Recombinant adeno-associated virus vector overexpressing the Rlim gene, recombinant adeno-associated virus and its application in increasing milk production in animals

Abstract

This invention relates to the fields of animal genetics and breeding and biotechnology, and particularly to an overexpression method. Rlim Recombinant adeno-associated virus (AAV) vector, recombinant AAV, and its application in increasing milk production in animals. This invention utilizes a recombinant AAV vector to specifically overexpress a gene in mammary tissue. Rlim This study aims to provide a highly efficient, safe, and targeted approach to enhance lactation performance, thereby filling the technological gap in the application of this gene in lactation regulation and offering novel strategies and pathways for improving livestock production traits and potential interventions for related human health issues.

Description

Technical Field

[0001] This invention relates to the fields of animal genetics and breeding and biotechnology, and particularly to an overexpression method. Rlim Recombinant adeno-associated virus vectors, recombinant adeno-associated viruses, and their application in increasing milk production in animals. Background Technology

[0002] Lactation is a core physiological process for mammals to maintain the survival and growth of their offspring, and its regulatory mechanisms are highly evolutionarily conserved. This ability not only directly relates to the economic benefits of the livestock industry but also has a profound impact on human maternal and infant health. In animal husbandry, milk yield is a key indicator determining the milk production efficiency of dairy animals and the reproductive performance of meat-producing breeding stock, directly affecting the output and efficiency of the breeding cycle. Meanwhile, in the field of human health, insufficient postpartum lactation is a common clinical challenge, which not only affects early infant development but is also closely related to the physical and mental health of the mother.

[0003] Currently, methods to enhance lactation capacity face bottlenecks in both agriculture and medicine. In livestock production, methods mainly rely on genetic selection, nutritional regulation, and exogenous hormone intervention. These methods often suffer from long cycles, high costs, unstable effects, and potential animal welfare and food safety risks. In clinical practice, methods rely heavily on lactation guidance and limited drug support, often failing to fundamentally improve mammary gland secretion function at the physiological level. With the development of molecular biology, precise regulation of lactation function at the gene level has become a cutting-edge direction. However, current research focuses on a few known signaling pathways such as prolactin, resulting in relatively limited target selection and a lack of gene delivery technologies that can achieve mammary tissue-specific, efficient, and safe delivery.

[0004] Rlim The RING finger LIM domain-interacting protein (RING finger LIM) is a key factor involved in transcriptional regulation and protein degradation, playing important roles in cell differentiation and embryonic development. However, the specific mechanisms by which this gene plays a role in mammary gland development and lactation regulation have not been systematically elucidated, and practical research on its application to improve lactation performance is particularly lacking. Therefore, exploring its potential is crucial. Rlim Discovering novel gene functions in lactation regulation and developing reliable technologies to target mammary tissue are crucial for overcoming existing bottlenecks. This will not only provide entirely new strategies for genetic improvement in animal husbandry but also lay a necessary scientific foundation for exploring physiological intervention pathways for related human health issues in the future. Summary of the Invention

[0005] To overcome the shortcomings and drawbacks of existing technologies, the primary objective of this invention is to provide an overexpression... Rlim Recombinant adeno-associated virus vector of genes.

[0006] Another object of the present invention is to provide an overexpression of serotype 9 (AAV9) obtained by packaging with the above-described vector. Rlim Recombinant adeno-associated virus.

[0007] Another object of the present invention is to provide the application of the above-mentioned recombinant adeno-associated virus vector or recombinant adeno-associated virus in increasing milk production in animals.

[0008] The fourth objective of this invention is to provide a method for increasing milk production in mice or for constructing a high-milk-production mouse model.

[0009] The objective of this invention is achieved through the following technical solution: An overexpression Rlim The method for preparing a recombinant adeno-associated virus vector of a gene includes the following steps: (1) In Rlim A P2A sequence is added to the 3' end of the gene's nucleotide sequence to obtain the Rlim+P2A nucleotide sequence; then homologous arms are added to both ends of the Rlim+P2A nucleotide sequence, and gene synthesis is performed to obtain the Rlim+P2A fragment with homologous arms, wherein the nucleotide sequence of Rlim+P2A is shown in SEQ ID NO.1. (2) The recombinant adeno-associated virus vector was linearized and then ligated with the Rlim+P2A fragment with homologous arms synthesized in step (1) through homologous recombination to obtain overexpression. Rlim Recombinant adeno-associated virus vector of genes.

[0010] The steps described in step (1) Rlim Genes can be derived from human, mouse, bovine, or swine sources, etc. Rlim Gene.

[0011] The vector described in step (2) contains the following elements: AAV2 ITR, CMV promoter, EGFP, and hGH polyA.

[0012] The carrier described in step (2) preferably includes the following element: Human β-globin intron.

[0013] The vector mentioned in step (2) can be pAAV-CMV(589bp)-EGFP-hGH polyA or pAAV-CMV(1035bp) EGFP-hGH polyA.

[0014] The overexpression described in step (2) Rlim The preferred nucleotide sequence of the recombinant adeno-associated virus vector is shown in SEQ ID NO.2 or SEQ ID NO.3.

[0015] An overexpression Rlim Recombinant adeno-associated virus (AAV) of the above gene overexpression Rlim The gene was obtained by co-transfecting a recombinant adeno-associated virus vector, helper plasmid pHelper Vector, and pRep2 / Cap9 Vector into HEK293T cells.

[0016] The overexpression Rlim The method for preparing recombinant adeno-associated virus (AAV) includes the following steps: (1) The above recombinant adeno-associated virus vector and helper plasmids pHelperVector and pRep2 / Cap9 Vector were added to DMEM medium to obtain solution A; polyethyleneimine (PEI) was added to DMEM medium to obtain solution B; solution B was slowly added to solution A in equal volume, mixed and allowed to stand to form a transfection complex. (2) The transfection complex was added to HEK293T cells and transfected for 48-72 h. The culture supernatant and cells were harvested separately. (3) Add cell lysis buffer containing nuclease to the harvested cells to lyse the cells and centrifuge them, and collect the cell lysis supernatant; centrifuge the harvested culture medium supernatant, collect the supernatant, add PEG8000 to the final concentration of PEG8000 to 12% (w / v), precipitate at low temperature, centrifuge, remove the supernatant, resuspend the precipitate with cell lysis buffer, and mix it with the collected cell lysis supernatant to obtain recombinant adeno-associated virus solution; (4) The recombinant adeno-associated virus solution obtained in step (3) is further purified to obtain overexpressed adeno-associated virus solution. Rlim Recombinant adeno-associated virus.

