A torreya grandis MATE transporter protein TgMATE72, its encoding gene and applications

By providing the encoding gene of the MATE transporter TgMATE72 in Torreya grandis and related biological materials, the transport of proanthocyanidin precursors was regulated, which solved the lack of systematic research on proanthocyanidin transport and accumulation in Torreya grandis, and achieved the increase of proanthocyanidin content in plant tissues, thus promoting molecular breeding and quality improvement.

CN122080155APending Publication Date: 2026-05-26ZHEJIANG FORESTRY UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-29
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

In Torreya grandis, systematic research and functional verification of the MATE transporter gene's role in proanthocyanidin transport and accumulation are still unclear. There is a lack of related key genes and their mechanisms of action, which affects molecular breeding and quality improvement of proanthocyanidin-related traits in plants.

Method used

We provided the encoding gene of the MATE transporter TgMATE72 from Torreya grandis and related biological materials. By overexpressing or inhibiting TgMATE72 in heterologous and homologous plant systems, we regulated the transport of proanthocyanidin precursors. We amplified the gene using specific primer pairs and verified its transport function through heterologous expression in Xenopus laevis oocytes.

Benefits of technology

This study has enabled the enhancement of the accumulation levels of proanthocyanidins and their monomers in plant tissues, especially the content of soluble proanthocyanidins, providing a tool for molecular breeding and quality improvement and enhancing the potential for improving proanthocyanidin-related traits in plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122080155A_ABST
    Figure CN122080155A_ABST
Patent Text Reader

Abstract

This invention discloses a Torreya grandis MATE transporter protein TgMATE72, its encoding gene, and its applications. The amino acid sequence of the transporter protein TgMATE72 is shown in SEQ ID NO.2, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.1. This invention also provides the application of the transporter protein TgMATE72 and its encoding gene in regulating the transport of proanthocyanidin precursors and increasing proanthocyanidin content in plants. Based on the combined analysis of transcriptome data from Torreya grandis seed development and the content of proanthocyanidins and their monomers, this invention screened and obtained TgMATE72, and its expression level is positively correlated with the accumulation of catechin monomers. Sequence alignment and phylogenetic analysis show that the transporter protein TgMATE72 belongs to the plant MATE transporter protein family. Heterologous expression and transport activity detection results in Xenopus laevis oocytes show that TgMATE72 can mediate the transport of catechin monomers. This invention provides gene resources and application methods for improving proanthocyanidin-related traits in plants, and can be used for molecular breeding and quality improvement of Torreya grandis and other plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology and genetic engineering technology, specifically relating to a Torreya grandis MATE transporter protein TgMATE72, its encoding gene, and its applications. Background Technology

[0002] Proanthocyanidins (PAs) are an important class of polyphenolic secondary metabolites widely found in plants, mainly composed of flavan-3-ol monomers such as catechins and epicatechins. PAs play a crucial role in plant resistance to abiotic stress, antioxidant defense, and adaptation to environmental changes. They are also natural functional components with significant application value in the food, pharmaceutical, and health industries.

[0003] In plants, the biosynthesis of proanthocyanidins mainly occurs in the cytoplasm, and their stable accumulation usually depends on the transport of synthesized proanthocyanidin precursors or related metabolites to cellular compartments such as vacuoles for storage. Therefore, transport proteins involved in the transmembrane transport of proanthocyanidins and their monomers are considered to be one of the important factors regulating the level of proanthocyanidin accumulation.

[0004] The MATE (Multidrug and Toxic Compound Extrusion) transporter family is a class of secondary active transporters driven by proton or sodium ion electrochemical gradients. Widely distributed in plants, they participate in the transmembrane transport of various secondary metabolites, toxic substances, and secondary metabolites. Previous studies have shown that plant MATE family members can mediate the efflux of organic acids (such as citric acid) to promote aluminum ion tolerance, and participate in the transport and detoxification of secondary metabolites such as alkaloids, suggesting that this family has diverse functions in plant stress adaptation and secondary metabolic regulation. However, in Torreya grandis, an important economic forest tree, systematic research and functional verification of the role of MATE transporter genes in the regulation of proanthocyanidin transport and accumulation are lacking. The key genes and their mechanisms of action remain unclear, thus requiring urgent investigation. Summary of the Invention

[0005] To address the aforementioned issues, this invention provides a Torreya grandis MATE transporter protein TgMATE72, its encoding gene, and its applications. This encoding gene / protein can mediate the transport of catechin monomers and participate in regulating the accumulation of proanthocyanidins in plants, thereby providing new gene resources and technical means for molecular breeding and quality improvement of proanthocyanidin-related traits in plants.

