Rapid lysis solution for bacteria and detection method

Abstract

The invention relates to the technical field of microbiological detection, in particular to a rapid lysis solution for bacteria and a detection method. The lysate provided by the invention can rapidly and fully lyse bacteria, is wide in application range and convenient to use, can complete full lysis within 2 minutes, does not need nucleic acid extraction and / or purification process subsequently, does not inhibit subsequent PCR amplification, and is high in storage stability. In addition, the invention provides a method for rapidly detecting specific bacteria through fluorescent PCR, PCR amplification can be promoted by adding the lysate in a PCR reaction system, the detection sensitivity can be improved by adopting the internal control, and the method has a wide application prospect in the field of rapid detection of bacteria.

Description

Technical Field

[0001] This invention relates to the field of microbial detection technology, and in particular to a rapid bacterial lysis buffer and detection method. Background Technology

[0002] Bacteria are widely distributed in the human gut, mouth, vagina, and skin, and are closely related to human health. By detecting specific bacteria, we can identify potential pathogenic microorganisms, which helps to reveal related disease risks and provide scientific references for disease prevention and control; compare the impact of different individuals, different health conditions, or different treatment interventions on bacteria; and monitor the dynamic changes of bacteria during treatment, thereby assessing efficacy and developing individualized treatment strategies.

[0003] *Streptococcus mutans* (Sm) is a Gram-positive, facultative anaerobic spherical bacterium and the most prevalent pathogen causing dental caries in humans. Detecting *Streptococcus mutans* helps identify individuals at high risk for caries, enabling early intervention and personalized prevention. *Porphyromonas gingivalis* (Pg) is a Gram-negative, obligate anaerobic spherical bacillus, widely recognized as a key pathogen of chronic periodontitis. Detecting *Porphyromonas gingivalis* aids in the early detection and treatment of periodontal disease. *Fusobacterium nucleatum* (Fn) is a Gram-negative, obligate anaerobic fusible bacterium and a pivotal bacterium in the development of periodontal disease. Detecting *Fusobacterium nucleatum* allows for precise monitoring of its dynamic changes in the periodontal microecology, helping to assess the current activity and future risk of periodontitis.

[0004] Currently, the diagnosis of oral diseases still largely relies on visual observation and manual probing by dentists. Limited by individual experience, it is difficult to conduct timely, rapid, and objective assessments of early-stage periodontal disease, particularly those deep beneath the gum line, or the levels of Streptococcus mutans that cause tooth decay. Detection methods for specific bacteria currently include traditional culture methods, fluorescent PCR, and sequencing. Traditional culture methods are time-consuming and some bacteria are difficult to culture; various sequencing methods have long testing cycles and are expensive, making them unsuitable for rapid detection of specific bacteria. Therefore, rapid detection of specific bacteria based on fluorescent PCR is the optimal choice.

[0005] Conventional techniques require nucleic acid extraction from the sample before fluorescent PCR detection. However, existing techniques have significant shortcomings: Due to the diverse types and quantities of bacteria at the sampling sites, especially Gram-positive bacteria which have thicker peptidoglycan layers in their cell walls compared to Gram-negative bacteria, making them difficult to lyse, reagents with strong lysis capabilities can significantly inhibit PCR, leading to detection failure or false negatives. Therefore, nucleic acid purification is necessary before downstream detection. This nucleic acid extraction and purification process is time-consuming and labor-intensive, failing to achieve rapid detection. Furthermore, if the lysis buffer's lysis capability is weakened to allow direct PCR of the lysed crude extract, insufficient bacterial lysis in the sample may occur, resulting in false negatives or a lower-than-expected positive level.

[0006] Therefore, there is an urgent need for a lysis buffer that can rapidly and fully lyse bacteria, as well as a method for rapid detection of specific bacteria via fluorescent PCR. Summary of the Invention

[0007] In a first aspect, the present invention provides a lysis buffer comprising: lauroyl surfactant, guanidine hydrochloride, Tris-HCl buffer, and EDTA; wherein the concentration of guanidine hydrochloride in the lysis buffer is below 0.4 M.

[0008] The lysis buffer of this invention is specifically designed for efficient bacterial lysis, has a wide range of applications (it can target both Gram-positive and Gram-negative bacteria), is convenient (the lysis process does not require a dedicated vortex mixer, it can be done by manually inverting the container a few times), and can complete full lysis within 2 minutes, eliminating the need for subsequent nucleic acid extraction and / or purification processes.

[0009] Among them, the bidirectional agent guanidine hydrochloride in the lysis buffer, when the concentration is controlled below 0.4M, can both promote efficient bacterial lysis and PCR amplification, without significantly inhibiting PCR.

[0010] Preferably, the concentration of guanidine hydrochloride in the lysis solution is 0.1~0.4 M, more preferably 0.2 M~0.4 M.