[0017] The preferred mass ratio of the recombinant adeno-associated virus vector to the helper plasmids pHelperVector and pRep2 / Cap9Vector in step (1) is 1:1:1.

[0018] The preferred mass ratio of polyethyleneimine to total DNA in step (1) is 1:(1~3).

[0019] The preferred settling time in step (1) is 30-60 min.

[0020] The preferred conditions for low-temperature precipitation in step (3) are precipitation at 4°C for 12-16 h.

[0021] The purification process described in step (4) includes iodixanol density gradient centrifugation purification and ultrafiltration concentration.

[0022] The application of the recombinant adeno-associated virus vector or recombinant adeno-associated virus in increasing milk production in animals.

[0023] A method for increasing milk production in mice or establishing a high-milk-producing mouse model includes the following steps: The recombinant adeno-associated virus was injected into the mammary glands of mice.

[0024] The preferred injection dose of the recombinant adeno-associated virus is 1.25 × 10⁻⁶. 11 GC.

[0025] The preferred injection volume of the recombinant adeno-associated virus is 25 μL.

[0026] The preferred time for injection of the recombinant adeno-associated virus is on the 10.5th day of pregnancy.

[0027] The preferred injection site for the recombinant adeno-associated virus is the mammary duct of the fourth pair of right mammary glands in female mice.

[0028] The application of the above-mentioned high-lactation mouse model in lactation research or drug research for the treatment of related lactation diseases.

[0029] Technical principle of this invention: To address the problems and shortcomings of existing technologies, this invention proposes a method for specifically overexpressing recombinant adeno-associated virus (rAAV) in breast tissue via a recombinant adeno-associated virus (rAAV) vector. Rlim This study aims to provide a highly efficient, safe, and well-targeted technology for enhancing lactation performance, thereby filling the technological gap in the application of this gene in lactation regulation. It also offers novel strategies and approaches for improving livestock production traits and potential interventions in related human health issues, as detailed below: This invention achieves localized overexpression of rAAV in mouse mammary tissue via intraductal injection of rAAV. Rlim The gene significantly increased milk production, and the vector construction, intervention time, and dosage were optimized, as follows: ① Viral vector construction: The pAAV-CMV(1035bp)-EGFP-hGH polyA plasmid was selected for viral vector construction. Its CMV promoter and intron Human β-globin intron elements form a complex regulatory element to optimize gene expression.

[0030] ② Timing of intervention: Intervention is preferred in the second trimester (e.g., day 10.5) as it is more effective than in the third trimester.

[0031] ③Effective dose: 1.25 × 10⁻⁶ 11 Single-papillary injection of GC virus doses can achieve more significant improvements in gene expression and phenotype.

[0032] In summary, this invention discloses and confirms for the first time... RlimOverexpression of the gene in mammalian mammary tissue can directly and effectively increase milk production.

[0033] The present invention has the following advantages and effects compared with the prior art: (1) This invention utilizes recombinant adeno-associated virus (rAAV) to directly target mammary cells via minimally invasive intraductal injection, achieving localized, efficient, and stable targeting. Rlim Gene delivery and expression significantly increase milk production, avoiding the off-target effects and waste associated with systemic drug administration.

[0034] (2) The rAAV provided by the present invention has long-term expression ability and low immunogenicity, which ensures that the lactation-promoting effect is long-lasting and has high safety for mammary tissue and dairy products with low risk of side effects, so that it has good biocompatibility and long-term safety potential when it is transformed and applied.

[0035] (3) This invention breaks through the limitations of traditional genetic selection or hormone regulation, and provides a precise and innovative strategy to improve lactation performance. It is expected to increase milk production without increasing feeding costs or introducing exogenous hormones, and has significant economic benefits and industrial application potential.

[0036] (4) This invention also provides a new perspective for a deeper understanding of the regulatory mechanism of mammary gland secretion function. Its technical principle and safe and controllable delivery method demonstrate the potential cross-species and cross-domain application value for future exploration of human postpartum lactation or mammary gland function reconstruction and other health fields.

[0037] (5) The process of this invention is clear and highly reproducible. Standardized parameters have been established in mouse models, providing a solid feasibility basis for its application to large economic animals and future clinical applications. Attached Figure Description

[0038] Figure 1 This is a viral vector map from Example 1, where A: pAAV-CMV(589bp)-EGFP-hGH polyA, and B: overexpression. Rlim The gene pAAV-CMV(589bp)-mRlim-P2A-EGFP-hGH polyA.

[0039] Figure 2 These are staining images of breast tissue after intraductal injection of different volumes of trypan blue solution. Among them, 22 μL injection: the staining result of breast tissue after injection of 22 μL of 0.1% trypan blue solution, and 25 μL injection: the staining result of breast tissue after injection of 25 μL of 0.1% trypan blue solution.

[0040] Figure 3 On day 16.5 of gestation, female mice were injected with 2.5 × 10⁻⁶ mmol / L mammary glands. 10Fluorescence images of breast tissue after GC rAAV administration, where L5d: fluorescence in breast tissue on day 5 of lactation, L9d: fluorescence in breast tissue on day 9 of lactation, L13d: fluorescence in breast tissue on day 13 of lactation, NC-1: control group, OE-1: overexpression. Rlim Group.

[0041] Figure 4 On day 16.5 of gestation, female mice were injected with 2.5 × 10⁻⁶ mmol / L mammary glands. 10 The results of the analysis of the effect of GC rAAV on lactation yield are shown in the figure, where NC-1: control group, OE-1: overexpression. Rlim Group, * indicates P<0.05.

[0042] Figure 5 On day 16.5 of gestation, female mice were injected with 2.5 × 10⁻⁶ mmol / L mammary glands. 10 GC rAAV followed by qRT-PCR detection of L9d and L13d breast tissue Rlim Genes and Csn2 Gene expression level analysis results, where NC-1: control group, OE-1: overexpression. Rlim Group, * indicates P<0.05.

[0043] Figure 6 This is a viral vector map from Example 3, where A: pAAV-CMV(1035bp)-EGFP-hGH polyA, and B: overexpression. Rlim The gene is pAAV-CMV(1035bp)-mRlim-P2A-EGFP-hGH polyA.

[0044] Figure 7 On day 10.5 of gestation, female mice were injected with 1.25 × 10⁻⁶ ppm of the drug into their mammary glands. 11 Fluorescence images of breast tissue after GC rAAV administration, where L5d: day 5 of lactation, L9d: day 9 of lactation, L13d: day 13 of lactation, NC-2: control group, OE-2: overexpression. Rlim Group 1: Natural refers to the mammary gland state of female mice under natural light, while Fluorescence refers to the fluorescence state of mammary gland tissue of female mice under blue excitation light.

