells with DNA extraction solution; 3) obtaining DNA; and 4) purifying the DNA.

[0056] In a specific embodiment, the cells are collected by centrifugation. The centrifugation speed can be 400-600g, and the centrifugation time can be 4-6 minutes. For example, the centrifugation speed can be 400g, 450g, 500g, 550g, or 600g, and the centrifugation time can be 4min, 4.5min, 5min, 5.5min, or 6min.

[0057] In a specific embodiment, the DNA extraction solution includes SDS (sodium dodecyl sulfonate), NaCl (sodium chloride), Tris-HCl, EDTA (ethylenediaminetetraacetic acid), and DTT (dithiothreitol).

[0058] In a specific implementation, the following components are used: 0.3-0.5 μL of the upstream primer for amplifying the BaEV gene, 0.3-0.5 μL of the downstream primer for amplifying the BaEV gene, 0.1-0.3 μL of the probe for amplifying the BaEV gene, 0.3-0.5 μL of the upstream primer for amplifying the ABL gene, 8-10 μL of PCR reaction premix (2× qPCR Reaction Buffer), and 3-5 μL of enzyme-free deionized water (RNase-Free Water).

[0059] In a specific embodiment, the amplification reaction system is as follows: 0.3-0.5 μL of upstream primer for amplifying the BaEV gene, 0.3-0.5 μL of downstream primer for amplifying the BaEV gene, 0.1-0.3 μL of probe for amplifying the BaEV gene, 10 μL of PCR reaction premix (2× qPCR Reaction Buffer), and RNase-free deionized water to a final volume of 15 μL.

[0060] In a specific implementation, the detection limit of the method is 10 copies / 15 μL.

[0061] In a specific implementation, the method further includes a system suitability determination: If the coefficient of variation (CV%) of Ct values ​​among the three parallel wells is ≤5% (except for wells with Ct values ​​greater than 35), the blank NTC has no Ct value or the Ct value of the blank NTC is at least two Ct values ​​greater than the lowest concentration of the standard curve, and the negative control NCS has no Ct value or the negative control NCS has a Ct value greater than the lowest concentration of the standard curve, then the system detection is valid.

[0062] If the coefficient of variation (CV%) of the Ct value among the three parallel wells is greater than 5% (except for wells with Ct values ​​greater than 35), the blank NTC has a Ct value, or the Ct value of the blank NTC is less than or equal to the two Ct values ​​of the lowest concentration of the standard curve, or the negative control NCS has a Ct value, or the negative control NCSC has a Ct value less than or equal to the Ct value of the lowest concentration of the standard curve, then the system detection is invalid.

[0063] In a specific implementation, the number of parallel holes is 3.

[0064] In a specific implementation, the amplification efficiency of the PCR reaction is 85%–110%, with R² ≥ 0.99.

[0065] (I) Definitions and Explanations To facilitate understanding of this disclosure, certain technical and scientific terms are specifically defined below. In this disclosure, unless otherwise stated, the scientific and technical terms used have meanings commonly understood by those skilled in the art. It should be understood that this disclosure is not limited to specific methods, reagents, compounds, compositions, or biological systems, and variations thereof are certainly possible. Furthermore, the molecular biology, cell and tissue culture, microbiology, and immunology-related terms and laboratory procedures used in this disclosure are widely used terms and routine procedures in their respective fields. It should also be understood that the terminology used in this disclosure is for the purpose of describing specific embodiments only and is not intended to be limiting.

[0066] All publications and patents mentioned in this disclosure are incorporated herein by reference in their entirety. In the event of any conflict between the use or terminology used in any publications and patents incorporated by reference and that used in this disclosure, the use and terminology of this disclosure shall prevail. Section headings used in this disclosure are for organizational purposes only and should not be construed as limiting the subject matter.

[0067] In this disclosure, the conjunction term “and / or” between multiple elements means to include both the meaning of “and” and “or”, for example, the phrase “A, B and / or C” is intended to cover each of the following: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0068] In this disclosure, the terms “comprising” or “including” generally mean including the expressly specified features, but not excluding other elements.

[0069] In this disclosure, the term "about" generally refers to a variation within a range of 0.5% to 10% above or below a specified value, such as a variation within a range of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value.

[0070] In this disclosure, the term "amplification reaction" refers to any in vitro method used to amplify or increase the copy of a target sequence, mainly including two categories: temperature-dependent amplification reactions and isothermal amplification reactions. Temperature-dependent amplification reactions mainly include polymerase chain reaction (PCR) and ligase chain reaction (LCR), while isothermal amplification reactions include strand displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated amplification (LAMP), helicase-dependent isothermal DNA amplification (HDA), nucleic acid sequence-based amplification (NASBA), and transcription-dependent amplification systems (TAS). Preferably, the amplification reaction is polymerase chain reaction (PCR). In this disclosure, the term "polymerase chain reaction (PCR)" refers to a method for preparing nucleic acids (e.g., target sequences) and amplifying or increasing their copy number by using multiple cycles of denaturation (separation of template DNA double strands), annealing (hybridization of single-stranded oligonucleotides with single-stranded template DNA strands), and DNA synthesis (DNA polymerase catalyzes the synthesis of new DNA strands initiated from the 3' end of hybridized oligonucleotides using the template DNA strand as a template).

