Primer composition and kit for grouping subjects based on ovarian support-interstitial cytoma and application of primer composition and kit

Abstract

The invention provides a primer composition and a kit for grouping subjects based on ovarian support-interstitial cytoma and application of the primer composition and the kit. On the first aspect, the invention provides a primer composition which comprises a first primer, a second primer, a third primer, a fourth primer, a fifth primer and a sixth primer, and nucleotide sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer and the sixth primer are respectively shown as SEQ ID NO: 1-6. A DNA sample of a tumor sample or a paraffin section is subjected to PCR amplification based on the primer composition, an amplification product is sequenced in combination with Sanger sequencing, and subjects are grouped based on a detection result, so that the defects of long time consumption and high requirements on specialty and experience of doctor reading of a traditional method are overcome, and the detection accuracy is improved. And a technical support is provided for clinical diagnosis of ovarian support-interstitial cell tumor.

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, specifically to a primer composition, kit, and application for grouping subjects based on ovarian stromal tumors. Background Technology

[0002] Non-epithelial ovarian tumors include sex cord-stromal tumors (SCST), germ cell tumors, and other miscellaneous tumors, with SCST accounting for only 5%-7% of ovarian tumors. SCST is a group of tumors with diverse clinicopathological features, such as granulosa cell tumors (GCT), Sertoli-Leydig cell tumors (SLCT), and fibromas / fibrothecomas. Due to their morphological diversity, diagnosis is challenging and remains one of the difficulties in clinicopathological diagnosis. Because different subtypes of SCST have varying risks of malignancy, proximal and distal metastasis, timely and accurate subtyping is crucial for the treatment of this type of tumor. Ovarian Sertoli-stromal tumors are mainly classified into well-differentiated, moderately-differentiated, and reticular types. The malignancy and prognosis of different types of ovarian Sertoli-stromal tumors vary greatly. Well-differentiated tumors have low malignancy and good prognosis after treatment, while moderately-differentiated tumors have high malignancy and poor prognosis.

[0003] Currently, the differential diagnosis of ovarian Supporting-stromal cell tumors mainly relies on the patient's clinical manifestations combined with the patient's tumor tissue pathology sections. The traditional diagnostic workflow is as follows: (1) Preparation of paraffin sections: The surgically removed tumor tissue is fixed with paraformaldehyde, dehydrated in a gradient, cleared, impregnated with paraffin, embedded in paraffin, sectioned, spread, and dried to prepare qualified paraffin sections. (2) HE staining: The paraffin sections are dewaxed, rehydrated in a gradient, stained with hematoxylin, acidified, blued, stained with eosin, dehydrated in a gradient, impregnated with xylene, and mounted with neutral resin to prepare qualified HE-stained paraffin sections. (3) Immunohistochemical staining: If necessary, immunohistochemical staining is also required to observe the content and distribution of some markers in the tissue. The paraffin sections are dewaxed, rehydrated in a gradient, antigen retrieval, blocked with serum, added with primary antibody, washed with PBS, added with secondary antibody, washed with PBS, added with SABC, added with chromogenic agent, stained with hematoxylin, dehydrated in a gradient, impregnated with xylene, and mounted with neutral resin to prepare qualified immunohistochemically stained paraffin sections. (4) Slide reading: HE-stained tissue sections can show the structure and morphology of tissues and cells; immunohistochemical staining results can show the content and distribution of relevant markers. Combining the morphological characteristics of tumor tissue and cells with the distribution and content of relevant markers, differential diagnosis can be made to determine whether the tumor is an ovarian Sertoli stromal tumor and the degree of tumor differentiation. The key points of pathological diagnosis of ovarian Sertoli stromal tumor are: ① Markers: inhibin, calretinin, WT-1, AE1 / AE3, CD56, SF-1 positive, CK5 / 6, EMA negative, Leydig cells: MelanA+ positive (can be differentiated from granulosa cell tumor); ② Under low magnification, well-differentiated Sertoli stromal tumors are lobulated, the Sertoli cells are tubular structures (hollow or solid), the nuclei are warm, the lumen is lined with consistent lipid-rich or eosinophilic cytoplasm, the elongated nuclei are arranged perpendicular to the basement membrane, the stromal cells are nested, and the cytoplasm is rich in eosinophilic or vacuolated. Moderately differentiated Sertoli stromal tumors appear lobulated and nodular under low magnification, with Sertoli cells arranged in cord-like (typically 1-2 cells wide) or trabecular patterns, showing mild cellular atypia. Stromal cells are scattered or clustered, with visible mitotic figures against a background of cellular stroma, which may be accompanied by edema. Poorly differentiated Sertoli stromal tumors appear sarcomatous under microscopic examination, diffusely arranged in sheets, with significant nuclear atypia, not lobulated and nodular, and with very few stromal cells, making them difficult to detect. Reticular types contain testicular reticular structures, cystic cavities or papillary projections, and hyalinized stroma.