[0006] The amino acid sequence of the Torreya grandis MATE transporter TgMATE72 described in this invention is shown in SEQ ID NO.2. Heterologous expression and transport activity assays in Xenopus laevis oocytes confirmed that the transporter TgMATE72 can mediate the transport of catechin monomers.

[0007] This invention also provides a gene encoding the aforementioned Torreya grandis MATE transporter TgMATE72, the nucleotide sequence of which is shown in SEQ ID NO.1. This gene was selected based on the dynamic characteristics of proanthocyanidin accumulation during Torreya grandis seed (including seed coat and kernel) development, through joint analysis of transcriptome and proanthocyanidin and its monomer (catechin monomer) content data. This gene is associated with proanthocyanidin accumulation.

[0008] This invention also provides a primer pair for amplifying the encoding gene of the above-mentioned Torreya grandis MATE transporter TgMATE72, the primer pair being: GFP-TgMATE72-FP: 5′-GACGAGCTCGGTACCATGGCAGACACCCTCCACTC - 3′; GFP-TgMATE72-RP: 5′-GCTCACCATGTCGACAGGAACGTTTCCATTTTCAA-3′.

[0009] The present invention also provides a biological material related to the coding gene of the above-mentioned Torreya grandis MATE transporter TgMATE72, which is an expression cassette, recombinant vector, host cell or recombinant microorganism containing the above-mentioned coding gene or its functional fragment.

[0010] This invention also provides the application of the encoding gene of the above-mentioned Torreya grandis MATE transporter TgMATE72 or the above-mentioned Torreya grandis MATE transporter TgMATE72 in regulating the transport of proanthocyanidin precursors and increasing proanthocyanidin content in plants. Promoting the expression of the encoding gene in plant tissues (e.g., overexpression) can increase the accumulation level of proanthocyanidins and their monomers; inhibiting the expression of the encoding gene (e.g., virus-induced gene silencing) can reduce the content of proanthocyanidins and their monomers.

[0011] The aforementioned proanthocyanidin precursors are catechin monomers, and the aforementioned catechin monomers are at least one of catechin (C), epicatechin (EC), gallocatechin (GC), and epigallocatechin (EGC).

[0012] The plant tissues mentioned above include tobacco leaves and Torreya grandis seed tissues. The above regulation can be used to improve proanthocyanidin-related traits in Torreya grandis and other plants.

[0013] Beneficial Effects: The transporter protein TgMATE72 and its encoding gene (TgMATE72) of this invention have been verified to mediate the transport of catechin monomers through a heterologous expression system of Xenopus laevis oocytes, thus providing a clear functional gene resource for the study and application of proanthocyanidin precursor transport mechanisms. This invention also verifies the function of TgMATE72 by overexpressing it in heterologous plant systems (tobacco leaves) and homologous tissue systems (torreya seeds), and by inhibiting its expression in Torreya seeds. This demonstrates that TgMATE72 can positively regulate the content of proanthocyanidins and their monomers, and can be used to increase the accumulation level (i.e., content) of proanthocyanidins and their monomers in plant tissues, especially the accumulation level (i.e., content) of soluble proanthocyanidins, showing good application potential. The primer pairs, expression cassettes / vectors, and related biological materials provided by this invention can serve as tools for molecular breeding and quality improvement, facilitating the molecular design and improvement of proanthocyanidin-related traits in Torreya and other plants. Attached Figure Description