[0071] In this disclosure, "backup sample" refers to an untreated or treated but not fully consumed sample from the same batch that is additionally retained during sampling or experimentation. Specifically, in this application, it may refer to an additional sample drawn from the same batch, sealed and preserved, and not processed or only partially processed. In this application, the backup sample is a portion of the test sample or a portion isolated from the test sample. In a specific embodiment, the test sample is selected from nucleic acid extracts or cell culture materials. In a specific embodiment, the nucleic acid extract is prepared from animal cells; in a specific embodiment, the animal cells include somatic cells, stem cells, and / or immune cells; in a specific embodiment, the somatic cells include fibroblasts, keratinocytes, hepatocytes, pancreatic β cells, chondrocytes, cardiomyocytes, retinal pigment epithelial cells, and dopaminergic neurons; in a specific embodiment, the immune cells include αβ T cells, γδ T cells, and γδ T cells. T cells, regulatory T cells, tumor-infiltrating lymphocytes, double-negative T cells, virus-specific T cells, dendritic cells, macrophages, cytokine-induced killer cells, lymphokine-activated killer cells, B lymphocytes, NK cells, constant NKT cells, CAR-NK cells, CAR-T cells, TCR-T cells, CAR-Macrophage, CAR-Treg cells, engineered DC cells, and / or resting T cells; in specific embodiments, the stem cells include embryonic stem cells, induced pluripotent stem cells, mesenchymal stem cells, bone marrow mesenchymal stem cells, adipose mesenchymal stem cells, and umbilical cord mesenchymal stem cells. The cell culture medium includes animal cells, dental pulp stem cells, placental mesenchymal stem cells, amniotic / chorionic mesenchymal stem cells, blood-derived mesenchymal stem cells, hematopoietic stem cells, neural stem cells, endothelial progenitor cells, cardiac stem cells, liver stem cells / progenitor cells, epidermal stem cells, and / or cancer stem cells. The nucleic acid extract contains impurities such as animal cell genomic DNA, RNA, and / or cell debris. In a specific embodiment, the cell culture medium includes animal cells. In a specific embodiment, the cell culture medium further includes animal cell culture medium and animal cell metabolites. In a specific embodiment, the metabolites include primary metabolites and / or animal cell secondary metabolites.

[0072] In this disclosure, "parallel samples" refers to a group of samples that have been independently and repeatedly measured under the same conditions. In this application, both the "test sample" and "parallel samples" are extracted from the same sample, but the extraction processes are independent. In specific embodiments, the sample includes animal cells. In specific embodiments, the animal cells include somatic cells, stem cells, and / or immune cells; in specific embodiments, the somatic cells include fibroblasts, keratinocytes, hepatocytes, pancreatic β cells, chondrocytes, cardiomyocytes, retinal pigment epithelial cells, and dopaminergic neurons; in specific embodiments, the immune cells include αβ T cells and γδ T cells. T cells, regulatory T cells, tumor-infiltrating lymphocytes, double-negative T cells, virus-specific T cells, dendritic cells, macrophages, cytokine-induced killer cells, lymphokine-activated killer cells, B lymphocytes, NK cells, constant NKT cells, CAR-NK cells, CAR-T cells, TCR-T cells, CAR-Macrophage, CAR-Treg cells, engineered DC cells, and / or resting T cells; in specific embodiments, the stem cells include embryonic stem cells, induced pluripotent stem cells, mesenchymal stem cells, bone marrow mesenchymal stem cells, adipose mesenchymal stem cells, and umbilical cord mesenchymal stem cells. The cell culture medium includes animal cells, dental pulp stem cells, placental mesenchymal stem cells, amniotic / chorionic mesenchymal stem cells, blood-derived mesenchymal stem cells, hematopoietic stem cells, neural stem cells, endothelial progenitor cells, cardiac stem cells, liver stem cells / progenitor cells, epidermal stem cells, and / or cancer stem cells. The nucleic acid extract contains impurities such as animal cell genomic DNA, RNA, and / or cell debris. In a specific embodiment, the cell culture medium includes animal cells. In a specific embodiment, the cell culture medium further includes animal cell culture medium and animal cell metabolites. In a specific embodiment, the metabolites include primary metabolites and / or animal cell secondary metabolites.

[0073] In this disclosure, the term "cycle" refers to a single round of: step 1, denaturation: the template DNA strand is unwound; step 2, annealing: the primer is hybridized to the single-stranded DNA obtained in step 1 according to the rules of base pairing; and step 3, amplification: a new DNA strand is synthesized from the 3' end of the primer in a 5'-to-3' direction. Typically, polymerization uses a DNA polymerase (e.g., Taq polymerase) to catalyze the formation of phosphodiester bonds between adjacent deoxynucleotide triphosphates ("dNTPs"), which are then positioned along the exposed single-stranded template DNA via hydrogen bonds according to the rules of base pairing. The denaturation and annealing temperatures, as well as the ionic strength of the reaction buffer, control the stringency of hybridization and the fidelity of DNA replication. For the amplification reaction, at least two different primers are used in PCR: a "forward primer" hybridizes with the antisense strand of the target sequence to form the 5' end of the newly synthesized sense strand, and a "reverse primer" hybridizes with the sense strand of the target sequence during amplification to form the 5' end of the newly synthesized antisense strand. In each cycle, the two template strands of the target sequence are each replicated to form a new double-stranded DNA molecule, called an "amplifier". In this disclosure, the PCR includes conventional PCR as well as amplification reactions based on PCR principles, such as quantitative real-time PCR (qPCR), reverse transcription PCR (RT-PCR), nested PCR, multiplex PCR, and digital PCR (dPCR). qPCR is used as an example in this specific embodiment, but it is not the only instance.

[0074] In this disclosure, the term "quantitative real-time PCR (qPCR)" refers to a type of PCR that monitors amplicon formation during PCR cycling. qPCR can be used to quantify the amount of a specific template DNA in a sample to be tested. In addition to forward and reverse primers, qPCR also introduces at least one probe (detection probe) into the reaction mixture.