[0004] However, the traditional diagnostic process has the following two problems: (1) The process is complicated and time-consuming: The preparation of paraffin sections involves many steps, each of which takes at least 1-2 hours. The paraffin soaking process takes 6 hours or overnight. The preparation of paraffin sections takes at least two working days. Moreover, the quality control of the paraffin section preparation process is not easy. Whether there are problems with the paraffin can usually only be discovered in the slide preparation or even the reading stage after staining. HE staining takes half a working day, and the staining of each marker in immunohistochemical staining takes at least 1.5 working days. If multiple markers are stained at the same time, multiple people need to conduct the experiment at the same time. It takes at least a week or longer to complete the reading and issue the report. Untimely identification and classification may delay the treatment of patients. (2) Differential diagnosis requires a high level of experience and expertise from physicians: Ovarian stromal tumors exhibit diverse histological morphology, especially requiring differentiation from ovarian granulosa cell tumors, dysgerminomas, gonadal blastomas, and gastrointestinal stromal tumors that have metastasized to the ovary; some patients present with atypical clinical symptoms and tumor histological morphology, all of which place high demands on physicians' experience and expertise. Misdiagnosis or missed diagnosis caused by these factors can affect the determination of the patient's treatment plan.

[0005] The inherent contradictions of traditional tumor tissue morphology-based methods lie in their poor diagnostic timeliness and high dependence on physician experience and expertise for diagnostic accuracy, making fundamental improvements difficult to achieve through optimization. Therefore, how to utilize molecular biological targets highly relevant to SLCT to address the problems of traditional methods through molecular biological diagnostic approaches is one of the urgent technical challenges in this field. Summary of the Invention

[0006] This invention provides a primer composition, a kit, and its application for grouping subjects based on ovarian supporting stromal tumors.

[0007] A first aspect of the present invention provides a primer composition comprising a first primer, a second primer, a third primer, a fourth primer, a fifth primer, and a sixth primer, wherein: The first primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:1; Therefore, the second primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:2; The third primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:3; The fourth primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:4; The fifth primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:5; The sixth primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:6.

[0008] In the primer composition described above, the molar concentration ratio of the first primer and the second primer is 1:1; the molar concentration ratio of the third primer and the fourth primer is 1:1; and the molar concentration ratio of the fifth primer and the sixth primer is 1:1.

[0009] A second aspect of the present invention provides a kit comprising the primer composition described above.

[0010] The kit described above also includes reagents required for PCR.

[0011] The kit described above also includes the reagents required by Sanger. In one specific embodiment, it includes a first primer, a third primer, and a fifth primer.