[0011] Preferably, the concentration of lauroyl surfactant in the lysis buffer is 0.2%~0.8% w / v, the concentration of Tris-HCl buffer is 20~80 mM, and the concentration of EDTA is 1~5 mM.

[0012] Preferably, the lauroyl surfactant is at least one of sodium lauroyl glutamate, sodium lauroyl glycinate, sodium lauroyl alanine, sodium lauroyl aspartate, sodium lauroyl sarcosinate, sodium lauroyl methylaminopropionate, and sodium lauroyl oat amino acid.

[0013] More preferably, the concentration of lauroyl surfactant in the lysis solution is 0.3%~0.5% w / v, more preferably 0.4% w / v.

[0014] More preferably, the concentration of Tris-HCl buffer in the lysis buffer is 30-50 mM, more preferably 40 mM.

[0015] More preferably, the concentration of EDTA in the lysis solution is 4-5 mM.

[0016] Furthermore, the present invention provides a kit comprising the lysis buffer described above.

[0017] Preferably, the kit is a PCR kit.

[0018] Preferably, the kit includes the lysis buffer and the PCR reaction solution, wherein the PCR reaction solution contains L-cysteine.

[0019] More preferably, the PCR reaction solution contains a buffer substance, magnesium ions, dNTPs, DNA polymerase, and L-cysteine.

[0020] The present invention further reveals that when the lysis buffer containing guanidine hydrochloride and the PCR reaction buffer containing L-cysteine ​​are added together to the PCR reaction system, the synergistic effect of guanidine hydrochloride and L-cysteine ​​promotes rapid and efficient PCR amplification. The combined effect of other bidirectional agents and stabilizers is not as good as the combination of guanidine hydrochloride and L-cysteine.

[0021] Furthermore, the present invention provides the use of the lysis buffer or the kit in at least one of the following aspects: (1) Lysis of bacteria; (2) Prepare bacterial detection kits or bactericides; (3) Bacterial detection for purposes other than disease diagnosis and treatment.

[0022] Preferably, the bacteria are selected from Gram-positive bacteria and / or Gram-negative bacteria.

[0023] More preferably, the bacteria are selected from at least one of Streptococcus mutans (Sm), nucleic acid-bearing bacilli (Fn), and Porphyromonas gingivalis (Pg).

[0024] Secondly, the present invention provides a rapid detection method for bacteria, comprising: lysing a sample containing bacteria using the lysis buffer, and then detecting the bacteria by PCR amplification.

[0025] Preferably, the PCR is fluorescent PCR.

[0026] Preferably, before the PCR amplification, nucleic acid extraction and / or purification are not performed on the lysed sample.

[0027] Preferably, the PCR amplification reaction system contains the lysis buffer.

[0028] Using a PCR reaction system containing the lysis buffer can promote PCR amplification.

[0029] Preferably, the lysis buffer accounts for 5% to 8% of the total volume of the PCR amplification reaction system.

[0030] In some implementations, the PCR amplification reaction system contains buffer substances, magnesium ions, dNTPs, primers, DNA polymerase, and stabilizers.

[0031] In some embodiments, the PCR amplification reaction system comprises: PCR buffer, magnesium chloride (2-4 mM, preferably 3 mM), dNTPs (0.1-0.5 mM each, preferably 0.2 mM), forward primer (0.2-1 μM, preferably 0.5 μM), reverse primer (0.2-1 μM, preferably 0.5 μM), stabilizer (L-cysteine, 0.1%-0.2% w / v, preferably 0.2% w / v), and DNA polymerase (0.5-2 U, preferably 1 U).

[0032] The stabilizer in the reaction system of this invention protects Taq enzyme, enabling rapid and efficient amplification, and exhibits high tolerance to inhibitory components and rapid temperature fluctuations in the PCR instrument. Furthermore, this invention utilizes a single reaction system to simultaneously detect multiple bacteria and internal controls, resulting in high efficiency, reduced reagent and sample consumption, increased throughput, and shorter detection cycles for large numbers of samples.

[0033] Preferably, in the PCR amplification, the primers for detecting the internal control (IC) are shown in SEQ ID No. 10~SEQ ID No. 11, and the probe for detecting the IC is shown in SEQ ID No. 12.

[0034] Preferably, the IC (internal control) target gene is a multicopy sequence in the human genome.

[0035] Multiple copy sequences refer to sequences with 5 to 20 copies in the human genome.

[0036] Preferably, the target gene sequence of the internal control is shown in SEQ ID No. 13.

[0037] Setting internal controls in PCR amplification can be used for quality control of human samples. This invention has found that when selecting the aforementioned target genes for internal controls, the amplification of the internal controls will not affect the amplification and detection of the target bacteria in the same reaction system, while ensuring that the internal controls are detected sensitively. In other words, the internal controls selected in this invention improve detection sensitivity without significantly affecting the amplification of the target bacteria, thus fully realizing their quality control function.