[0075] In this disclosure, the term "probe" generally refers to a combination of a fluorophore and a quencher. In most cases, the fluorophore is attached to or near the 5' end of the oligonucleotide, and the quencher is attached to or near the 3' end of the oligonucleotide. However, any feasible configuration may be used in the practice of this invention. When the probe is intact, the fluorophore and quencher are close together, such that the quencher absorbs light emitted by the excited fluorophore, thereby significantly reducing detectable fluorophore emission. When the probe is cleaved or degraded, the fluorophore and quencher are released and thus spatially separated. The quencher is no longer sufficient to quench the fluorescence emission of the fluorophore. A probe is a single-stranded oligonucleotide that hybridizes to the sense or antisense strand of a target sequence somewhere between a forward primer binding site and a reverse primer binding site. During the annealing step, the probe anneals to the single-stranded template. When polymerization occurs, the probe is cleaved and degraded by the 5' nuclease activity of a DNA polymerase. As more amplicones are formed, more probes are cleaved, more fluorophores and quenchers are released, resulting in more fluorophore / quencher pairs being separated and an increase in fluorescence emission amplitude. The fluorescent groups include, for example: FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, Alexa Fluor series, BODIPY series, LCRED640, LCRED705, Quasar705, or TexasRed; the quenching groups include, for example: TAMRA, BHQ1, BHQ2, BHQ3, MGB, or Dabcy1. In specific embodiments, FAM and BHQ1 are used together.

[0076] In this disclosure, the term "specific detection" refers to the fact that the probe detects the target sequence at a statistically significant level compared to the non-target sequence. For example, primers and probes that specifically amplify and detect the target sequence produce Cq values ​​that are easily distinguishable from non-target sequences, such as Cq values ​​that are at least 2, 3, 4, 5, 5-10, 10-20, or 10-30 cycles higher than those for non-target sequences.

[0077] In this disclosure, the terms "Cq value (Cycle Quantification)" or "Ct value (Cycle Threshold)" refer to the cycle number corresponding to when the fluorescence signal intensity reaches a set threshold in a qPCR reaction. Preferably, a cq value ≤ 40 is considered a positive result, indicating the presence of the target sequence in the test sample and at least 10⁻⁶ ng / μL of *Neptunus* nucleic acid; otherwise, it is considered negative.

[0078] In this disclosure, the term "target sequence" refers to a nucleic acid sequence for which amplification or increased copy is desired, and in particular, to a specific nucleic acid sequence in *Novoidea*, and more specifically, to the nucleic acid sequence between the upstream and downstream primers as shown in SEQ ID NO: 1-2.

[0079] In this disclosure, the aforementioned kit may further include a positive control (Beav gene) and / or a negative control (containing no Beav gene, such as sterile double-distilled water or sterile deionized water).

[0080] In this disclosure, the aforementioned primer pairs and primer-probe combinations may be supplied in solid (e.g., lyophilized) or liquid form. In one embodiment, the primers, probes, and other reagents are lyophilized.

[0081] The primer pairs, primer-probe combinations, and various components of the kit of this invention can optionally be contained in different containers (e.g., vials, ampoules, test tubes, flasks, or bottles). Each component is generally suitably aliquoted into its respective container or provided in concentrated form. Other containers suitable for certain steps of amplification / detection may also be provided.

[0082] The present application will be further illustrated by the following examples, but these examples do not limit the scope of the application. Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques have been well described in existing literature.

[0083] Example 1: Screening of primers and probes for specific amplification of the BaEV gene The aim was to establish a suitable method for detecting the BaEV gene copy number and to screen primers and probes for detection.

[0084] Materials and Instruments Equipment and consumables The main equipment is shown in Table 11.

[0085] Table 11 Main Equipment

[0086] The main reagents and consumables are shown in Table 12.

[0087] Table 12 Main Reagents and Consumables

[0088] The primer and probe information is shown in Table 13.

[0089] Table 13 Primer and probe information used

[0090] Note: F represents the upstream primer, R represents the downstream primer, and P represents the probe.

[0091] The probe BaEV-P2 is modified at the site of SEQ ID NO: 3 (AGGGCCTCCCGCCATCGGACCA). Starting from the 5' end, the first base A is labeled with a FAM fluorescent group. FAM undergoes an amidation reaction between its carboxyl group and the amino group on the first base A, forming a stable amide bond. The 22nd base A is labeled with a TAMRA quencher group. The TAMRA carboxyl group undergoes an amidation reaction with the amino group on the 22nd base A, forming a stable amide bond. In specific embodiments, the fluorescent group may also be selected from at least one of FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LCRED640, LCRED705, Quasar705, or TexasRed; the quencher group may also be selected from at least one of TAMRA, BHQ1, BHQ2, BHQ3, MGB, or Dabcy1. The quencher group can quench the fluorescence of the fluorescent group.

[0092] The sources of the standard products are shown in Table 14.

[0093] Table 14 Sources of Standards

[0094] Note: The BaEV plasmid contains the BaEV gene. The BaEV plasmid is 3000 bp in total. The BaEV gene sequence is shown in SEQ ID NO: 25.

[0095]

[0096] Development content of detection and analysis methods: BaEV linear standard preparation Standard linearization processing The plasmids were digested with enzymes under the following conditions, and the system is shown in Table 15: Table 15

[0097] The enzyme-digested samples were incubated at 65°C for 15 minutes to inactivate the restriction enzymes.

[0098] Two μl of the processed plasmid was taken and subjected to electrophoresis. The electrophoresis showed only one single band.