[0014] Figure 1 Figure 1 shows the results of proanthocyanidin and its monomer content determination in Torreya grandis seed coat and kernel. Figure 2 shows the soluble proanthocyanidin content in Torreya grandis seed coat (top) and kernel (bottom); Figure 3 shows the insoluble proanthocyanidin content in Torreya grandis seed coat and kernel; Figure 4 shows the gallocatechin content in Torreya grandis seed coat and kernel; Figure 5 shows the epicatechin content in Torreya grandis seed coat and kernel; Figure 6 shows the epicatechin content in Torreya grandis seed coat and kernel. Figure 2 The figures show the screening and expression correlation analysis results of TgMATE72. A represents the gene co-expression clustering tree and dynamic splicing module results constructed based on Torreya grandis seed coat transcriptome data; B represents the weighted gene co-expression network analysis (WGCNA) and module association analysis results related to soluble proanthocyanidins based on Torreya grandis seed coat transcriptome data; C represents the expression level analysis results of TgMATE72 in Torreya grandis seed coat (top) and kernel (bottom); and D represents the correlation analysis results between TgMATE72 expression level and soluble proanthocyanidin content. Figure 3 Figure A shows the sequence alignment and phylogenetic analysis results of the transporter protein TgMATE72; where A is the sequence alignment results of TgMATE72 with other plant MATE family proteins; and B is the phylogenetic analysis results of TgMATE72 with other plant MATE proteins. Figure 4The results show the effects of transient overexpression of TgMATE72 in tobacco leaves on the accumulation of proanthocyanidins and their monomers. Figure A shows the TgMATE72 expression level in tobacco leaves after transient overexpression; Figure B shows the proanthocyanidin content in tobacco leaves after transient overexpression of TgMATE72; and Figure C shows the catechin monomer content in tobacco leaves after transient overexpression of TgMATE72. Figure 5 The results show the effects of transient overexpression of TgMATE72 in Torreya grandis seeds on the accumulation of proanthocyanidins and their monomers. Figure A shows the TgMATE72 expression level after transient overexpression in Torreya grandis seeds; Figure B shows the proanthocyanidin content after transient overexpression in Torreya grandis seeds; and Figure C shows the catechin monomer content after transient overexpression in Torreya grandis seeds. Figure 6 Figure 1 shows the effect of TgMATE72 gene silencing on the content of proanthocyanidins and their monomers in Torreya grandis seeds. Figure 2 shows the TgMATE72 expression level detection results after gene silencing; Figure 3 shows the proanthocyanidin content determination results in Torreya grandis seeds after TgMATE72 gene silencing; Figure 4 shows the catechin monomer content determination results in Torreya grandis seeds after TgMATE72 gene silencing. Figure 7 The image shows the results of catechin monomer transport detection after heterologous expression of TgMATE72 in Xenopus laevis oocytes. Detailed Implementation

[0015] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0016] Unless otherwise specified, conditions in the examples were performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the vectors mentioned in the examples were constructed according to standard procedures in the field of genetic engineering. Unless otherwise specified, the materials and reagents used were commercially available. All chemical reagents used in the examples were imported or domestically produced analytical grade.

[0017] Example 1: Measurement of physiological data

[0018] 1. Determination of soluble / insoluble proanthocyanidin content in seed coat and kernel of Torreya grandis at different developmental stages

[0019] Seed coat and kernel samples of *Torreya grandis* at different developmental stages (90, 105, 120, 135, and 150 days after seed scale emergence) were collected from the 'Xifei' variety of *Torreya grandis* at the Panmugang Experimental Base in Lin'an District, Hangzhou City, Zhejiang Province. The samples were freeze-dried and ground into powder. Approximately 0.1 g of the freeze-dried powder was weighed and added to 3 mL of 70% acetone-0.1% ascorbic acid. The mixture was sonicated for 30 min at 30°C, and the extraction was repeated once. The supernatants were combined. After extraction with chloroform-n-hexane, the soluble proanthocyanidins were concentrated and reacted with DMACA solution in the dark. The residue was vortexed and sonicated with butanol-HCl 95:5, and then hydrolyzed with ferric ammonium sulfate solution at 100°C. The absorbance at 640 nm and 550 nm was measured. Using (+)-catechin and proanthocyanidin B1 as standards, simultaneous quantification of soluble and insoluble proanthocyanidins was achieved. The results are as follows: Figure 1 A- Figure 1 As shown in B.