[0038] Preferably, when the target bacterium to be detected is Streptococcus mutans, the primer sequences are shown in SEQ ID No. 1 to SEQ ID No. 2, and the probe sequence is shown in SEQ ID No. 3; And / or, when the target bacteria to be detected are nucleic acid-containing bacilli, the primer sequences are shown in SEQ ID No. 4~SEQ ID No. 5, and the probe sequence is shown in SEQ ID No. 6; And / or, when the target bacteria to be detected is *Porphyromonas gingivalis*, the primer sequences are shown in SEQ ID No. 7~SEQ ID No. 8, and the probe sequence is shown in SEQ ID No. 9.

[0039] In some implementations, the fluorescent groups modified by different probe sequences are different and can be detected simultaneously using different fluorescence channels on a fluorescence PCR instrument. The fluorescent groups include, but are not limited to, FAM, HEX / VIC, ROX, and Cy5.

[0040] Preferably, the PCR amplification employs a rapid heating and cooling mode, with an average heating rate ≥8℃ / s and / or an average cooling rate ≥6℃ / s.

[0041] The PCR reaction system of the present invention is applicable to both normal heating and cooling and rapid heating and cooling modes. Experimental verification shows that the target Ct value does not change significantly in the rapid heating and cooling mode compared to the normal heating and cooling mode. Therefore, the detection cycle can be further shortened by using the above-mentioned PCR reaction system in the rapid heating and cooling mode.

[0042] Preferably, the PCR amplification program is as follows: 98℃ for 2 min; (98℃ for 3 s, 60℃ for 10 s) × 40 cycles (fluorescence is collected at 60℃, and the lid is heated to 105℃).

[0043] In addition, the present invention provides an internal control for PCR amplification, comprising internal control primers and internal control probes; wherein the internal control primers are shown in SEQ ID No. 10 to SEQ ID No. 11, and the internal control probes are shown in SEQ ID No. 12.

[0044] In addition, the present invention provides primers and probes for detecting Streptococcus mutans, the primer sequences being shown in SEQ ID No. 1 to SEQ ID No. 2, and the probe sequence being shown in SEQ ID No. 3.

[0045] Furthermore, the present invention provides primers and probes for detecting nucleic acid-bearing bacteria, the primer sequences being shown in SEQ ID No. 4~SEQ ID No. 5, and the probe sequence being shown in SEQ ID No. 6.

[0046] Furthermore, the present invention provides primers and probes for detecting Porphyromonas gingivalis, the primer sequences being shown in SEQ ID No. 7 to SEQ ID No. 8, and the probe sequence being shown in SEQ ID No. 9.

[0047] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a lysis buffer that can rapidly and completely lyse bacteria. It is widely applicable and easy to use, achieving complete lysis within 2 minutes without requiring subsequent nucleic acid extraction and / or purification. Furthermore, it does not inhibit subsequent PCR amplification and exhibits high storage stability. In addition, this invention provides a method for rapid detection of specific bacteria using fluorescent PCR. Adding the lysis buffer of this invention to the PCR reaction system promotes PCR amplification, and the internal control mechanism of this invention enhances detection sensitivity. This method has broad application prospects in the field of rapid bacterial detection. Detailed Implementation

[0048] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0049] In the embodiments provided in this specification, unless specific techniques or conditions are specified, the techniques or conditions described in the literature in this field, or the product instructions, shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0050] This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book *Molecular Cloning* (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. In addition, depending on the experimental purpose, those skilled in the art may conduct corresponding experiments under the guidance of the operating manuals accompanying various commercially available kits or entrust them to specialized companies, such as primer synthesis.

[0051] In this invention, % refers to the mass-volume concentration (w / v), which is the number of grams of solute contained in 100 mL of solution.

[0052] Example 1 This embodiment provides lysis buffers with different formulations and tests the inhibition of fluorescent PCR by different formulations. The steps are as follows: Genomic DNA was extracted from Streptococcus mutans (Sm), Fn, and Porphyromonas gingivalis (Pg) using the VAMNE Magnetic Pathogen DNA / RNA Kit (manufactured by Novizan). Sm was a Gram-positive bacterium, while Fn and Pg were Gram-negative bacteria. Genomic DNA was extracted from human 293T cells using the TIANamp Genomic DNA Kit (manufactured by Tiangen Pharmaceuticals).

[0053] The lysis buffer was prepared according to different formulations. The lysis buffer included buffer (Tris-HCl, 20~80 mM), surfactant (sodium lauroyl sarcosinate, 0.2%~0.8%), bidirectional interaction agent (without or with guanidine hydrochloride, 0.1~0.8 M), and protective agent (EDTA, 5 mM). The final concentrations of each component are shown in Table 1.