[0099] The concentration and purity of the processed plasmid were detected using an ultra-micro UV spectrophotometer, and the conversion between plasmid concentration and copy number was performed according to the following formula: (6.02×10²³)×(ng / μL×10⁻ 9 (DNA length × 660) = copies / μL Based on the copy number calculation, the plasmid was diluted to a concentration of 2E+08 copies / μl, and BaEV quantitative standards were dispensed in 15μl vials. The packaged standards were then stored in a freezer at -80°C for later use.

[0100] Dilution gradient of standard: Take one vial of BaEV quantitative standard with a concentration of 2E+08 copies / μl and DNA diluent (manufacturer: Shanghai Sangon Biotech, catalog number: B639270-0010), and thaw them in a 4℃ refrigerator. After complete thawing, place the vial on a vortex mixer set to speed 6 and vortex for 10 seconds. Centrifuge at 6000 rpm for 5 seconds in a multi-rotor centrifuge. Serially dilute the BaEV quantitative reference standard with DNA diluent. Take seven clean 1.5mL centrifuge tubes and label them STD0, STD1, STD2, STD3, STD4, STD5, and STD6 respectively (all standard dilutions are performed by pipetting and mixing, continuously pipetting at a constant speed for 20 times), as shown in Table 16.

[0101] Table 16

[0102] Preparation of cell DNA solution: CAR-NK cells were extracted (purchased from Shanghai Sangon Biotech, catalog number: B639270-0010), and the DNA concentration was adjusted to 100 ng / μL to obtain cell DNA solution.

[0103] Preparation of accompanying quality control samples: Spiked recovery sample (ERC): Take 10 μl of cell DNA solution, add 10 μl of STD3, and mix well; Template-free control (NTC): Take 100 μl of DNA dilution buffer.

[0104] When performing qPCR experiments, first prepare 8-tube PCR sets and add 15 μl of qPCR reaction mixture (MIX) to each well. Next, add 5 μl of standard curve sample (STD1 to STD6), template-free control (NTC), test solution, and internal control (ERC) to each well sequentially, ensuring thorough mixing. Each sample should be repeated in triplicate to improve experimental reliability. Notes: 1. Calculate the total amount of Mix mixture required based on the number of reaction wells: Mix mixture = (number of reaction wells + 2) × (10 + 1 + 4) μL (including loss from 2 wells). 2. After adding samples and sealing the tubes, centrifuge at low speed for 10 s to collect the liquid from the tube wall to the bottom. Then, vortex to mix for at least 5 s to completely mix the reaction solution. Centrifuge at low speed for 10 s again to collect the liquid from the tube wall to the bottom. If there are air bubbles, remove them. The specific components are shown in Table 17.

[0105] Table 17

[0106] The PCR reaction program settings are as follows:

[0107] (1) Start the "Bio-RAD CFX Manager" software, set the amplification program, and set the reaction volume to 20 μl: Table 18

[0108] (2) Set up the sample plate; create a new detection probe, name it BaEV-DNA, select the reporter fluorescent group as "FAM" and the quencher fluorescent group as "none". Edit the information of the standard, NTC, test sample or sample ERC according to the placement of the PCR eight-tube tube. Save the sample plate file to the target folder. The plate layout diagram can be referred to Table 19. (1) Start the "Bio-RAD CFXManager" software, set the amplification program, and set the reaction volume to 20μl:

[0109] (2) Set up the sample plate; create a new detection probe, named BaEV-DNA, and select "FAM" as the reporter fluorescent group and "none" as the quencher fluorescent group. Edit the information for the standards, NTC, test samples, or sample ERC according to the placement of the PCR eight-tube strip. Save the sample plate file to the target folder. The plate layout diagram can be found in Table 19.

[0110] Table 19

[0111] Note: STD1-STD6 are test standards, S1-S3 are DNA samples to be tested, NTC is DNA diluent, and ERC is spiked and recovered sample.

[0112] (3) Start the PCR program: After selecting the “BaEV-DNA” program and sample plate, click “Start Run”, save the result file to the target folder, and start the PCR reaction.

[0113] Data processing: After the reaction is complete, the instrument will automatically set the baseline and threshold. Save and export the results.

[0114] If abnormal data or unexpected situations occur during the testing process, such as tube leakage, sample evaporation, or incorrect sample addition, the resulting data should be deleted, and the reason should be explained in the testing record. Other normal data can continue to be used in the calculation of the test results.

[0115] Using Excel to calculate results: Import the test data directly exported from the instrument into a pre-designed test result analysis table, calculate the final result, and attach the calculated Excel table to the test record. The final test result is retained to two decimal places.

[0116] Primer and probe test results Amplification efficiency formula: Amplification efficiency (E) = [10^(-1 / slope) - 1] × 100%; The "slope" in the formula refers to the slope of the regression line of the standard curve.

[0117] R² formula: R² = 1 - (SS_res / SS_tot); SS_res: residual sum of squares, i.e., the sum of squares of the vertical distances of each data point from the regression line. SS_tot: total sum of squares, i.e., the sum of squares of the distances of each data point from its mean.

[0118] System suitability testing of primers and probes: Table 20: Primer and probe system suitability test

[0119] Preparation of cellular DNA samples: CAR-NK cells were extracted (purchased from Shanghai Sangon Biotech, catalog number: B639270-0010), and the DNA concentration was adjusted to 100 ng / μL to obtain cellular DNA samples.

[0120] Primer and probe detection and recovery rate test: The formula for detection recovery rate is: Detection recovery rate = Actual detection concentration / Theoretical concentration * 100%.

[0121] High-concentration spiking: Take 20 μL of cell DNA sample (concentration 100 ng / μL) + 20 μL of STD1 sample (concentration 2E6 copies / μL) as the high-concentration spiking sample.

[0122] Medium concentration spiking: Take 20 μL of cell DNA sample (concentration 100 ng / μL) + 20 μL of STD3 sample (concentration 2E4 copies / μL) as high concentration spiking sample.