[0020] 2. HPLC determination of proanthocyanidin monomers in Torreya grandis seed coat and kernel

[0021] Approximately 0.5 g of lyophilized sample was weighed and extracted twice with 80% methanol-0.05% HCl at different times using ultrasonic extraction. The supernatants were combined, concentrated under vacuum, and redissolved in 1 mL of the above 80% methanol solution. The supernatant was filtered through a 0.22 μm organic filter membrane. The sample was then processed on an SB-C18 column at 1 mL min... -1 Detection was performed at 280 nm using a gradient elution of formic acid-water and acetonitrile. Standard curves were established using C, EC, GC, and EGC standards to achieve simultaneous quantification of the four monomers. Results are as follows: Figure 1 C- Figure 1 As shown in F.

[0022] Example 2: Cloning and Sequence Analysis of the TgMATE72 Gene

[0023] Total RNA was extracted from Torreya grandis seeds (collected from the 'Xifei' variety at the Panmugang Experimental Base in Lin'an District, Hangzhou City, Zhejiang Province), and cDNA was obtained by reverse transcription. Using the cDNA as a template, the coding sequence of the TgMATE72 gene was amplified using specific primer pairs: GFP-TgMATE72-FP: 5′- GACGAGCTCGGTACCATGGCAGACACCCTCCACTC - 3′; GFP-TgMATE72-RP: 5′- GCTCACCATGTCGACAGGAACGTTTCCATTTTCAA - 3′. The PCR amplification products were recovered and purified after agarose gel electrophoresis, and then inserted into a vector via homologous recombination or restriction endonuclease ligation to obtain recombinant plasmids containing the TgMATE72 coding sequence. These recombinant plasmids were transformed with *E. coli*, screened for positive clones, and sequenced for verification. Sequencing results showed that the obtained TgMATE72 gene nucleotide sequence is shown in SEQ ID NO. 1. Further sequence analysis revealed that the sequence encodes the MATE transporter TgMATE72, the amino acid sequence of which is shown in SEQ ID NO.2.

[0024] Example 3: Screening and Correlation Analysis of TgMATE72

[0025] During the seed development of Torreya grandis (at 90, 105, 120, 135, and 150 days after seed scale emergence), seed coat tissue samples were selected for transcriptome sequencing. The soluble proanthocyanidins measured in Example 1 were used as a characterization index for proanthocyanidins in subsequent trait association analysis. Total RNA extracted in Example 2 was used to construct a library for sequencing. Unigene was assembled using Trinity, and transcripts were quantified using RSEM (RNA-Seq by Expectation-Maximization) software to calculate TPM (Transcripts Per Million). Genes with TPM>1 and CV>0.2 were retained for Weighted Gene Co-expression Network Analysis (WGCNA). Using soluble proanthocyanidin content as the trait vector, a soft-threshold power exponent β=12 was selected to construct the co-expression network. Module-trait correlations were calculated, and target modules with r>0.8 and P<0.01 related to soluble proanthocyanidin were screened. For genes within a module with GS>0.9 and MM>0.9, combined with Pfam transporter domain annotation, candidate genes of the MATE family were obtained, resulting in TgMATE72. Results are as follows: Figure 2 A- Figure 2 As shown in B.

[0026] Subsequently, to verify the expression characteristics of TgMATE72 and its relationship with proanthocyanidin-related traits, RT-qPCR was used to detect the expression levels of TgMATE72 in the seed coat and kernel tissues of Torreya grandis at different developmental stages, and correlation analysis was performed with the changing trends of soluble proanthocyanidin content in the corresponding tissues. The results are as follows: Figure 2 C- Figure 2 As shown in Figure D, the results indicate that the expression levels of TgMATE72 in seed coat and kernel were positively correlated with the changing trends of soluble proanthocyanidin content, suggesting that TgMATE72 is related to proanthocyanidin-related metabolic processes.