[0054] Add 1 μL of each lysis buffer to the fluorescent PCR reaction system, and add 1 μL of water to the control.

[0055] The components of the fluorescent PCR reaction system (15 μL, 1×) were: PCR buffer (1×), magnesium chloride (3 mM), dNTPs (0.2 mM each), Sm / Fn / Pg / IC primers and probes (0.5 μM each), stabilizer (either omitted or with L-cysteine, 0.2%), DNA polymerase (1 U), and template (1 pg of each of the three bacterial genomic DNAs; 1 ng of human genomic DNA). The purpose of adding purified DNA to the PCR reaction system was to test the inhibition of fluorescent PCR by different lysis buffer formulations.

[0056] Sm-F: GGCAATGATGGTTATGCCTT (SEQ ID No. 1) Sm-R: GATCATGACTGGCATAACGAT (SEQ ID No. 2) Sm-Pb: TGGCATGTTGTTGAAGGAAGACGT (SEQ ID No. 3) Fn-F: GGTAAGATTTGAACTTACGACCT (SEQ ID No. 4) Fn-R: GGTAGAGCAGTCTGGCA (SEQ ID No. 5) Fn-Pb:TCGGGTTATGAGCCCGACGA (SEQ ID No. 6) Pg-F: CACCCTGTCCTGTAACGA (SEQ ID No. 7) Pg-R: TACAGTGCGAACTTCGAGT (SEQ ID No. 8) Pg-Pb: TTGTGTAGTAACAACAGGATCGGCA (SEQ ID No. 9) The primer and probe sequences for detecting internal controls (ICs) are as follows: IC-F: CATCAGTCTATCAAATGCCTAGA (SEQ ID No.10) IC-R: GAGAATGAAAGGGCTGAGA (SEQ ID No. 11) IC-Pb: TCACCTTCTGTGTCACCCAGCA (SEQ ID No. 12) Fluorescent PCR program: 95℃ 2 min; (95℃ 3s, 60℃ 10s) × 40 cycles (fluorescence collected at 60℃; hot lid 105℃). Rapid heating and cooling mode was used, with an average heating rate ≥8℃ / s and an average cooling rate ≥6℃ / s. Sm / Fn / Pg / IC were detected using the FAM / ROX / Cy5 / VIC channels, respectively. When analyzing the results, (1) Set the baseline: the starting value of the baseline is the number of the starting rounds at the level of the amplification curve, and the ending value is the number of the ending rounds at the level of the amplification curve. The baseline can be automatically set by the instrument software, and can be manually adjusted if necessary. (2) Set the threshold line: the amplification curve algorithm is selected as the absolute fluorescence value method, and the threshold is set in the linear part of the logarithmic fluorescence value graph. The same threshold is taken for each target in all samples. (3) Read the Ct value: when the Ct value is <38, it is judged as positive; when the Ct value is ≥38 or there is no amplification, it is judged as negative.

[0057] Experimental results: (1) When no stabilizer is added to the fluorescent PCR reaction system, the Ct value is significantly larger than when a stabilizer is added, indicating that the stabilizer can resist the inhibitory effect of the rapid heating and cooling mode on DNA polymerase, and it is speculated that it may help maintain the stability of the enzyme structure.

[0058] (2) Table 1 shows the results of fluorescent PCR detection with stabilizer in the fluorescent PCR reaction system, where ΔCt value is Ct of each target in each group - Ct of the target in the control.

[0059] Table 1

[0060] The results show that: within the buffer concentration range of 20 mM to 80 mM and the surfactant concentration range of 0.2% to 0.8%, the Ct values ​​of each target did not change significantly (the deviation from the control was no more than ±0.5). After the addition of the bidirectional agent, the difference between 0.1 M and the control was small (the deviation from the control was no more than ±0.5); within the concentration range of 0.2 M to 0.4 M, there was no significant inhibition and PCR amplification was better (the Ct value decreased by more than 0.5 compared with the control), indicating that it has an enhancing effect on PCR; however, too much should not be added, and when the concentration exceeds 0.4 M, there is a certain degree of inhibition on PCR (the Ct value increases by more than 0.5 compared with the control).

[0061] Example 2 This embodiment tests the bacterial lysis performance of different lysis buffer formulations, and the steps are as follows: Lysis buffers were prepared according to different formulations, including buffer (Tris-HCl, 20–80 mM), surfactant (sodium lauroyl sarcosinate, 0.2%–0.8%), biphasic agent (without or with guanidine hydrochloride, 0.2–0.4 M), and protective agent (EDTA, 5 mM). The final concentrations of each component are shown in Table 2.