[0123] Low-concentration spiking: Take 20 μL of cell DNA sample (concentration 100 ng / μL) + 20 μL of STD5 sample (concentration 2E2 copies / μL) as the high-concentration spiking sample.

[0124] Table 21: Primer and probe detection recovery rate test

[0125] Primer and probe test results:

[0126] The amplification curves of the Beav gene primers and probes are as follows: Figure 1 As shown, the standard curve for Beav gene detection is as follows: Figure 2 As shown in Tables 20 and 21, the primer and probe design of combination 2 meets the requirements in five aspects: amplification efficiency, R², blank control, amplification curve, and detection recovery rate. Therefore, the primer and probe combination of combination 2 is selected as the BaEV gene copy number detection method.

[0127] Example 2 BaEV gene copy detection 1. Sample extraction (1) Sample pretreatment: 1.5E6 CAR-NK cells (purchased from Shanghai Sangon Biotech, catalog number: B639270-0010) suspension was placed in a 1.5 mL centrifuge tube and centrifuged at 500 g for 5 minutes at room temperature. The supernatant was discarded by pipette. The cell pellet was resuspended in 1 mL PBS and centrifuged at 500 g for 5 minutes at room temperature. The supernatant was discarded by pipette, and the cell pellet was retained. 200 μL of PBS was added. A new 1.5 mL centrifuge tube was prepared and 200 μL of PBS was added as a negative control.

[0128] (2) Turn on the metal bath and set the temperature to 55°C for preheating.

[0129] (3) Add 10 μL of proteinase K and 230 μL of lysis buffer to the sample tube, place it on a vortex mixer set to level 6 and shake for 10 seconds, then centrifuge at 6000 rpm for 5 seconds in a compound rotor centrifuge, and incubate the sample tube at 55°C for 15 minutes.

[0130] (4) After incubation, take it out and centrifuge briefly. After cooling, add 320 μL of isopropanol and 20 μL of magnetic bead suspension, place it on a mini mixer, adjust it to the maximum setting, and shake for 10 minutes.

[0131] (5) After the vortex oscillation ends, centrifuge the centrifuge tube at 13000 g for 30 seconds, then place the centrifuge tube on a magnetic separator for 5 minutes, remove the supernatant with a pipette and remove the centrifuge tube.

[0132] (6) Add 600 μL of washing solution I, place it on a mini mixer, adjust it to the maximum setting, shake for 1 minute to fully resuspend the magnetic beads, then place the centrifuge tube on a magnetic separator for 2 minutes until the solution is clear, remove the supernatant and remove the centrifuge tube, and repeat this step once.

[0133] (7) Add 600 μL of 80% ethanol, place it on a mini mixer, adjust it to the maximum setting, shake for 1 minute to fully resuspend the magnetic beads, place the centrifuge tube on a magnetic separator for 2 minutes until the solution is clear, remove the supernatant and remove the centrifuge tube, and repeat this step once.

[0134] (8) After centrifuging at 6000 rpm for 10 seconds in a composite rotor centrifuge, place the centrifuge tube on a magnetic separator for 2 minutes and carefully remove the washing liquid residue using a 10 μL pipette.

[0135] (9) Keep the centrifuge tube on the magnetic separator and let it stand at room temperature for 10 minutes until the surface of the magnetic bead has no obvious luster. Then remove the centrifuge tube.

[0136] (10) Add 100 μL of elution buffer and place on a vortex mixer set to speed 6 and vortex for 10 seconds to fully resuspend the magnetic beads. Then incubate at 55°C for 5 minutes, centrifuge at 12000g for 1 minute, place the centrifuge tube on a magnetic separator for 5 minutes until the solution is clear, and transfer 90 μL of supernatant to a new 1.5 mL centrifuge tube. This is the purified genomic DNA.

[0137] (11) Use an ultra-micro UV spectrophotometer to detect the concentration and purity of DNA, and obtain the DNA sample to be tested. The DNA sample to be tested can be stored at -20℃ or immediately subjected to PCR experiment.

[0138] 2. Standard dilution (1) Take out the BaEV quantitative reference and DNA diluent (manufacturer: Shanghai Sangon, item number: B639270-0010) and place them in a 4℃ refrigerator to thaw. After thawing completely, place them on a vortex mixer set to level 6 and shake for 10 seconds. Centrifuge at 6000 rpm for 5 seconds in a composite rotor centrifuge. Use DNA diluent to serially dilute the BaEV quantitative reference.

[0139] Take seven clean 1.5 mL centrifuge tubes and label them STD0, STD1, STD2, STD3, STD4, STD5, and STD6, ​​respectively. The standard dilution procedure is shown in the table below. Table 1 Standard Dilution Process

[0140] (2) Preparation of NTC: 100 μL DNA dilution buffer;

[0141] (3) Preparation of NCS: Take 100 μL of DNA diluent with the sample and pre-treat the sample using the “1. Sample Extraction” step in Example 2.

[0142] 3. Sample dilution (1) Dilute the DNA sample prepared above to 100 ng / μL for RCL detection. (If the concentration of the sample to be tested is less than 200 ng / μL, take the original sample solution for detection.) (2) Take 15 μL of diluted test sample and add 15 μL of STD3 standard as spiked recovery sample (ERC).

[0143] 4. Preparation of PCR reaction solution (1) Calculate the number of reaction wells required based on the number of samples to be tested and prepare the PCR reaction mix. The standard dilution and PCR reaction mix preparation should be completed separately in different clean benches to reduce cross-contamination.