[0045] Figure 8 On day 10.5 of gestation, female mice were injected with 1.25 × 10⁻⁶ ppm of the drug into their mammary glands. 11 The results of the analysis of the effect of GC rAAV on lactation yield are shown in the figure, where NC-2: control group, OE-2: overexpression. Rlim Group, ** indicates P<0.01.

[0046] Figure 9 On day 10.5 of gestation, female mice were injected with 1.25 × 10⁻⁶ ppm of the drug into their mammary glands. 11GC rAAV followed by qRT-PCR detection of L9d breast tissue Rlim Genes and Csn2 Gene expression level analysis results, where NC-2: control group, OE-2: overexpression. Rlim Group, * indicates P<0.05.

[0047] Figure 10 On day 10.5 of gestation, female mice were injected with 1.25 × 10⁻⁶ ppm of the drug into their mammary glands. 11 Morphological images of L9d breast tissue observed after GC rAAV HE staining (scale bar 50 μm), where NC-2: control group, OE-2: overexpression. Rlim Group.

[0048] Figure 11 On day 10.5 of gestation, female mice were injected with 1.25 × 10⁻⁶ ppm of the drug into their mammary glands. 11 Immunohistochemical staining results of RLIM protein in L9d breast tissue after GC rAAV (scale bar 100 μm), where NC-2: control group, OE-2: overexpression. Rlim Group, *** indicates P<0.001.

[0049] Figure 12 On day 10.5 of gestation, female mice were injected with 1.25 × 10⁻⁶ ppm of the drug into their mammary glands. 11 Image showing the results of immunofluorescence detection of CSN2 protein in L9d breast tissue after GC rAAV (scale bar: 100 μm). NC-2: control group; OE-2: overexpression. Rlim Group, *** indicates P<0.001. Detailed Implementation

[0050] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0051] Unless otherwise specified, all instruments, reagents and materials used in the following examples are commercially available.

[0052] The main materials and reagents used in this invention are as follows: The mice used in the examples were ICR female mice, purchased from Spiford (Beijing) Biotechnology Co., Ltd. Based on the literature, this invention defines the morning of the discovery of the vaginal plug as day 0.5 of pregnancy.

[0053] Helper plasmids pHelper Vector and pRep2 / Cap9 Vector were purchased from Genscript Biotech, and their gene synthesis was performed by Genscript Biotech. Trypan blue powder was purchased from Guangzhou Caichi Biotechnology Co., Ltd.; 1.25% afodin anesthetic was purchased from Jiangsu Yihe Scientific Instruments Co., Ltd.; Hamilton microsyringes and replaceable needles for microsyringes were purchased from Shanghai Xiyao Biotechnology Co., Ltd.; hair removal cream was purchased from Guangzhou Caisheng Biotechnology Co., Ltd.; metal microtweezers were purchased from Guangzhou Mingrui Biotechnology Co., Ltd.; PBS was purchased from Beijing Kangrun Chengye Biotechnology Co., Ltd. Evo M - MLV The reverse transcription premix kit II was purchased from Guangzhou Ruizhen Biotechnology Co., Ltd.; the Taq Pro Universal SYBR qPCR Master Mix was purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0054] Example 1 Overexpression Rlim Construction of recombinant adeno-associated virus and optimization of viral injection conditions I. Experimental Methods 1. Overexpression Rlim Construction of recombinant adeno-associated virus (1) In mice Rlim Based on the nucleotide sequence of the gene's CDS region (NCBI database, NM_011276.4), homologous arms were added, specifically, a homologous arm gtcagatcctcgaggccacc was added to its 5' end, and the stop codon was removed from its 3' end, adding the P2A sequence ggaagcggagccacgaacttctctctgttaaagcaagcaggagatgttgaagaaaaccccgggcct and the homologous arm atggtgagcaagggcgagga. Then, the gene was synthesized into the above nucleotide sequence (Rlim+P2A sequence 1 with homologous arms).

[0055] Rlim+P2A sequence with homologous arm 1: (2) The plasmid pAAV-CMV(589bp)-EGFP-hGH polyA (provided by Cyagen (Suzhou) Biotechnology Co., Ltd.) was linearized by EcoRI digestion; then the target gene nucleotide fragment synthesized in step (1) was ligated into the linearized pAAV-CMV(589bp)-EGFP-hGH polyA vector by homologous recombination to obtain overexpression. Rlim The recombinant adeno-associated virus vector pAAV-CMV(589bp)-mRlim-P2A-EGFP-hGH polyA (Cyagen (Suzhou) Biotechnology Co., Ltd.) was used for homologous recombination. The specific homologous recombination method was as follows: 50 ng of linearized vector was added to the target gene fragment at a molar ratio of 1:2, 10 µL of NEBuilder HiFi was added, and ddH2O was added to a final volume of 20 µL. The mixture was incubated at 50°C for 30 min, followed by transformation using standard methods. Sequencing confirmed the recombinant adeno-associated virus vector pAAV-CMV(589bp)-mRlim-P2A-EGFP-hGH polyA, and its vector map is shown below. Figure 1 As shown.