[0062] Oral samples (containing Sm, Fn, and Pg bacteria) were collected from the human mouth using swabs. The swabs were added to 200 μL of lysis buffers with different formulations, and the mixture was inverted five times. For the control, the swabs were placed in 200 μL of PBS and heated at 95°C for 20 min. Subsequently, 50 μL each of the lysis buffer and PBS solution were taken and purified using magnetic beads (Novozymes) to obtain purified DNA. 1 μL of each purified DNA was added as a template to the PCR reaction system. The fluorescent PCR reaction system was the same as in Example 1, but contained a stabilizer (L-cysteine, 0.2%); the fluorescent PCR procedure was the same as in Example 1.

[0063] In addition, the swabs were processed using standard experimental procedures—first, nucleic acid was extracted using a commercial kit (VAMNE Magnetic Pathogen DNA / RNA Kit, manufactured by Novizan), and then fluorescent PCR was performed. Since the PCR reaction system contained purified DNA from the swabs after lysis buffer treatment (heat treatment was used as a control), the purpose was to test the lysis ability of different lysis buffer formulations and heat treatments on bacteria.

[0064] The results of the fluorescent PCR experiment are shown in Table 2, where the ΔCt value is the Ct of each target in each group minus the Ct of the control.

[0065] Table 2

[0066] The results show that when using lysis buffer with a concentration range of 20 mM to 80 mM and a surfactant concentration range of 0.2% to 0.8%, the Ct value was significantly lower than the control (heat treatment) without the addition of the biphasic agent (Ct value decreased by more than 0.50). The Ct value in the conventional experimental procedure was significantly higher than the control (heat treatment) (Ct value increased by more than 1.0), indicating that the lysis buffer has a significant lysis effect on bacteria and is better than heat treatment and the conventional experimental procedure. When the biphasic agent was added to the lysis buffer, it showed no significant inhibition in the 0.2–0.4 M concentration range, and PCR amplification was better (Ct value decreased by more than 0.5 compared to the control, and the decrease was greater than that without the biphasic agent), indicating that the biphasic agent promotes the lysis of bacteria in human samples.

[0067] Example 3 This embodiment tests the lysis rate of bacteria by the lysis buffer, and the steps are as follows: A lysis buffer was prepared containing 40 mM Tris-HCl buffer, 0.4% sodium lauroyl sarcosinate surfactant, 0.4 M guanidine hydrochloride bidirectional agent, and 5 mM EDTA protectant. Oral swabs were taken from individuals with Sm, Fn, and Pg. The swabs were added to 200 μL of the lysis buffer and mixed by inverting the container five times. For the control, 200 μL of the lysis buffer was added to the container, vortexed (highest setting, 2 min), and then heated at 95°C for 2 min. 1 μL of the lysis buffer was then added to the fluorescent PCR reaction system. The fluorescent PCR reaction system and procedure were the same as in Example 1. Since both vortexing and heating can promote the action of the lysis buffer, the purpose was to test whether the lysis process could be simplified after adding the swabs to the lysis buffer.

[0068] The results of the fluorescent PCR experiment are shown in Table 3, where the ΔCt value is the Ct of each target in each group minus the Ct of the control.

[0069] Table 3

[0070] The results show that the Ct values ​​of each target did not change significantly after adding the lysis buffer to the swabs (the deviation from the control was no more than ±0.5). This indicates that the lysis of bacteria in the swab samples can be completed with simple operation after adding the lysis buffer, without the need for vortexing or heating. The rapid lysis effect of the lysis buffer is good, which is beneficial to shortening the detection cycle.

[0071] Example 4 This embodiment tests the stability of swab samples preserved with lysis buffer, and the steps are as follows: Prepare the lysis buffer using the same formula as in Example 3. Take oral swab samples from individuals with Sm, Fn, and Pg, add the swab to 200 μL of lysis buffer, and mix thoroughly by inverting 5 times. For the control, immediately add 1 μL of the lysis buffer to the fluorescent PCR reaction system. After storage at room temperature (20–30°C), refrigerated (2–8°C), and frozen (-30–-10°C) for 1 week, 1 month, 6 months, and 1 year, add 1 μL of the lysis buffer to the fluorescent PCR reaction system for detection. The fluorescent PCR reaction system and procedure are the same as in Example 1.

[0072] The results of the fluorescent PCR experiment are shown in Table 4, where the ΔCt value is the Ct of each target in each group minus the Ct of the control.

[0073] Table 4

[0074] The results show that after storing the swab lysis buffer at room temperature, under refrigeration, and under freezing conditions for 1 week, 1 month, 6 months, and 1 year, the Ct values ​​of each target did not change significantly (the deviation from the control was no more than ±0.5), indicating that the lysis buffer has good stability in preserving swab samples.