[0144] (2) Calculate the required number of reaction wells based on the number of samples to be tested, and perform three replicate tests for each sample. Take an eight-tube PCR test tube, add 10 μL of 2X qPCR Reaction Buffer, 4.6 μL of BaEV Primer & Probe MIX, and 0.4 μL of LOX to each well, then add 5 μL of standard curve samples (STD1 / STD2 / STD3 / STD4 / STD5 / STD6), NTC, NCS, test solution, and ERC in sequence, and place on a vortex mixer set to speed 6 and shake for 10 seconds. Perform three replicate tests for each sample. Note: Calculate the total amount of Mix solution required for this test based on the number of reaction wells: Mix solution = (number of reaction wells + 2) × (10 + 4.6 + 0.4) μL (including the loss from 2 wells). Prepare the PCR mixture in a biosafety cabinet, as shown in Table 2: Table 2 PCR Reaction Solution Preparation Table

[0145] (3) The sample loading situation of each reaction well is shown in Table 3:

[0146] Table 3 Sample Addition List

[0147] (4) After adding the sample, put on the 8-piece cap. First put on the caps at both ends, then put on the middle cap, and make a mark on the edge of the cap.

[0148] (5) After the sample is added and the tube is sealed, centrifuge at 6000 rpm for 10 seconds in a compound rotor centrifuge to collect the liquid on the tube wall to the bottom of the tube. Then place it on a vortex mixer set to level 6 and shake for 10 seconds to completely mix the reaction solution. Then centrifuge at 6000 rpm for 10 seconds in a compound rotor centrifuge to collect the liquid on the tube wall to the bottom of the tube. If there are air bubbles, they need to be removed.

[0149] 5. PCR amplification (1) 5.10.1 Turn on the PCR instrument and set the PCR reaction program: set the two-step reaction program, 95℃ pre-denaturation for 2 minutes; 95℃ for 15 seconds, 60℃ for 30 seconds, 40 cycles, 20 μL reaction system; the reaction program is shown in Table 4.

[0150] Table 4 Reaction Procedure

[0151] (2) Setting up the sample reaction plate: Edit the information for standards, NTC, and test samples according to the PCR reaction solution addition positions. In the reaction plate chart, select the sample wells, select "Unknown" from the "Sample Type" dropdown menu, check "FAM" for fluorescence, name the "Target Name" as "BaEV", and enter the number of replicates and the Sample Name for each sample. Enter the number of replicates and the Sample Name for each dilution gradient. Also, assign values ​​of 2E+06, 2E+05, 2E+04, 2E+03, 2E+02, and 20 to the "Concentration" column of STD1, STD2, STD3, STD4, STD5, and STD6 respectively, and select the unit (copies / μL). (3) Open the heating lid, place the eight tubes according to the sample plate editing information, close the heating lid, start the PCR running program, and start the PCR reaction.

[0152] 5. Data Processing (1) After the reaction is complete, the instrument will automatically set the baseline and threshold. Save and export the results.

[0153] (2) Using Excel to calculate results: Substitute the test results directly exported by the instrument into the pre-designed test result analysis table to calculate the final test results, and attach the calculated Excel table to the test record.

[0154] (3) Calculation formula:

[0155] (4) Data save path: The save path is the original location where the data was generated.

[0156] (5) System applicability determination If the coefficient of variation (CV%) of Ct values ​​among the three parallel wells is ≤5% (except for wells with Ct values ​​greater than 35), the blank NTC has no Ct value or the Ct value of the blank NTC is at least two Ct values ​​greater than the lowest concentration of the standard curve, and the negative control NCS has no Ct value or the negative control NCS has a Ct value greater than the lowest concentration of the standard curve, then the system detection is valid.

[0157] If the coefficient of variation (CV%) of the Ct value among the three parallel wells is greater than 5% (except for wells with Ct values ​​greater than 35), the blank NTC has a Ct value, or the Ct value of the blank NTC is less than or equal to the two Ct values ​​of the lowest concentration of the standard curve, or the negative control NCS has a Ct value, or the negative control NCSC has a Ct value less than or equal to the Ct value of the lowest concentration of the standard curve, then the system detection is invalid.

[0158] The formula for calculating the coefficient of variation (CV) is: the standard deviation of the three parallel holes (SD) / the average value of the three parallel holes × 100%.

[0159] PCR amplification efficiency: 85%-110%, R² ≥ 0.99.

[0160] 6. Judgment Criteria (1) Negative determination criteria: If there is no amplification signal in all 3 parallel wells of the sample (Ct value is shown as NA), or if 2 of the 3 parallel wells of the sample have no Ct value and 1 well has a Ct value, or if the average BaEV gene copy number detection value of the detected well is less than 10 copies / reaction, the BaEV gene detection result is determined to be negative.

[0161] (2) Positive criteria: If two or more wells of the sample show amplification signals (Ct values ​​are present) and the number of BaEV gene copies in the detected wells is not less than 10 copies / reaction, the BaEV gene detection result is considered positive.

[0162] (3) When the test result of the sample is positive, the backup sample needs to be re-extracted and re-tested according to the above method. The test result is then judged again according to the retest data through the above steps (1) and (2), and the result of this judgment is the final result.

[0163] Example 3 Detection Limit of the Detection Method Preparation of BaEV solutions of different concentrations: Add 200 μL of STD6 (concentration 20 copies / μL) to 200 μL of 293T cell genomic DNA (50 ng / μL), vortex to mix, and obtain a BaEV solution with 50 copies / reaction.

[0164] Add 200 μL of BaEV solution with 50 copies / reaction to 200 μL of 293T cell genomic DNA (50 ng / μL), vortex to mix, and obtain BaEV solution with 25 copies / reaction.