[0027] Example 4: Sequence alignment and phylogenetic analysis of the transporter protein TgMATE72

[0028] The amino acid sequence of the transporter TgMATE72 encoded by TgMATE72 was compared with the sequence of previously reported plant MATE transporters, and a phylogenetic tree was constructed. The database accession numbers for the MATE transporter sequences used for alignment include: DkMATE5 (Diospyros kaki, MW672056), DkMATE1 (Diospyros kaki, JQ820156), AtTT12 (Arabidopsis thaliana, NP_191462), MtMATE1 (Medicago truncatula, ACX37118), CaMATE1 (Cicer arietinum L., XP_004491273), FaTT12-1 (Fragaria ananassa, KY851294), MdMATE1 (Malus domestica, ADO22709.1), MdMATE1 (Malus domestica, ADO22711.1), GhTT12 (Gossypium hirsutum, NP_001314298), VvMATE1 (Vitis vinifera (XP_002282907), VvMATE1 (Vitis vinifera,XP_002282932), results as follows Figure 3 As shown in the analysis, the transporter TgMATE72 has high homology with DkMATE5, a member of the persimmon MATE transporter family, and belongs to the MATE transporter family.

[0029] Example 5: Effect of TgMATE72 overexpression in tobacco on proanthocyanidin accumulation

[0030] The TgMATE72 coding sequence was cloned into a plant overexpression vector to obtain a recombinant expression vector / recombinant vector containing the TgMATE72 expression cassette, denoted as TgMATE72-OE; simultaneously, an empty vector (e.g., pCAMBIA1300-GFP) without the TgMATE72 insert was prepared. The TgMATE72-OE recombinant vector and the empty vector were transformed into Agrobacterium strain GV3101, respectively, to obtain host cells carrying the TgMATE72-OE recombinant vector, i.e., recombinant Agrobacterium (recombinant microorganism), and control Agrobacterium carrying the empty vector. The recombinant Agrobacterium and control Agrobacterium were cultured to appropriate concentrations, centrifuged to collect the cells, resuspended in infection buffer, and the bacterial concentration was adjusted to OD0.05. 600Approximately 0.6–0.8. The overexpressing bacterial culture was introduced into tobacco leaf tissue via leaf injection, with leaves treated with empty vector bacterial culture serving as a control (denoted as EV). Samples were collected approximately 7 days after injection, and the expression level of TgMATE72 in tobacco leaves was detected using RT-qPCR. The contents of proanthocyanidins (soluble and insoluble fractions) and catechin monomers in the leaves were also determined. Results are as follows: Figure 4 As shown, compared with EV, the content of soluble proanthocyanidins and their monomers in tobacco leaves of the TgMATE72-OE group was significantly increased, with the GC content increasing by up to about 13 times, indicating that TgMATE72 is involved in the regulation of proanthocyanidin accumulation.

[0031] Example 6: Effect of TgMATE72 overexpression in Torreya grandis seeds on proanthocyanidin accumulation

[0032] The TgMATE72 overexpression vector (denoted as TgMATE72-OE) from Example 5 was used to transform Agrobacterium strain GV3101, and an infection suspension was prepared. The bacterial concentration was adjusted to OD. 600 Approximately 0.6–0.8; an Agrobacterium infection suspension carrying an empty vector was used as a control (denoted as EV). The infection suspension was injected into Torreya grandis seed tissue for transient overexpression, and samples were collected approximately 7 days after injection. The expression level of TgMATE72 in Torreya grandis seed tissue was detected by RT-qPCR, and the increase was approximately 5-fold (e.g., 0.6–0.8). Figure 5 As shown in A), the contents of proanthocyanidins (soluble and insoluble fractions) and catechin monomers (e.g., as shown in Figure A) were determined. Figure 5 B- Figure 5 (As shown in C). Figure 5 It can be seen that after overexpression of TgMATE72, the soluble proanthocyanidins in Torreya grandis seed tissue increased by more than 60%, and the contents of catechin monomers GC, C and EC were significantly increased, further verifying the regulatory role of TgMATE72 in the accumulation of proanthocyanidins in Torreya grandis.