[0075] Example 5 This embodiment tests the adaptability of the PCR reaction system with added lysis buffer to both standard and rapid temperature control programs. The steps are as follows: Prepare the lysis buffer using the same formula as in Example 3. Take oral swab samples from individuals with Sm, Fn, and Pg, add the swabs to 200 μL of lysis buffer, and mix thoroughly by inverting five times. Then, add 1 μL of the lysis buffer to the fluorescent PCR reaction system. Perform fluorescent PCR using a conventional PCR instrument (average heating rate 3℃ / sec, average cooling rate 2℃ / sec) and a rapid PCR instrument (average heating rate 8℃ / sec, average cooling rate 6℃ / sec) to test whether the fluorescent PCR reaction system with added lysis buffer is suitable for rapid heating and cooling programs. The fluorescent PCR reaction system and fluorescent PCR program are the same as in Example 1.

[0076] The results of the fluorescent PCR experiment are shown in Table 5, where ΔCt is the Ct of each target in each group minus the Ct of the control.

[0077] Table 5

[0078] The results show that, compared with the normal temperature rise and fall mode, the Ct values ​​of each target did not change significantly in the rapid temperature rise and fall mode (the deviation from the control was no more than ±0.5), indicating that the fluorescent PCR reaction system with added lysis buffer of the present invention is suitable for rapid temperature rise and fall programs, which can further shorten the entire detection cycle.

[0079] Example 6 This embodiment provides a rapid detection method for bacteria, the steps of which are as follows: 1. Collect samples by repeatedly swabbing the target area (e.g., the human mouth) with a sterile swab.

[0080] 2. Place the collected swabs into 200 μL of lysis buffer and invert the container five times to mix thoroughly, allowing the bacteria collected from the swabs to lyse rapidly. The composition of the lysis buffer is the same as in Example 3.

[0081] 3. No nucleic acid extraction and purification are required. Simply add 1 μL of lysis buffer to the fluorescent PCR reaction system to detect specific bacterial Sm, Fn, Pg and internal control (IC).

[0082] The components of the fluorescent PCR reaction system (15 μL, 1×) are: PCR buffer (1×), magnesium chloride (3 mM), dNTPs (0.2 mM each), Sm / Fn / Pg / IC primers and probes (0.5 μM each, same as in Example 1), stabilizer (L-cysteine, 0.2%), DNA polymerase (1 U), and template (lysate).

[0083] The IC (internal control) target gene is a multicopy sequence in the human genome, as shown in SEQ ID No. 13.

[0084] IC (internal control) target gene (SEQ ID No. 13): CCATCAGTCTATCAAATGCCTAGAAAACCTTTCGCCCTTTGTCACCTTCTGTGTCACCCAGCATTCCCCTTCTCAGCCCTTTTCATTCTCA Fluorescent PCR program: 95℃ for 2 min; (95℃ for 3 s, 60℃ for 10 s) × 40 cycles (fluorescence acquisition at 60℃; heated lid at 105℃). A rapid temperature ramp-up / ramp mode was used, with an average ramp-up rate ≥8℃ / s and an average cooling rate ≥6℃ / s. Sm / Fn / Pg / IC were detected using the FAM / ROX / Cy5 / VIC channels, respectively.

[0085] When analyzing the results, (1) Set the baseline: The starting value of the baseline is the number of the initial rounds at the level of the amplification curve, and the ending value is the number of the final rounds at the level of the amplification curve. The baseline can be set automatically by the instrument software, and can be adjusted manually if necessary. (2) Set the threshold: The amplification curve algorithm selects the absolute fluorescence value method, and the threshold is set in the linear part of the logarithmic fluorescence value graph. The same threshold is taken for each target in all samples. (3) Read the Ct value: When the Ct value is <38, it is judged as positive; when the Ct value is ≥38 or there is no amplification, it is judged as negative.

[0086] Example 7 This embodiment tests the precision of the detection method of Example 6, that is, the same sample (oral cavity of a person with Sm, Fn, and Pg) is repeatedly tested 10 times according to the detection method of Example 6.

[0087] The results showed that the CV (relative standard deviation) of the Ct values ​​of each target was <3%, indicating that the detection method in Example 6 had high precision.

[0088] Example 8 This embodiment tests the sensitivity and specificity of the detection method in Example 6. The detection method in Example 6 is followed, with 5 copies of each target template added per reaction. Interfering bacteria are also included, meaning that a high concentration of interfering bacterial DNA exists in addition to the target (see Table 6 below, Np is Neisseria adenosus, a common oral cavity bacterium). The amount of each interfering bacterial template added is 50,000 copies per reaction, and each is tested 20 times.

[0089] Table 6

[0090] The results show that the detection method in Example 6 can reliably detect bacteria as low as 5 copies / reaction, with high sensitivity and is not affected by high concentrations of interfering bacteria; moreover, it has high specificity, and the detection of human genomic DNA or non-target bacteria is negative.