[0012] A third aspect of the present invention provides the application of any of the primer compositions described above or the kits described above, wherein the application is selected from at least one of A1)-A7): A1) Application in detecting whether a mutation has occurred at the p.1344 site of the DICER1 gene in a sample; A2) Application in detecting whether a mutation has occurred at the p.1705 site of the DICER1 gene in a sample; A3) Application in detecting whether a mutation has occurred at the p.1709 site of the DICER1 gene in a sample; A4) Application in detecting whether a mutation has occurred at the p.1809 site of the DICER1 gene in a sample; A5) Application in detecting whether a mutation has occurred at the p.1810 site of the DICER1 gene in a sample; A6) Application in detecting whether a mutation has occurred at the p.1813 site of the DICER1 gene in a sample; A7) Application in grouping subjects based on ovarian Sertoli-stromal tumors; A8) Application in the preparation of products for grouping subjects based on ovarian support-stromal tumors.

[0013] A fourth aspect of the present invention provides a method for detecting whether a DICER1 gene mutation has occurred in a sample for non-disease diagnostic purposes, wherein the mutation sites of the DICER1 gene include p.1344, p.1705, p.1709, p.1809, p.1810, and p.1813, and the method includes: Obtain the DNA from the sample to be tested; Using the DNA of the sample to be tested as a template, PCR amplification is performed on the DNA of the sample to be tested using the first and second primers in any of the primer compositions or kits described above to obtain a first amplification product; PCR amplification is performed on the DNA of the sample to be tested using the third and fourth primers in any of the primer compositions or kits described above to obtain a second amplification product; PCR amplification is performed on the DNA of the sample to be tested using the fifth and sixth primers in any of the primer compositions or kits described above to obtain a third amplification product. The first, second, and third amplification products were sequenced, and the results were used to determine whether mutations occurred at the corresponding sites of the DICER1 gene.

[0014] As described above, the sample to be tested is a tumor sample or a paraffin section of a tumor. Further, the tumor is a tumor sample originating from the ovary.

[0015] The fifth aspect of the present invention provides a method for grouping subjects, comprising: Obtain the DNA from the sample to be tested; Using the DNA of the sample to be tested as a template, PCR amplification is performed on the DNA of the sample to be tested using the first and second primers in any of the primer compositions or kits described above to obtain a first amplification product; PCR amplification is performed on the DNA of the sample to be tested using the third and fourth primers in any of the primer compositions or kits described above to obtain a second amplification product; PCR amplification is performed on the DNA of the sample to be tested using the fifth and sixth primers in any of the primer compositions or kits described above to obtain a third amplification product. The first amplification product, the second amplification product, and the third amplification product were sequenced respectively. Based on the sequencing results, it was determined whether mutations occurred at six sites in the DICER1 gene: p.1344, p.1705, p.1709, p.1809, p.1810, and p.1813. If no mutation occurs at any of the six sites or the mutation does not lead to changes in amino acids, the subjects will be classified as either non-ovarian Sertoli-stromal tumors or well-differentiated ovarian Sertoli-stromal tumors. If at least one of the six sites is mutated and leads to changes in amino acids, the subjects will be classified as either moderately or poorly differentiated ovarian Sertoli-stromal tumors.

[0016] As described above, the non-ovarian Sertoli-stromal tumor (FSMT) group refers to the population with a low risk of developing ovarian Sertoli-stromal tumors; the well-differentiated ovarian Sertoli-stromal tumor (BSMT) group refers to the population with a high risk of developing well-differentiated ovarian Sertoli-stromal tumors; and the moderately or poorly differentiated or reticular ovarian Sertoli-stromal tumor (MSMT) group refers to the population with a high risk of developing moderately or poorly differentiated or reticular ovarian Sertoli-stromal tumors.

[0017] A sixth aspect of the present invention provides a system comprising: Amplification module: used to amplify DNA in a sample from a subject using any of the primer compositions described above, to obtain amplification products; Analysis module: used to analyze the amplification products to determine whether mutations have occurred at six sites in the DICER1 gene of the sample to be tested: p.1344, p.1705, p.1709, p.1809, p.1810 and p.1813.