[0165] Add 200 μL of BaEV solution with 25 copies / reaction to 300 μL of 293T cell genomic DNA (50 ng / μL), vortex to mix, and obtain BaEV solution with 10 copies / reaction.

[0166] Add 200 μL of 10 copies / reaction BaEV solution to 200 μL of 293T cell genomic DNA (50 ng / μL), vortex to mix, and obtain 5 copies / reaction BaEV solution.

[0167] Following the detection method in Example 2, the detection rate at each concentration point below the Baev limit of quantitation was determined to obtain the detection limit of the kit. The results showed that at concentrations of 10 copies / reaction and above, 21 copies were detected in 21 replicate wells (i.e., the detection rate was 100%), indicating that the detection limit of this kit can reach 10 copies / reaction. The results are shown in Table 5.

[0168] Table 5 Detection results of sample detection limits

[0169] Example 4: Specificity of the Detection Method Following the detection method in Example 2, three samples—E. coli cell genomic DNA, 293T cell genomic DNA, and CD19 CAR-T cell genomic DNA—were tested using the Baev gene copy number detection kit (qPCR-fluorescent probe method) (the specific method is shown in the example). The average Ct value measured in the FAM channel was greater than the minimum Ct value LLOQ+2 of the standard curve, meeting the specificity standard requirements. The results are shown in Table 6.

[0170] Table 6 Specificity Detection Results

[0171] Example 5: Accuracy of the detection method The following samples were tested according to the detection method of Example 2: 1) Preparation of sample A (high concentration solution): Dilute the standard to 2.00×105 copies / μl and mix with DNA diluent at a ratio of 1:1.

[0172] 2) Preparation of Sample B (medium concentration solution): Dilute the standard to 2.00×103 copies / μl and mix with DNA diluent at a 1:1 ratio.

[0173] 3) Preparation of sample C (low concentration solution): Dilute the standard to 2.00×102 copies / μl and mix with DNA diluent at a 1:1 ratio.

[0174] Samples A, B, and C were each prepared in triplicate and tested using the Baev gene copy number assay kit (qPCR-fluorescent probe method) (following the detection method in Example 2). The recovery rates of each sample were between 70% and 130%, meeting the accuracy requirements. The accuracy test results are shown in Table 7.

[0175] Table 7 Accuracy Test Results

[0176] Example 6 Repeatability of the detection method Following the method in Example 2, the Baev gene copy number of the standard was diluted to 50 copies / μl, and the test was repeated 12 times. The coefficient of variation of the test results was less than 15%. The repeatability test results are shown in Table 8.

[0177] Table 8 Repeatability test results

[0178] Following the method in Example 2, high, medium, and low concentrations were independently detected: 2 x 10 5 copies / μl, 2x10 3 The coefficients of variation for the nine data points obtained at copies / μl and 20 copies / μl were all less than 15%. The intermediate precision test results are shown in Table 9.

[0179] Table 9 Intermediate Precision Test Results

[0180] Following the method in Example 2, the Baev gene copy number detection kit was subjected to 3 freeze-thaw cycles and 5 freeze-thaw cycles, with 12 replicates performed to test the limit of quantitation (20 copies / μL) and the limit of detection (2 copies / μL). The performance of the kit was not affected.

[0181] Table 10 Stability Test Results

[0182] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in the present invention should still be covered by the claims of the present invention.

Claims

1. A primer composition for amplifying the Beav gene, characterized in that, The composition includes primers named Beav-F2 and Beav-R2, respectively. The nucleotide sequence of the Beav-F2 primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the Beav-R2 primer is shown in SEQ ID NO:

2.

2. A composition for detecting the Beav gene in a test sample, characterized in that, The invention comprises the primer composition of claim 1 and the probe BaEV-P2, wherein the nucleotide sequence of the probe BaEV-P2 is shown in SEQ ID NO:

3.

3. The composition according to claim 2, characterized in that, The probe BaEV-P2 has a fluorescent group or a quenching group attached to its 5' end, and a fluorescent group or a quenching group attached to its 3' end; preferably, the 5' end of BaEV-P2 has a fluorescent group attached, and the 3' end of the probe BaEV-P2 has a quenching group attached.

4. The composition according to claim 3, characterized in that, The fluorescent group is selected from at least one of FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, Alexa Fluor series, BODIPY series, LCRED640, LCRED705, Quasar705 or TexasRed; preferably, the fluorescent group is selected from FAM; And / or, the quenching group is selected from at least one of TAMRA, BHQ1, BHQ2, BHQ3, MGB, and Dabcy1; preferably, the quenching group is selected from TAMRA; And / or, the first nucleotide A of SEQ ID NO: 3 is attached to a fluorescent group, and the 22nd nucleotide A of SEQ ID NO: 3 is attached to a quenching group; And / or, the test sample is selected from nucleic acid extracts or cell culture materials; preferably, the nucleic acid extract is prepared from animal cells; more preferably, the animal cells include somatic cells, stem cells and / or immune cells; even more preferably, the somatic cells include fibroblasts, keratinocytes, hepatocytes, pancreatic β cells, chondrocytes, cardiomyocytes, retinal pigment epithelial cells, and dopaminergic neurons; even more preferably, the immune cells include αβ T cells, γδ T cells, regulatory T cells, tumor-infiltrating lymphocytes, double-negative T cells, virus-specific T cells, dendritic cells, macrophages, cytokine-induced killer cells, lymphokine-activated killer cells, B lymphocytes, NK cells, constant NKT cells, CAR-NK cells, CAR-T cells, TCR-T cells, CAR-Macrophage, CAR-Treg cells, engineered DC cells and / or resting T cells; even more preferably, the stem cells include embryonic stem cells, induced pluripotent stem cells, mesenchymal stem cells, and bone marrow mesenchymal stem cells. The cell culture medium includes cytoplasmic stem cells, adipose-derived mesenchymal stem cells, umbilical cord mesenchymal stem cells, dental pulp stem cells, placental mesenchymal stem cells, amniotic / chorionic mesenchymal stem cells, blood-derived mesenchymal stem cells, hematopoietic stem cells, neural stem cells, endothelial progenitor cells, cardiac stem cells, liver stem cells / progenitor cells, epidermal stem cells, and / or cancer stem cells; preferably, the cell culture medium includes animal cells; more preferably, the cell culture medium further includes animal cell culture medium and animal cell metabolites; even more preferably, the metabolites include primary metabolites and / or animal cell secondary metabolites; And / or, the mass ratio of the Beav-F2 primer to the Beav-R2 primer is 1:0.2-5; preferably, the mass ratio is 1:1; And / or, the mass ratio of the Beav-F2 primer, the Beav-R2 primer and the probe BaEV-P2 is 1:0.2-5:0.1-2.5; preferably, the mass ratio is 2:2:

1.

5. A test kit for detecting the copy number of the Beav gene in a test sample, characterized in that, The kit comprises the composition according to any one of claims 1-4.

6. The reagent kit as described in claim 5, characterized in that, The kit also includes a DNA polymerase; preferably, the DNA polymerase includes any one or more of Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4, and Klenow. And / or, the kit further includes a PCR reaction solution; preferably, the PCR reaction solution contains dNTPs, Mg2+ solution and / or nuclease-free water; And / or, the kit further includes a Beav gene standard and / or an internal reference gene; preferably, the concentration of the Beav gene in the Beav gene standard is 2E+06 to 20 copies / μL; preferably, the concentration is 2E+06 copies / μL, 2E+05 copies / μL, 2E+04 copies / μL, 2E+03 copies / μL, 2E+02 copies / μL and 20 copies / μL; And / or, the kit further includes a DNA extraction solution; preferably, the DNA extraction solution includes SDS (sodium dodecyl sulfonate), NaCl (sodium chloride), Tris-HCl, EDTA (ethylenediaminetetraacetic acid), and / or DTT (dithiothreitol).

7. A method for detecting BaEV gene residues in a test sample, characterized in that, The method includes the step of amplifying the test sample using the composition of any one of claims 1-4 or the kit of claim 5 or 6.

8. The method as described in claim 7, characterized in that, The method includes the following steps: (1) Obtain the test sample; (2) Prepare the reaction system and perform qPCR; (3) Steps for assessing the residual status of the BaEV gene in the test sample based on the fluorescence signal of the test sample being evaluated: a. If two-thirds or more of the tested samples showed no amplification signal or the mean BaEV gene copy number of the tested samples was less than 10 copies / reaction, the BaEV gene test result was deemed negative. b. If the BaEV gene copy number is not less than 10 copies / reaction in two-thirds of the tested samples being evaluated, the BaEV gene test result is considered positive. Preferably, the number of test samples being evaluated is 3n, where n is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; Preferably, the number of test samples being evaluated is the same as the number of test samples.

9. The method as described in claim 7 or 8, characterized in that, The method further includes step c. If the BaEV gene test result is positive, then the parallel samples of the test sample are evaluated using steps a and / or b, and the result of this evaluation is the final result. And / or, the amplification includes PCR, preferably, the PCR includes conventional PCR, quantitative real-time PCR, reverse transcription PCR, nested PCR, multiplex PCR, digital PCR; more preferably, the PCR includes quantitative real-time PCR; preferably, the PCR amplification program includes the following: pre-denaturation: 95-98℃, 35min; Denaturation: 95-98℃, 15-30s, 40-50 cycles; Annealing and extension: 60-65℃, 60-65s, 40-50 cycles; And / or, the test sample is selected from nucleic acid extracts or cell culture materials; preferably, the nucleic acid extract is prepared from animal cells; more preferably, the animal cells include somatic cells, stem cells and / or immune cells; even more preferably, the somatic cells include fibroblasts, keratinocytes, hepatocytes, pancreatic β cells, chondrocytes, cardiomyocytes, retinal pigment epithelial cells, and dopaminergic neurons; even more preferably, the immune cells include αβ T cells, γδ T cells, regulatory T cells, tumor-infiltrating lymphocytes, double-negative T cells, virus-specific T cells, dendritic cells, macrophages, cytokine-induced killer cells, lymphokine-activated killer cells, B lymphocytes, NK cells, constant NKT cells, CAR-NK cells, CAR-T cells, TCR-T cells, CAR-Macrophage, CAR-Treg cells, engineered DC cells and / or resting T cells; even more preferably, the stem cells include embryonic stem cells, induced pluripotent stem cells, mesenchymal stem cells, bone marrow mesenchymal stem cells, adipose mesenchymal stem cells, and umbilical cord mesenchymal stem cells. Cells, dental pulp stem cells, placental mesenchymal stem cells, amnion / chorionic mesenchymal stem cells, blood-derived mesenchymal stem cells, hematopoietic stem cells, neural stem cells, endothelial progenitor cells, cardiac stem cells, liver stem cells / progenitor cells, epidermal stem cells, and / or cancer stem cells; more preferably, the nucleic acid extract contains impurities such as animal cell genomic DNA, RNA, and / or cell debris; preferably, the cell culture material includes animal cells; more preferably, the cell culture material further includes animal cell culture medium and animal cell metabolites; even more preferably, the metabolites include primary metabolites and / or animal cell secondary metabolites.

10. Use of the compositions of claims 1-4, or the kits of claims 5 or 6, in the preparation of samples for detecting the Beav gene in test subjects, for quality control, or for the detection of cell therapy products.

Images