[0056] The nucleotide sequence of pAAV-CMV(589bp)-mRlim-P2A-EGFP-hGH polyA (7098bp): AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACA ATTTCACAGGAAACAGCTATGACCATGATTACGAATTGCCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTATCGATATCAAGCTT TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCG TTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTAT GTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGC AGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATG CCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT CAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAA TGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATC CTCGAGGCCACC ATGGAGAACTCAGATTCTAACGATAAAGGAAGTGACCAGTCTGCAGCTCAGCGCAGAAGTCAAATGGATCGCTTGGA TCGGGAAGAGGCTTTCTATCAATTTGTGAATAATCTCAGTGAAGAAGATTATAGACTTATGAGAGACAACAATTTGC TGGGCACCCCAGGTGAAAGTACTGAGGAAGAGTTGCTCAGAAGACTACAACAAATTAAAGAGGGTCCACCACCACAG AGCCCCGATGAAAATAGAGCTGGAGAGTCTTCAGATGATGTGACCAACAGTGATTCTATAATAGATTGGCTTAACTC AGTCAGACAGACTGGAAATACAACAAGAAGTGGTCAGAGAGGAAACCAGTCCTGGAGAGCAGTGAGCCGGACTAATC CAAACAGCGGTGATTTCAGATTCAGTTTAGAGATAAATGTTAACCGTAACAATGGAAGCCAAACTTCCGAGAATGAA AGTGAACCATCCACTAGGCGTCTTAGTGTAGAAAACATGGAGAGCAGCAGCCAAAGGCAAATGGAAAATTCTGCATC TGAATCAGCATCGGCCAGACCTTCTCGAGCGGAGCGCAATTCAGCTGAAGCAGTAACAGAAGTGCCGACCACCAGAG CTCAGAGGAGGGCAAGAAGCCGGAGCCCAGAGCATCGGAGAACCAGAGCAAGAGCTGAAAGAAGCAGGTCCCCTCTG CAGCCAACAAGTGAAATTCCACGAAGAGCTCCGACCTTGGAGCAGTCTTCGGAAAACGAGCCTGAAGGAAGTTCTAG AACCCGGCACCATGTGACCCTGAGACAGCAGATATCTGGACCGGAGTTGTTAGGTAGAGGTCTTTTTGCAGCTTCTG GATCAAGAAACCCCTCTCAGGGGACAAGCTCTTCAGACACAGGTAGCAATAGTGAATCCTCAGGATCTGGCCAAAGA CCTCCAACCATAGTTCTTGATCTTCAAGTAAGAAGAGTTCGTCCTGGAGAATACCGGCAGAGAGATAGTATAGCTAG CAGAACTCGATCAAGATCTCAGGCTCCGAACAACACAGTTACTTATGAAAGTGAACGTGGAGGTTTTAGGCGTACCT TTTCCCGTTCTGAACGTGCAGGTGTGAGAACCTATGTGAGTACTATCAGGATTCCTATTCGCAGAATCTTAAATACT GGATTAAGTGAAACTACATCTGTTGCAATTCAAACCATGTTAAGGCAGATAATGACAGGCTTTGGTGAGCTAAGCTA CTTTATGTACAGTGACAGTGATTCAGAGCCTAGTGCCTCAGTCTCCAGCCGAAATGTGGAGAGAGTAGAGTCACGGA ATGGAAGAGGGAGCTCTGGTGGCGGTAACAGCTCTGGTTCCAGTTCCAGCTCAAGTCCTAGCCCCAGTTCAAGTGGT GAAAGTTCCGAGAGTAGCTCAGAGATGTTCGAAGGCAGTAGTGAAGGAGGCTCGTCTGGCCCATCCAGAAGAGATGG TCGACATAGGGCCCCAGTCACATTTGATGAAAGTGGCTCTCTGCCATTCCTTAGTCTGGCTCAGTTTTTTCTTTTAA ATGAAGATGATGAAGACCAACCTAGAGGACTCACTAAAGAACAGATCGATAACTTGGCAATGAGAAGCTTTGGTGAA AATGATGCATTGAAAACGTGTAGTGTTTGCATTACAGAATACACAGAAGGCAACAAACTTCGTAAACTACCTTGCTC CCATGAGTACCACGTCCACTGCATCGACCGCTGGTTGTCTGAGAATTCCACCTGTCCCATTTGTCGCAGGGCAGTCT TATCTTCTGGGAACAGAGAAAGTGTTGTGGGAAGCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTT GAAGAAAACCCCGGGCCT The first underlined part is the CMV promoter sequence (589bp), and the second underlined part is the mRlim CDS[NM_011276.4] sequence and the P2A sequence.

[0057] (3) The recombinant adeno-associated virus vector pAAV-CMV(589bp)-mRlim-P2A-EGFP-hGH polyA obtained in step (2) (with a plasmid without homologous recombination as a control) was co-transfected into HEK293T cells with the helper plasmids pHelper Vector and pRep2 / Cap9 Vector. The specific method is as follows: pAAV-CMV(589bp)-mRlim-P2A-EGFP-hGH polyA and the helper plasmids pHelper Vector and pRep2 / Cap9 Vector were added to DMEM at a mass ratio of 1:1:1 to prepare solution A. Polyethyleneimine (PEI) was added to DMEM to prepare solution B. Solution B was slowly added to solution A in equal volume. After mixing, the mixture was allowed to stand for 30 min to form a transfection complex. The mass ratio of PEI to total DNA was 1:3. The transfection complex was added to an appropriate amount of DMEM medium and mixed. The mixture was then added to HEK293T cells and cultured at 37°C and 5% CO2.

[0058] (4) After 72 h of transfection, the culture medium supernatant and cells were harvested separately. Cells were added with cell lysis buffer containing nuclease (150 mM NaCl, 50 mM Tris-HCl pH 8.5, 0.1% Triton X-100, 2 mM MgCl2, 50 U / mL Benzonase), incubated at 37℃ for 2 h, centrifuged at 3000×g for 10 min, and the cell lysis supernatant (intracellular viral fraction) was collected and temporarily stored at 4℃. The culture medium supernatant was centrifuged at 1000×g for 5 min to remove cell debris, and the supernatant was collected. 50% PEG8000 was added to a final concentration of 12% (w / v), and the precipitate was incubated overnight at 4℃. After centrifugation at 3000×g for 15 min, the supernatant was removed, and the precipitate (viral fraction in the culture medium supernatant) was resuspended with the same cell lysis buffer and mixed with the collected cell lysis supernatant to obtain the virus sample to be purified.

[0059] (5) The virus obtained in step (4) was purified by iodixanol density gradient centrifugation, and concentrated by multiple centrifugations and PBS changes using ultrafiltration centrifuge tubes with a molecular weight cutoff of 100 kD. The specific method is as follows: ① Take an Ultra-Clear centrifuge tube and add 0.5 mL of 60% Iodixanol, 2 mL of 40% Iodixanol, 1.5 mL of 25% Iodixanol, 1.5 mL of 15% Iodixanol (all percentages are w / v) and the virus suspension collected in step (4) (3.5 mL) to the bottom in sequence. Also, use 15% Iodixanol to precisely balance the solution in the control tube.

[0060] ② Centrifuge at 230,000 g for 18 h at 4℃ (acceleration setting 8, deceleration setting 0); after centrifugation, carefully collect the 40%-60% Iodixanol intermediate liquid layer and transfer it to a 100kD ultrafiltration tube pre-wetted with PBS.

[0061] ③ Add an appropriate amount of pre-cooled PBS buffer to the ultrafiltration tube and gently vortex or invert to mix. Centrifuge at 4500 g for 5 min at 4°C. Repeat this step 5 times until Iodixanol is removed.

[0062] ④ Finally, add an appropriate amount of pre-cooled PBS buffer to the concentrated virus solution in the ultrafiltration tube, gently aspirate and irrigate several times to rinse the filter membrane surface and the inner wall of the tube, transfer the virus suspension to an EP tube, and filter through a 0.22 μm syringe filter to obtain the recombinant adeno-associated virus rAAV9-CMV(589bp)-mRlim-P2A-EGFP-hGH polyA carrying the green fluorescent protein (EGFP) reporter gene. The viral titer was detected by qPCR (primer information is shown in Table 1), and the final viral titer was 5 × 10⁻⁶. 12 GC / mL.