[0018] The system described above also includes: Judgment module: Used to group subjects based on the results of the analysis module.

[0019] A seventh aspect of the present invention provides an electronic device including a memory, a processor, and a computer program stored in the memory and executable on the processor, wherein the processor, when executing the program, implements the method described above for grouping subjects suffering from ovarian Sertoli-stromal tumors.

[0020] The eighth aspect of the present invention provides a non-transitory computer-readable storage medium having a computer program stored thereon, characterized in that, when the computer program is executed by a processor, it implements the method for grouping subjects suffering from ovarian Sertoli-stromal tumors as described above.

[0021] The primer composition provided by this invention can perform PCR amplification on tumor samples or paraffin-embedded DNA samples, and combine this with Sanger sequencing to sequence the amplified products, determining whether mutations have occurred at six sites in the DICER1 gene, leading to amino acid changes. Based on the detection results, subjects can be grouped into non-ovarian Sertoli-stromal tumor (SIST) groups, well-differentiated SIST groups, and moderately to poorly differentiated or reticular SIST groups. This overcomes the shortcomings of traditional methods, such as long processing time and high requirements for physician expertise and experience in interpreting images, providing technical support for the clinical diagnosis of SISTs. Attached Figure Description

[0022] Figure 1 Sequencing results for samples where no mutation occurred at the p.1709 site; Figure 2Sequencing results of a sample in which a mutation occurred at the p.1709 site, resulting in a change from aspartic acid (D) to glycine (G) at the amino acid site; Figure 3 Sequencing results for samples where no mutation occurred at the p.1813 site; Figure 4 Sequencing results of a sample with a mutation at the p.1813 site that resulted in a change from glutamic acid (E) to glycine (G). Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0024] Example 1: Identification of hotspot mutation sites of the DICER1 gene associated with Sertoli-Leydig cell tumors (SLCT) of the ovary. The DICER1 gene is a ribonuclease in the RNase III family that splices hairpin-like RNA and double-stranded RNA into mature miRNA or siRNA containing 21 nucleotides, playing a crucial role in RNA formation. The most important molecular genetic characteristic of SLCT is the presence of germline and somatic mutations in the DICER1 gene. In this embodiment, six hotspot mutations on the DICER1 gene to be detected were identified as p.S1344X, p.E1705X, p.D1709X, p.G1809X, p.D1810X, and p.E1813X, as detailed in Table 1.

[0025] Table 1. Information on six mutation sites in the DICER1 gene

[0026] Example 2, Primer Design Based on the upstream and downstream sequences of the six hotspot mutations to be detected in the DICER1 gene provided in Example 1, primers for PCR amplification were designed, and the nucleotide sequences of the primers are shown in Table 2.

[0027] Table 2. Nucleotide sequences of primers

[0028] The nucleotide sequence of the amplification product (named D1) obtained using the DICER1-F1 and DICER1-R1 primer pairs is shown in SEQ ID NO:7, consisting of 201 nucleotides, as detailed below: SEQ ID NO:7: 5'-tggagcggcttgaaatgcttggcgactcctttttaaagcatgccatcaccacatat ctattttgcacttaccctgatgcgcatgagggccgcctt TCA tatatgagaagcaaaaaggtaagagatgatttttttattttgagcagttaattattcagtgtgcctgaaagtggtttgcagtgttggataatctcagaggatg-3'.