[0091] Example 9 This embodiment tests the accuracy of the detection method in Example 6, and the steps are as follows: Oral swabs were collected from 50 individuals and tested according to the detection method in Example 6. The results of the target bacteria detection were compared with those of the Sanger sequencing method. The negative concordance rate, positive concordance rate, and overall concordance rate of the fluorescent PCR detection results for Sm, Fn, and Pg were all 100% with those of the Sanger sequencing method, indicating that the detection method of the present invention has high accuracy.

[0092] Example 10 This embodiment designs multiple sets of IC primers and probes with similar sequences based on the IC target sequence, and tests the amplification efficiency, IC detection rate, and bacterial target detection rate of each IC primer and probe combination. That is, based on the detection method in Example 6, only the combinations of IC primers and probes are changed. Each fluorescent PCR reaction system contains one IC forward primer from IC-F1 to F4, one IC reverse primer from IC-R1 to R4, and one IC probe from IC-Pb1 to Pb4, resulting in a total of 64 combinations of IC primers and probes.

[0093] The primer and probe sequences used in this embodiment are as follows: IC-F1: CATCAGTCTATCAAATGCCTAGA (SEQ ID No.10) IC-F2: ATCAGTCTATCAAATGCCTAGA (SEQ ID No.14) IC-F3: CATCAGTCTATCAAATGCCTAG (SEQ ID No. 15) IC-F4: CCATCAGTCTATCAAATGCCTAGA (SEQ ID No. 16) IC-R1:GAGAATGAAAAGGGCTGAGA (SEQ ID No.11) IC-R2: AGAATGAAAAGGGCTGAGA (SEQ ID No. 17) IC-R3: GAGAATGAAAAGGGCTGAG (SEQ ID No. 18) IC-R4:TGAGAATGAAAAGGGCTGAGA (SEQ ID No. 19) IC-Pb1: TCACCTTCTGTGTCACCCAGCA (SEQ ID No. 12) IC-Pb2: CACCTTCTGTGTCACCCAGCA (SEQ ID No. 20) IC-Pb3:TCACCTTCTTGTGTCACCCAGC (SEQ ID No. 21) IC-Pb4: GTCACCTTCTGTGTCACCCAGCA (SEQ ID No. 22) (a) Amplification efficiency assessment: Human genomic DNA was diluted to different concentrations and added to the reaction system (5 pg / reaction for low concentration, 5 ng / reaction for high concentration, with 8 sample volume gradients set relatively evenly between the low and high concentrations). Each sample volume was tested 3 times. The average Ct value at each sample volume (as the ordinate) was linearly fitted to the logarithm of the sample volume (as the abscissa) to obtain the slope value k of the fitted line. The amplification efficiency was then calculated as 10^(-1 / k)-1.

[0094] Results: The combined amplification efficiency of IC-F1+IC-R1+IC-Pb1 was 98%, while the amplification efficiencies of the remaining 63 IC primer and probe combinations ranged from 75% to 95% or 105% to 115%. These results indicate that the IC primer and probe combinations of this invention (SEQ ID No. 10~SEQ ID No. 12) exhibit the best amplification efficiency.

[0095] (b) Evaluation of IC detection rate and bacterial target detection rate: Human genomic DNA was diluted to different concentrations and added to the reaction system (template addition amounts were 5 pg / reaction for low values ​​and 5 ng / reaction for high values), and low-copy target bacteria (Sm+Fn+Pg, 5 copies / reaction for each target template) and high-copy interfering bacteria (Np DNA, 50,000 copies / reaction for interfering bacteria template) were added simultaneously. Each was tested 20 times.

[0096] Results: The IC-F1+IC-R1+IC-Pb1 combination achieved 100% IC detection rate and bacterial target detection rate when the template contained low levels of human genomic DNA (5 pg); and 100% when the template contained high levels of human genomic DNA (5 ng). The remaining 63 IC primer and probe combinations achieved IC detection rates ≤95% and bacterial target detection rates 100% when the template contained low levels of human genomic DNA (5 pg); and 100% and ≤95% when the template contained high levels of human genomic DNA (5 ng). These results indicate that the IC primer and probe combinations of this invention (SEQ ID No. 10~SEQ ID No. 12) provide normal internal control amplification without interfering with the amplification of target bacteria when the swab sample contains a large number of human cells; and when the swab sample contains a small number of human cells, the internal control amplification remains normal and effective, without affecting its effectiveness as a quality control indicator, and without interfering with the amplification of target bacteria.

[0097] In summary, the IC primer and probe combination (SEQ ID No. 10~SEQ ID No. 12) of the present invention has the best amplification efficiency, IC detection rate, and bacterial target detection rate.