[0063] Table 1 Primer sequences for virus titer detection

[0064] 2. Optimization of virus injection conditions and verification of injection efficacy. To determine the optimal injection volume of recombinant adeno-associated virus (AAV) in mammary tissue of live female mice, 22 μL and 25 μL of 0.1% trypan blue solution were injected into the right mammary gland of the fourth pair (groin area) of ICR female mice on day 16.5 of gestation. Two hours after injection, the mice were dissected to observe the diffusion of the dye in the mammary gland, thereby assessing and determining the optimal injection volume for complete staining. The specific method is as follows: (1) Prepare 0.1% trypan blue solution: Weigh 50 mg trypan blue powder (40% dye content) and dissolve it in 20 mL double-distilled water. After it is fully dissolved, filter it through a 0.22 μm needle filter and repeat three times to remove impurities.

[0065] (2) On the 16.5th day of pregnancy, ICR female mice were anesthetized by intraperitoneal injection of 1.25% aphthine (20 mL / kg). After 3 minutes, they were fixed in a supine position. Hair removal cream was evenly applied around the right nipple of the 4th pair. After 5-10 minutes, it was wiped clean and the nipple was exposed.

[0066] (3) Place the ICR female mouse from step (2) under a stereomicroscope, fix its limbs with tape, and gently remove the dead skin around the nipples with metal micro-forceps. Use a microsyringe to draw 22 μL or 25 μL of 0.1% trypan blue solution. Under the stereomicroscope, gently lift the nipple with micro-forceps, and slowly insert the injection needle into the central duct opening of the nipple, extending it about 1-2 mm beyond the bevel of the needle. Inject the solution at a uniform speed. After injection, wait 2 hours. Dissect the female mouse and observe the diffusion and infiltration of dye within the mammary gland tissue.

[0067] II. Test Results Experimental results are as follows Figure 2 As shown, 22 μL of mammary gland tissue was not completely infiltrated by the dye, while 25 μL of mammary gland tissue was uniformly stained, indicating that 25 μL is the optimal injection volume for a single nipple in the ICR female mouse model.

[0068] Example 2: 2.5 × 10⁻⁶ mmol / L was injected into the mammary glands of female mice on day 16.5 of gestation. 10 Effects of GC's rAAV on lactation I. Experimental Methods 1. Virus injection Following the optimal injection volume determined in Example 1, the rAAV9-CMV(589bp)-mRlim-P2A-EGFP-hGH polyA (experimental group, OE-1) and recombinant adeno-associated virus rAAV9-CMV(589bp)-EGFP-hGH polyA (control group, NC-1) prepared in Example 1 were injected via nipple into the fourth pair of right mammary glands of female mice on day 16.5 of gestation. Fluorescence was observed after injection. The specific method is as follows: (1) Before the injection, all female mice on the 16.5th day of pregnancy were weighed and paired up according to the principle of similar weight. One mouse in each pair was used as the experimental group and the other as the control group, so as to reduce the influence of individual differences on the experimental results. There were 12 female mice in each group.

[0069] (2) Before in vivo injection, rAAV9-CMV(589bp)-mRlim-P2A-EGFP-hGH polyA and rAAV9-CMV(589bp)-EGFP-hGH polyA were diluted with sterile PBS; 2.5 × 10⁻⁶ ppm was injected into the right mammary gland of the fourth pair of ICR female mice. 10 GC virus, the experimental group was injected with overexpressingRlim The gene rAAV9-CMV(589bp)-mRlim-P2A-EGFP-hGHpolyA was injected, while the control group was injected with rAAV9-CMV(589bp)-EGFP-hGH polyA. The viral injection method was completely consistent with the trypan blue solution injection procedure in Example 1, and both were performed by micro-injection through the papillary cannula under a stereomicroscope.

[0070] 2. Fluorescence observation and milk production measurement of mammary gland tissue in female mice. (1) After the virus injection, the female mice were housed in individual cages according to the conventional method. In order to eliminate the potential impact of different numbers of pups on the milk production of female mice, after the female mice gave birth (around the 19th day of pregnancy, the day of birth is the first day of lactation), each litter of pups was immediately adjusted to 8 pups to achieve the standardization of milk production load.

[0071] (2) Milk production was measured on days 5 (L5d), 9 (L9d), and 13 (L13d) of lactation. Fluorescence observation of mammary tissue was performed before milk production was measured. The specific method was as follows: At 8:00 am on the day of measurement, the pups were separated from the female mice to be measured for 2 hours to eliminate interference from the pups suckling at the nipples on milk production. The female mice were deprived of water and food. Subsequently, the female mice were anesthetized by intraperitoneal injection of 1.25% aphthylamine (20 mL / kg). Five minutes later, 2 U of oxytocin was injected subcutaneously into the neck to promote milk ejection using standard methods. The laboratory lights were turned off, and a biological observation lamp (FBL / Basic-B&N-01) was used in blue light mode. The yellow-filtered observation glasses provided with the light source were worn for live mammary tissue fluorescence observation and photographing. Approximately 5 minutes later, the breast pump tip was aimed at the fourth pair of right nipples previously injected with the virus, and milk was slowly drawn at a constant rate for 5 minutes. Finally, the volume of milk obtained was accurately measured using a pipette. The assays were performed on 12 female mice at L5d, the same 12 female mice at L9d, and the remaining 7 female mice at L13d.

[0072] 3. Gene expression analysis In step 2, after the female mice's milk production was measured, they were returned to the pups 3-4 hours later, and tissue samples were collected. Mammary gland tissue samples were collected from female mice whose milk production was measured at L9 day (5 mice per group), and from the remaining female mice whose milk production was measured at L13 day. Total RNA was extracted from the tissues using the TRizol method, and the RNA concentration and purity were determined using a spectrophotometer. The qualified total RNA was reverse transcribed into cDNA, which was then used as a template for real-time quantitative PCR (qRT-PCR) to detect the expression level of the target gene. The relative gene expression level was calculated and analyzed using the 2^(-ΔΔCt) method. The specific method is as follows: (1) Add 1 mL of TRizol to a 1.5 mL EP tube, weigh an appropriate amount of breast tissue into the EP tube, add 3 steel balls, grind the tissue using a tissue homogenizer, and incubate on ice for 5 min. Add 200 µL of chloroform to each tube, shake vigorously for 30 s, incubate on ice for 2-3 min, and centrifuge at 12000 g for 15 min at 4℃. Transfer the supernatant to a new 1.5 mL EP tube, add 500 µL of isopropanol, mix gently, incubate at room temperature for 10 min, and centrifuge at 12000 g for 10 min at 4℃. Discard the supernatant, add 1 mL of 75% (v / v) ice-cold ethanol, gently pipette to wash the RNA precipitate, and centrifuge at 12000 g for 5 min at 4℃. Discard the supernatant and dry the RNA, add an appropriate amount of 65℃ DEPC water to dissolve the RNA precipitate, and determine the total RNA concentration and purity using Nanodrop 2000.