[0029] The nucleotide sequence of the amplification product (named D2) obtained using the DICER1-F2 and DICER1-R2 primer pairs is shown in SEQ ID NO:8, consisting of 301 nucleotides, as detailed below: SEQ ID NO:8: 5'-ttagtttccagaggctttttagtatgatatgtcagatatcctttttgaagaatata tgtatgaaaatgattgtaaatacaaatcttcttcggatttggggatcagttgctatgtggggatagtgtaaatgcttctgcacaagcttacggttccacttcggatcccctcagattgttaccagcgctta GAA ttcctggga G AT gcgattttggactacctcataaccaagcacctttatgaagacccgcggcagcactccccgggggtcctgacagacctgcggtctgccctggtcaacaac-3' The nucleotide sequence of the amplification product (named D3) obtained using the DICER1-F3 and DICER1-R3 primer pairs is shown in SEQ ID NO:9, consisting of 261 nucleotides, as detailed below: SEQ ID NO:9: 5'-aagaaaagaaactacatctgtggactgcctgtaaaagtggcctttttgcttacaag tcacttttccctctgtaatagcttaggagatctgaggaggatgaagagaaagaagaggatattgaagttccaaaggccatg GGGGAT attttt GAG tcgcttgctggtgccatttacatggatagtgggatgtcactggagacagtctggcaggtgtactatcccatgatgcggccactaataggtattgttggctccctttaga-3'.

[0030] In the sequences shown in SEQ ID NO:7-9, the positions marked in bold and underlined are the mutation sites to be observed.

[0031] Example 3: Detection of 6 hotspot mutations in the DICER1 gene in tumor tissue or paraffin samples DNA was extracted from fresh tumor tissue or paraffin-embedded samples. The upstream and downstream sequences of six hotspot mutation sites in the DICER1 gene were amplified using the specific primers and reaction procedure provided in Example 2. The amplified products were subjected to Sanger sequencing. The sequencing results were analyzed, and patients with ovarian Sertoli-stromal tumors were grouped according to whether mutations occurred in the target sequences. The specific steps are as follows: 1. Obtaining tumor DNA DNA was extracted from fresh tumor tissue or paraffin samples using commercially available DNA extraction kits. The total amount and quality of extracted DNA were controlled, requiring that the DNA not be severely degraded, the main band be above 500 bp, and the total amount be above 1000 ng.

[0032] 2. Preparation of the reaction system: Following the reaction system shown in Table 3-5, melt all the components required for PCR at room temperature, vortex to mix, and after preparation, vortex to mix and then briefly centrifuge.

[0033] Table 3. Reaction system required for amplifying the fragment shown in SEQ ID NO:7

[0034] Table 4. Reaction system required for amplifying the fragment shown in SEQ ID NO:8

[0035] Table 5. Reaction system required for amplifying the fragment shown in SEQ ID NO:9

[0036] Table 6. 2X PCR Reaction Solution Formulation

[0037] 3. PCR amplification The above reaction system was subjected to PCR amplification according to the reaction procedure shown in Table 7. After the amplification was completed, the amplification product was obtained.

[0038] Table 7. Reaction Procedure

[0039] 4. Sanger sequencing After amplification, the amplification products were sent to a sequencing company for Sanger sequencing, a one-way sequencing method. The fragment lengths and sequencing primer sequences are shown in Table 8. Table 8. Primers required for Sanger sequencing

[0040] 5. Sequencing Results Analysis Observe the sequencing results of the target positions (c.4030-4032, p.1344) in the sequencing peak diagram of the first amplification product (D1). If the codon at this position is TCA, then no p.S1344X mutation has occurred. If the codon at this position is other, then determine whether its amino acid is serine (S) according to the codon translation table. If it is still serine (S), then no p.S1344X mutation has occurred. If it is other, then a p.S1344X mutation has occurred.

[0041] Observe the sequencing results of the target positions (c.5125-5127, p.1709) in the sequencing peak diagram of the second amplification product (D2). If the codon at this position is GAT, then the p.D1709X mutation has not occurred (e.g., Figure 1 (As shown), if the codon at that position is any other, then determine whether the amino acid is aspartic acid (D) according to the codon table. If it is still aspartic acid (D), then no p.D1709X mutation has occurred. If it is any other, then a p.D1709X mutation has occurred. It is necessary to specify which amino acid the mutation "X" represents (e.g., ...). Figure 2 (As shown).