[0033] Example 7: Effects of TgMATE72 gene silencing on proanthocyanidin accumulation

[0034] Virus-induced gene silencing technology was used to suppress the expression of the TgMATE72 gene in Torreya grandis, for example, using the VIGS system based on tobacco cracking virus (TRV). The TRV2-TgMATE72 and TRV1 plasmids were transformed into Agrobacterium strain GV3101, cultured to suitable concentrations, and then mixed in equal volumes. The concentration of the mixed bacterial solution was adjusted to a suitable range (e.g., OD). 600Approximately 0.6–0.8 μL of the mixed bacterial solution was incubated in the dark for about 3 hours. The solution was injected into Torreya grandis seeds using a syringe, with approximately 200 μL injected into each seed (denoted as TgMATE72-VIGS); an empty vector (TRV1+TRV2) was used as a control (denoted as VIGS). Samples were collected approximately 7 days after injection. The inhibitory effect of TgMATE72 expression was detected by RT-qPCR, and the contents of proanthocyanidins (soluble and insoluble fractions) and catechin monomers in the Torreya grandis seed tissue were measured. Results are as follows: Figure 6 As shown, the results indicate that, compared with the control, the expression level of TgMATE72 decreased significantly, resulting in a significant decrease in soluble proanthocyanidins in Torreya grandis seed tissues, and a significant decrease in the content of key monomers GC, C, and EC, while EGC showed no significant change. This suggests that TgMATE72 is involved in the regulation of proanthocyanidin accumulation in Torreya grandis.

[0035] Example 8: Validation of heterologous expression and transport activity of TgMATE72 in Xenopus laevis oocytes

[0036] The TgMATE72 coding sequence was inserted into an in vitro transcription vector (e.g., the pGEMHE-related vector) suitable for oocyte expression, and after linearization, TgMATE72 cRNA was obtained through in vitro transcription. The cRNA was injected into Xenopus laevis oocytes via microinjection at a dose of approximately 50 nL / oocyte; these oocytes injected with TgMATE72 cRNA were designated TgMATE72-OE; oocytes injected with empty vector cRNA served as a control (designated EV). The cells were cultured at 18°C ​​for approximately 48 hours to obtain protein expression. Subsequently, catechin monomer substrates, including GC, EGC, C, and EC, were added to the oocyte incubation system for 2–24 hours. After incubation, oocytes were collected, and the content of catechin monomers within the oocytes was measured. The TgMATE72 expression group was compared with the empty vector control group. Results are as follows: Figure 7 As shown, the results indicate that, compared with the empty vector control group, the contents of catechin monomers GC, C, and EC in oocytes expressing TgMATE72 were significantly increased, indicating that TgMATE72 has the function of mediating the transport of catechin monomers.

[0037] In summary, the TgMATE72 gene of this invention, through overexpression and gene silencing experiments in plants and heterologous expression and transport verification, demonstrates that the TgMATE72 gene and its encoded transporter protein TgMATE72 are involved in the regulation of catechin monomer transport and proanthocyanidin accumulation, and can be used for molecular breeding and quality improvement of proanthocyanidin-related traits in plants.

Claims

1. A Torreya grandis MATE transporter protein TgMATE72, characterized in that, The amino acid sequence of the transporter protein TgMATE72 is shown in SEQ ID NO.

2.

2. A gene encoding the Torreya grandis MATE transporter TgMATE72 as described in claim 1, characterized in that, The encoding gene is a nucleotide sequence as shown in SEQ ID NO.

1.

3. A primer pair for amplifying the gene encoding the Torreya grandis MATE transporter TgMATE72 as described in claim 2, characterized in that, The primer pair is GFP- TgMATE72 -FP: 5′-GACGAGCTCGGTACCATGGCAGACACCCTCCACTC - 3′; GFP- TgMATE72 -RP: 5′-GCTCACCATGTCGACAGGAACGTTTCCATTTTCAA-3′.

4. A biomaterial related to the gene encoding the Torreya grandis MATE transporter TgMATE72 as described in claim 2, characterized in that, The biological material is an expression cassette, recombinant vector, host cell, or recombinant microorganism containing the coding gene or its functional fragment.

5. The application of the gene encoding the Torreya grandis MATE transporter TgMATE72 as described in claim 1 or the Torreya grandis MATE transporter TgMATE72 as described in claim 2 in regulating the transport of plant proanthocyanidin precursors and increasing proanthocyanidin content.

6. The application of the encoding gene of Torreya grandis MATE transporter TgMATE72 or Torreya grandis MATE transporter TgMATE72 according to claim 5 in regulating the transport of plant proanthocyanidin precursors and increasing proanthocyanidin content, characterized in that, The proanthocyanidin precursor is a catechin monomer, and the catechin monomer is at least one of catechin, epicatechin, gallocatechin, and epigallocatechin.