[0073] (2) Use Evo M - MLV Reverse Transcription Premixed Kit II reverse transcribes total RNA into cDNA, which is then used as a template for qRT-PCR detection. Rlim Genes and β-casein gene ( Csn2 The expression level was measured. The qRT-PCR reaction system consisted of: 5 μL of 2×Taq Pro Universal SYBR qPCR Master Mix, 0.2 μL of forward primer, 0.2 μL of reverse primer, 100 ng of cDNA template, and 10 μL of RNase-free water. The qRT-PCR program was as follows: Stage 1: 50℃ for 2 min, 95℃ for 30 sec; Stage 2: 95℃ for 10 sec, 60℃ for 30 sec, for a total of 40 cycles; Stage 3: 95℃ for 15 sec, 60℃ for 60 sec, 95℃ for 15 sec. Primers were provided by Beijing Liuhe BGI Genomics Co., Ltd., and the primer sequences are shown in Table 2.

[0074] Table 2 Primer Sequences

[0075] II. Test Results Fluorescence results as follows Figure 3 As shown, both groups of female mice exhibited significant green fluorescence in the right mammary gland region of the fourth pair, demonstrating that rAAV was successfully delivered to the mammary tissue and achieved exogenous gene expression. The fluorescence signal of the control group NC-1 was stronger than that of the experimental group OE-1.

[0076] Results of milk production as follows Figure 4As shown, compared with the control group NC-1, the experimental group OE-1 had a significantly higher milk production at L13d (P<0.05), while there was no significant difference in milk production at L5d and L9d (P>0.05).

[0077] qRT-PCR results are as follows Figure 5 As shown, at L9d, Rlim Genes and Csn2 Gene expression levels were not significant (P>0.05). At L13d, in the experimental group OE-1... Rlim The mRNA expression level of the gene was significantly upregulated (P<0.05), while Csn2 The mRNA expression level of the gene was increased, but the difference was not significant (P>0.05).

[0078] In summary, injection of overexpressing [the drug] into breast tissue on day 16.5 of pregnancy... Rlim Although the rAAV gene can increase milk production in lactating female mice, the expression of the corresponding gene is not significant, indicating that the rAAV injection dose may be insufficient and the timing of viral injection may be too late, thus failing to achieve the maximum effect of rAAV. To address these two points, Example 3 was conducted.

[0079] Example 3: 1.25 × 10⁻⁶ mg / L was injected into the mammary glands of female mice on day 10.5 of gestation. 11 Effects of GC's rAAV on lactation I. Experimental Methods 1. Construction and injection of recombinant adeno-associated virus (1) Construction of recombinant adeno-associated virus Based on the nucleotide sequence of the CDS region of the mouse Rlim gene (NCBI database, NM_011276.4), homologous arms were added, specifically atgggatgaattcgccacc at the 5' end, and the stop codon was removed at the 3' end, followed by the P2A sequence ggaagcggagccacgaacttctctctgttaaagcaagcaggagatgttgaagaaaaccccgggcct and the homologous arm atggtgagcaagggcgagga. The gene was then synthesized into the above nucleotide sequence (Rlim+P2A sequence 2 with homologous arms).

[0080] (2) To enhance the gene expression level driven by the CMV promoter, the Rlim+P2A sequence with a homologous arm was ligated with the EcoRI-linearized plasmid pAAV-CMV(1035bp)-EGFP-hGH polyA (Cyagen (Suzhou) Biotechnology Co., Ltd.) by homologous recombination to obtain overexpression. RlimThe recombinant adeno-associated virus vector pAAV-CMV(1035bp)-mRlim-P2A-EGFP-hGH polyA was used, and the specific method is described in Example 1. In this vector, the CMV promoter and the downstream intron Human β-globin intron together form a 1035bp complex regulatory element to maximize the expression of the downstream gene. The vector map is shown below. Figure 6 As shown.