[0042] Observe the sequencing results of the target positions (c.5113-5115, p.1705) in the sequencing peak diagram of the second amplification product (D2). If the codon at this position is GAA, then no p.E1705X mutation has occurred. If the codon at this position is other, then determine whether its amino acid is glutamic acid (E) according to the codon translation table. If it is still glutamic acid (E), then no p.E1705X mutation has occurred. If it is other, then a p.E1705X mutation has occurred.

[0043] Observe the sequencing results of the target position (c.5425-5427, p.1809) in the sequencing peak diagram of the third amplification product (D3). If the codon at this position is GGG, then no p.G1809X mutation has occurred. If the codon at this position is other, then determine whether its amino acid is glycine (G) according to the codon translation table. If it is still glycine (G), then no p.G1809X mutation has occurred. If it is other, then a p.G1809X mutation has occurred.

[0044] Observe the sequencing results of the target position (c.5428-5430, p.1810) in the sequencing peak diagram of the third amplification product (D3). If the codon at this position is GAT, then no p.D1810X mutation has occurred. If the codon at this position is other, then determine whether its amino acid is aspartic acid (D) according to the codon translation table. If it is still aspartic acid (D), then no p.D1810X mutation has occurred. If it is other, then a p.D1810X mutation has occurred.

[0045] Observe the sequencing results of the target position (c.5428-5430, p.1813) in the sequencing peak diagram of the third amplification product (D3). If the codon at this position is GAG, then the p.E1813X mutation has not occurred (e.g. Figure 3 (As shown), if the codon at that position is any other, then the amino acid is determined according to the codon translation table to be glutamic acid (E). If it is still glutamic acid (E), then no p.E1813X mutation has occurred; if it is any other, then a p.E1813X mutation has occurred (e.g., ...). Figure 4 As shown, the p.E1813G mutation occurred.

[0046] The mutation status of the six sites is summarized. If no mutation occurs at any of them, the diagnosis is non-ovarian Sertoli-stromal cell tumor or well-differentiated ovarian Sertoli-stromal cell tumor. If any of the six sites is mutated, the diagnosis is moderately or poorly differentiated or reticular ovarian Sertoli-stromal cell tumor.

[0047] Example 4: Clinical Sample Test Results Ten samples each of poorly differentiated SLCT, moderately differentiated SLCT, reticular SLCT, well-differentiated SLCT, and non-SLCT patients were collected from Tianjin Central Women and Children's Hospital. Three target fragments of the DICER1 gene were amplified and sequenced using the method described in this kit. Mutations were detected at six sites: p.1344, p.1705, p.1709, p1809, p1810, and p1813. The results are shown in Tables 9-10.

[0048] Table 9. Clinical Sample Test Results

[0049] Table 10. Statistical Results of Clinical Samples

[0050] Statistical analysis showed that 100% of the low- to medium-differentiated SLCT samples had target site mutations, 70% of the samples in the reticular SLCT had target site mutations, and the detection rate of DICER1 target site mutations in high-differentiated SLCT samples and non-SLCT samples was 0%, with a specificity of 100%.

[0051] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer composition, characterized in that, It includes the first primer, second primer, third primer, fourth primer, fifth primer, and sixth primer, wherein: The first primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:1; Therefore, the second primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:2; The third primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:3; The fourth primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:4; The fifth primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:5; The sixth primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:

6.

2. The primer composition according to claim 1, characterized in that, The molar concentration ratio of the first primer to the second primer is 1:1; the molar concentration ratio of the third primer to the fourth primer is 1:1; and the molar concentration ratio of the fifth primer to the sixth primer is 1:

1.