[0098] Example 11 This embodiment further evaluates the sensitivity and specificity of the internal control, and the steps are as follows: Human genomic DNA was diluted to different concentrations and added to the reaction system (template addition amounts were 5 pg / reaction for low concentrations and 5 ng / reaction for high concentrations). Target bacteria were also included (see Table 7 below), with 5 copies of each target template added per reaction. Interference bacteria were also included, meaning a high concentration of interfering bacterial DNA was present in addition to the target DNA (see Table 7 below), with 50,000 copies of each interfering bacterial template added per reaction. Each reaction was performed 20 times according to the detection method in Example 6. Furthermore, under the same testing conditions, the effects of Alu repeat sequences and single-copy gene GAPDH as internal controls on the amplification of target bacteria and internal controls were compared.

[0099] The results are shown in Table 7.

[0100] Table 7

[0101] The results show that: when Alu is selected as the target for the internal control of the fluorescent PCR reaction system, the internal control amplification interferes with the amplification of the target bacteria when the swab sample contains a large number of human cells; when the single-copy gene GAPDH is selected as the target for the internal control, the internal control cannot be effectively amplified when the swab sample contains a small number of human cells, affecting the detection rate and greatly reducing its effectiveness as a quality control indicator; when the multi-copy sequence used in Example 6 is selected as the target for the internal control, the internal control amplification is normal and does not interfere with the amplification of the target bacteria regardless of whether the swab sample contains a large or small number of human cells.

[0102] In summary, the internal control of this invention can reliably detect human genomic DNA down to 5 pg / reaction, with high sensitivity, and the internal control amplification is not affected by high concentrations of interfering bacteria; moreover, the internal control of this invention has high specificity, and no amplification occurs in IC regardless of the addition of target bacteria or interfering bacteria when no human genomic DNA is added.

[0103] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A lysis buffer, characterized in that, include: The lysis buffer contains lauroyl surfactant, guanidine hydrochloride, Tris-HCl buffer, and EDTA; wherein the concentration of guanidine hydrochloride in the lysis buffer is below 0.4 M.

2. The pyrolysis solution according to claim 1, characterized in that, The concentration of guanidine hydrochloride in the lysis solution is 0.1~0.4M, more preferably 0.2M~0.4M.

3. The lysis buffer according to claim 1 or 2, characterized in that, The lysis buffer contains lauroyl surfactant at a concentration of 0.2%–0.8% w / v, Tris-HCl buffer at a concentration of 20–80 mM, and EDTA at a concentration of 1–5 mM.

4. A reagent kit, characterized in that, This includes the lysis solution according to any one of claims 1 to 3; Preferably, the kit includes the lysis buffer and PCR reaction solution according to any one of claims 1 to 3, wherein the PCR reaction solution contains L-cysteine.

5. The use of the lysis buffer according to any one of claims 1 to 3 or the kit according to claim 4 in at least one of the following aspects: (1) Lysis of bacteria; (2) Prepare bacterial detection kits or bactericides; (3) Bacterial detection for purposes other than disease diagnosis and treatment.

6. A rapid detection method for bacteria, characterized in that, include: After lysing the bacterial-containing sample using the lysis buffer described in any one of claims 1 to 3, the bacteria are detected by PCR amplification.

7. The rapid detection method for bacteria according to claim 6, characterized in that, Before the PCR amplification, nucleic acid extraction and / or purification are not performed on the lysed sample; And / or, the PCR amplification reaction system contains the lysis buffer.

8. The rapid detection method for bacteria according to claim 6 or 7, characterized in that, In the PCR amplification, the primers for detecting the internal control are shown in SEQ ID No. 10~SEQ ID No. 11, and the probe for detecting the internal control is shown in SEQ ID No.

12.

9. The rapid detection method for bacteria according to claim 6 or 7, characterized in that, When the target bacterium to be detected is Streptococcus mutans, the primer sequences are shown in SEQ ID No. 1 to SEQ ID No. 2, and the probe sequence is shown in SEQ ID No. 3; And / or, when the target bacteria to be detected are nucleic acid-containing bacilli, the primer sequences are shown in SEQ ID No. 4~SEQ ID No. 5, and the probe sequence is shown in SEQ ID No. 6; And / or, when the target bacteria to be detected is *Porphyromonas gingivalis*, the primer sequences are shown in SEQ ID No. 7~SEQ ID No. 8, and the probe sequence is shown in SEQ ID No.

9.

10. The rapid detection method for bacteria according to claim 6 or 7, characterized in that, The PCR amplification employs a rapid heating and cooling mode, with an average heating rate ≥8℃ / s and / or an average cooling rate ≥6℃ / s.

11. An internal control for PCR amplification, characterized in that, It includes internal control primers and internal control probes; wherein the internal control primers are shown in SEQ ID No. 10~SEQ ID No. 11, and the internal control probe is shown in SEQ ID No. 12.

Images