[0081] pAAV-CMV(1035bp)-mRlim-P2A-EGFP-hGH polyA nucleotide sequence (7538bp): AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGA TAACAATTTCACAGGAAACAGCTATGACCATGATTACGAATTGCCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTATCGAT CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAA TGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCC CACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTG GCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCA TGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCC ATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCAT GACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGGATATCCTTAAGGGCC CAGCCGGCCCGAATCCCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCC TATAGAGTCTATAGGCCCACAAAAAATGCTTTCTTCTTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTC CCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAGAATAACAGTGAT AATTTCTGGGTTAAGGCAATAGCAATATTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGT TTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTC TGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTG GTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTGGGAT GAATTCGCCACC ATGGAGAACTCAGATTCTAACGATA AAGGAAGTGACCAGTCTGCAGCTCAGCGCAGAAGTCAAATGGATCGCTTGGATCGGGAAGAGGCTTTCTATCAATTT GTGAATAATCTCAGTGAAGAAGATTATAGACTTATGAGAGACAACAATTTGCTGGGCACCCCAGGTGAAAGTACTGA GGAAGAGTTGCTCCAGAAGACTACAACAAATTAAAGAGGGTCCACCACCACAGAGCCCCGATGAAAATAGAGCTGGAG AGTCTTCAGATGATGTGACCAACAGTGATTCTATAATAGATTGGCTTAACTCAGTCAGACAGACTGGAAATACAACA AGAAGTGGTCAGAGAGGAAACCAGTCCTGGAGAGCAGTGAGCCGGACTAATCCAAACAGCGGTGATTTCAGATTCAG TTTAGAGATAAATGTTAACCGTAACAATGGAAGCCAAACTTCCGAGAATGAAAGTGAAACCATCCACTAGGCGTCTTA GTGTAGAAAACATGGAGAGCAGCAGCCAAAGGCAAATGGAAAATTCTGCATCTGAATCAGCATCGGCCAGACCTTCT CGAGCGGAGCGCAATTCAGCTGAAGCAGTAACAGAAGTGCCGACCACCAGAGCTCAGAGGAGGGCAAGAAGCCGGAG CCCAGAGCATCGGAGAACCAGAGCAAGAGCTGAAAGAAGCAGGTCCCCTCTGCAGCCAACAAGTGAAATTCCACGAA GAGCTCCGACCTTGGAGCAGTCTTCGGAAACGAGCCTGAAGGAAGTTCTAGAACCCGGCACCATGTGACCCTGAGA CAGCAGATATCTGGACCGGAGTTGTTAGGTAGAGGTCTTTTGCAGCTTCTGGATCAAGAAACCCCTCTCAGGGAC AAGCTCTTCAGACACAGGTAGCAATAGTGAATCCTCAGGATCTGGCCAAAGACCTCCAACCATAGTTCTTGATCTTC AAGTAAGAAGAGTTCGTCCTGGAGAATACCGGCAGAGAGATAGTATAGCTAGCAGAACTCGATCAAGATCTCAGGCT CCGAACAACACAGTTACTTATGAAAGTGAACGTGGAGGTTTTAGGCGTACCTTTTCCCGTTCTGAACGTGCAGGTGT GAGAACCTATGTGAGTACTATCAGGATTCCTATTCGCAGAATCTTAAATACTGGATTAAGTGAAACTACATCTGTTG CAATTCAAACCATGTTAAGGCAGATAATGACAGGCTTTGGTGAGCTAAGCTACTTTATGTACAGTGACAGTGATTCA GAGCCTAGTGCCTCAGTCTCCAGCCGAAATGTGGAGAGAGTAGAGTCACGGAATGGAAGAGGGAGCTCTGGTGGCGG TAACAGCTCTGGTTCCAGTTCCAGCTCAAGTCCTAGCCCCAGTTCAAGTGGTGAAAGTTCCGAGAGTAGCTCAGAGA TGTTCGAAGGCAGTAGTGAAGGAGGCTCGTCTGGCCCATCCAGAAGAGATGGTCGACATAGGGCCCCAGTCACATTT GATGAAAGTGGCTCTCTGCCATTCCTTAGTCTGGCTCAGTTTTTTCTTTTAAATGAAGATGATGAAGACCAACCTAG AGGACTCACTAAAGAACAGATCGATAACTTGGCAATGAGAAGCTTTGGTGAAAATGATGCATTGAAAACGTGTAGTG TTTGCATTACAGAATACACAGAAGGCAACAAACTTCGTAAACTACCTTGCTCCCATGAGTACCACGTCCACTGCATC GACCGCTGGTTGTCTGAGAATTCCACCTGTCCCATTTGTCGCAGGGCAGTCTTATCTTCTGGGAACAGAGAAAGTGT TGTGGGAAGCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCT The first underlined part is the CMV promoter + β-globin intron sequence (1035bp), and the second underlined part is the mRlim CDS[NM_011276.4] sequence + P2A sequence.

[0082] (3) The methods for plasmid co-transfection, virus preparation, purification, and concentration were the same as in Example 1. Finally, recombinant adeno-associated virus rAAV9-CMV(1035bp)-mRlim-P2A-EGFP-hGH polyA and recombinant adeno-associated virus rAAV9-CMV(1035bp)-EGFP-hGH polyA carrying the green fluorescent protein (EGFP) reporter gene were obtained, with a viral titer of 5 × 10⁻⁶. 12 GC / mL.

[0083] 2. Virus injection Following the optimal injection volume determined in Example 1 and the virus injection method described in Example 2, rAAV9-CMV(1035bp)-mRlim-P2A-EGFP-hGHpolyA (experimental group, OE-2) and recombinant adeno-associated virus rAAV9-CMV(1035bp)-EGFP-hGH polyA (control group, NC-2), prepared in step 1, were injected via nipple injection into the fourth pair of right mammary glands of female mice on day 10.5 of gestation. The injection dose was 1.25 × 10⁻⁶. 11 GC was administered to 11 female mice in each group, and fluorescence was observed after injection.

[0084] 3. Fluorescence observation and milk production measurement of mammary gland tissue in female mice. The measurement method was the same as in Example 2. Eight female mice were measured in each group at L5d and L9d, and the remaining five female mice (which had already been measured at L5d and L9d) were measured at L13d.

[0085] 4. Gene expression analysis The experimental method was the same as in Example 2. Based on the results of step 3, at L9 day, when the difference in milk production first became significant, mammary gland tissue was collected from three female mice in each group after the milk production was measured. Total RNA was extracted using the TRizol method, and after the concentration and purity were verified by spectrophotometer, it was reverse transcribed into cDNA. This cDNA was used as a template for qRT-PCR detection, and the relative gene expression level was calculated using the 2^(–ΔΔCt) method.

[0086] 5. Observation of organizational morphology To investigate overexpression RlimTo investigate the effects on mammary gland tissue structure, based on the results of steps 3 and 4, mammary gland tissue was collected from three female mice in each group at L9d that had not undergone the lactation measurement experiment, and analyzed using hematoxylin and eosin (HE) staining. The specific method was as follows: mammary gland tissue was fixed in 4% paraformaldehyde for 24 h, then sequentially dehydrated with graded ethanol, cleared with xylene, and embedded in paraffin to prepare 5 μm thick sections. After dewaxing and rehydration, the sections were stained with hematoxylin and eosin, mounted with neutral resin, and observed and photographed under an optical microscope.

[0087] 6. Immunohistochemical detection Simultaneously, the L9d breast tissue sections prepared in step 5 were dewaxed to water, antigen retrieval was performed, and serum blocking was carried out according to standard methods. Then, the sections were incubated with primary antibody (Anti-RLIM / Rnf12 Antibody, Sigma, ABE1949, dilution 1:200) and placed flat in a humidified chamber at 4°C overnight. Secondary antibody (HRP-labeled goat anti-rabbit IgG, Seville, GB23303, dilution 1:200) corresponding to the primary antibody was added to cover the tissue, and the tissue was incubated at room temperature for 1 h. After DAB staining, hematoxylin staining was performed, the sections were dehydrated, mounted, and observed and photographed under a white light microscope.

[0088] 7. Immunofluorescence detection Simultaneously, the L9d breast tissue sections prepared in step 5 were dewaxed to water, antigen retrieval was performed, and serum blocking was carried out according to standard methods. The sections were then incubated with primary antibody (β-casein, SANTA, sc-166530, dilution 1:100) and placed flat in a humidified chamber at 4°C overnight. Alexa Fluor 488-labeled goat anti-mouse IgG secondary antibody (Sevier, GB25301, dilution 1:400) was added and the sections were incubated at room temperature in the dark for 1 h. Cell nuclei were counterstained with DAPI, slides were washed in PBS on a decolorizing shaker, and mounted with autofluorescence quencher and antifluorescence quenching mounting medium. Images were then acquired under a microscope.