3. A reagent kit, characterized in that, Includes the primer composition as described in claim 1 or 2.

4. The application of the primer composition according to any one of claims 1-2 or the kit according to claim 3, characterized in that, The application is selected from at least one of A1)-A7): A1) Application in detecting whether a mutation has occurred at the p.1344 site of the DICER1 gene in a sample; A2) Application in detecting whether a mutation has occurred at the p.1705 site of the DICER1 gene in a sample; A3) Application in detecting whether a mutation has occurred at the p.1709 site of the DICER1 gene in a sample; A4) Application in detecting whether a mutation has occurred at the p.1809 site of the DICER1 gene in a sample; A5) Application in detecting whether a mutation has occurred at the p.1810 site of the DICER1 gene in a sample; A6) Application in detecting whether a mutation has occurred at the p.1813 site of the DICER1 gene in a sample; A6) Application in the grouping of subjects with ovarian Sertoli-stromal tumors; A7) Application in the preparation of products for grouping subjects with ovarian Sertoli-stromal tumors.

5. A method for detecting whether the DICER1 gene has mutated in a sample for non-disease diagnostic purposes, characterized in that, The mutation sites of the DICER1 gene include p.1344, p.1705, p.1709, p.1809, p.1810, and p.1813, and the method includes: Obtain the DNA from the sample to be tested; Using the DNA of the sample to be tested as a template, PCR amplification is performed on the DNA of the sample to be tested using the primer composition according to any one of claims 1-2 or the first and second primers in the kit according to claim 3 to obtain a first amplification product; PCR amplification is performed on the DNA of the sample to be tested using the primer composition according to any one of claims 1-2 or the third and fourth primers in the kit according to claim 3 to obtain a second amplification product; PCR amplification is performed on the DNA of the sample to be tested using the primer composition according to any one of claims 1-2 or the fifth and sixth primers in the kit according to claim 3 to obtain a third amplification product; The first, second, and third amplification products were sequenced, and the results were used to determine whether mutations occurred at the corresponding sites of the DICER1 gene.

6. A method for grouping subjects, characterized in that, include: Obtain the DNA from the sample to be tested; Using the DNA of the sample to be tested as a template, the DNA of the sample to be tested is amplified by PCR using the primer composition according to any one of claims 1-2 or the first and second primers in the kit according to claim 3 to obtain the first amplification product; The DNA of the sample to be tested was amplified by PCR using the primer composition according to any one of claims 1-2 or the third and fourth primers in the kit according to claim 3 to obtain the second amplification product; The DNA of the test sample was amplified by PCR using the primer composition according to any one of claims 1-2 or the fifth and sixth primers in the kit according to claim 3 to obtain the third amplification product; The first amplification product, the second amplification product, and the third amplification product were sequenced respectively. Based on the sequencing results, it was determined whether mutations occurred at six sites in the DICER1 gene: p.1344, p.1705, p.1709, p.1809, p.1810, and p.1813. If no mutations occur at any of the six sites or the mutations do not lead to changes in amino acids, the subjects will be classified into the non-ovarian Sertoli-stromal tumor group or the well-differentiated ovarian Sertoli-stromal tumor group. If a mutation occurs at at least one of the six sites and results in a change in amino acids, the subject will be classified into a moderately or poorly differentiated ovarian Sertoli-stromal tumor group or a reticular ovarian tumor group.

7. The system, characterized in that, include: Amplification module: used to amplify DNA in a sample from a subject using the primer composition according to any one of claims 1-2 to obtain amplification products; Analysis module: used to analyze the amplification products to determine whether mutations have occurred at six sites in the DICER1 gene of the sample to be tested: p.1344, p.1705, p.1709, p.1809, p.1810 and p.1813.

8. The system according to claim 7, characterized in that, Also includes: Judgment module: Used to group subjects based on the results of the analysis module.

9. An electronic device comprising a memory, a processor, and a computer program stored in the memory and executable on the processor, characterized in that, When the processor executes the program, it implements the method for grouping subjects with ovarian Sertoli-stromal tumors as described in claim 6.

10. A non-transitory computer-readable storage medium having a computer program stored thereon, characterized in that, When the computer program is executed by the processor, it implements the method for grouping subjects with ovarian Sertoli-stromal tumors as described in claim 6.

Images