[0089] II. Test Results Fluorescence results as follows Figure 7 As shown, both groups of female mice exhibited distinct green fluorescence in the right mammary gland region of the fourth pair, demonstrating that rAAV was successfully delivered to the mammary tissue and achieved efficient expression of the exogenous gene. Simultaneously, with... Figure 3 Comparative analysis revealed that the fluorescence signals of the experimental group OE-2 were similar to, and even brighter than, those of the control group NC-2. This indicates a significant increase in the expression level of the EGFP reporter gene, making it easier to detect.

[0090] Results of milk production as follows Figure 8As shown, compared with the control group NC-2, the milk production in the experimental group OE-2 exhibited a regular change at different time points during lactation. At L5, the milk production in the experimental group OE-2 showed an increasing trend, but the difference was not statistically significant (P>0.05). At L9 and L13, the milk production in the experimental group OE-2 was significantly higher than that in the control group NC-2 (P<0.01 and P<0.01, respectively). This indicates that breast tissue stimulation during mid-pregnancy is effective. Rlim Gene overexpression can effectively increase milk production during peak lactation, further confirming the reliability and effectiveness of this technology.

[0091] qRT-PCR results are as follows Figure 9 As shown, compared with the control group NC-2, the experimental group OE-2... Rlim Genes and Csn2 The mRNA expression levels of all genes were significantly upregulated (P<0.05). This indicates that overexpression of these genes was achieved through nipple injection during mid-pregnancy. Rlim rAAV can effectively increase the concentration of rAAV in breast tissue. Rlim Gene expression levels, and key genes that simultaneously promote milk protein synthesis. Csn2 Transcription.

[0092] HE staining analysis results are as follows: Figure 10 As shown, compared with the control group NC-2, the experimental group OE-2 showed significant expansion of mammary alveoli and more developed ductal structure. This indicates rAAV-mediated overexpression. Rlim It can effectively promote the secretion of milk from mammary alveoli and the development of ducts.

[0093] Immunohistochemical results as follows Figure 11 As shown, the expression level of RLIM protein in the breast tissue of the experimental group OE-2 was significantly higher than that in the control group NC-2 (P<0.001). Rlim Successful expression.

[0094] Immunofluorescence results as follows Figure 12 As shown, the expression level of CSN2 protein in the breast tissue of the experimental group OE-2 was significantly higher than that in the control group NC-2 (P<0.001). Rlim Overexpression directly promotes the synthesis and accumulation of functional milk proteins.

[0095] In summary, this invention experimentally demonstrates that injecting 1.25 × 10⁻⁶ mg / L of the drug via the mammary duct during mid-pregnancy in female mice... 11 GC overexpression Rlim rAAV can effectively promote mammary alveolar development and significantly increase milk production during peak lactation. This indicates... RlimGenes play a crucial role in regulating mammary gland development and lactation. Furthermore, the addition of the Human β-globin intron element to the vector significantly enhances the expression level of the EGFP reporter gene, resulting in a brighter and more easily detectable fluorescence signal. Based on these findings, this invention provides a targeted delivery method... Rlim This research explores an effective method for enhancing lactation performance in mammals using genetics. The technology is applicable not only to mouse models but also to other mammals.

[0096] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. An overexpression Rlim A method for preparing a recombinant adeno-associated virus vector of a gene, characterized in that... It includes the following steps: (1) In Rlim A P2A sequence is added to the 3' end of the gene's nucleotide sequence to obtain the Rlim+P2A nucleotide sequence; then homologous arms are added to both ends of the Rlim+P2A nucleotide sequence, and gene synthesis is performed to obtain the Rlim+P2A fragment with homologous arms, wherein the nucleotide sequence of Rlim+P2A is shown in SEQ ID NO.

1. (2) The recombinant adeno-associated virus vector was linearized and then ligated with the Rlim+P2A fragment with homologous arms synthesized in step (1) through homologous recombination to obtain overexpression. Rlim Recombinant adeno-associated virus vector of genes.

2. The overexpression according to claim 1 Rlim A method for preparing a recombinant adeno-associated virus vector of a gene, characterized in that: The vector described in step (2) contains the following elements: AAV2 ITR, CMV promoter, EGFP and hGH polyA.

3. The overexpression according to claim 1 Rlim A method for preparing a recombinant adeno-associated virus vector of a gene, characterized in that: The overexpression described in step (2) Rlim The nucleotide sequence of the recombinant adeno-associated virus vector of the gene is shown in SEQ ID NO.2 or SEQ ID NO.

3.

4. An expression Rlim A recombinant adeno-associated virus vector of genes, characterized in that It is prepared by the preparation method according to any one of claims 1-3.

5. An overexpression Rlim Recombinant adeno-associated virus of the gene, characterized by: The overexpression described in claim 4 Rlim The gene was obtained by co-transfecting a recombinant adeno-associated virus vector, helper plasmid pHelper Vector, and pRep2 / Cap9 Vector into HEK293T cells.

6. The overexpression as described in claim 5 Rlim A method for preparing recombinant adeno-associated virus of the gene, characterized in that... It includes the following steps: (1) The recombinant adeno-associated virus vector of claim 4 and the helper plasmids pHelperVector and pRep2 / Cap9Vector were added to DMEM medium to obtain solution A; polyethyleneimine was added to DMEM medium to obtain solution B; solution B was slowly added to solution A in equal volume, mixed and allowed to stand to form a transfection complex. (2) The transfection complex was added to HEK293T cells and transfected for 48-72 h. The culture supernatant and cells were harvested separately. (3) Add cell lysis buffer containing nuclease to the harvested cells to lyse the cells and centrifuge them, and collect the cell lysis supernatant; centrifuge the harvested culture medium supernatant, collect the supernatant, add PEG8000 to the final concentration of PEG8000 to 12% (w / v), precipitate at low temperature, centrifuge, remove the supernatant, resuspend the precipitate with cell lysis buffer, and mix it with the collected cell lysis supernatant to obtain recombinant adeno-associated virus solution; (4) The recombinant adeno-associated virus solution obtained in step (3) is further purified to obtain overexpressed adeno-associated virus solution. Rlim Recombinant adeno-associated virus.

7. The use of the recombinant adeno-associated virus vector of claim 4 or the recombinant adeno-associated virus of claim 5 in increasing milk production in animals.

8. A method for increasing milk production in mice or constructing a high-milk-production mouse model, characterized in that... It includes the following steps: The recombinant adeno-associated virus of claim 5 was injected into the mammary glands of mice.

9. The method for increasing milk production in mice or constructing a high-milk-production mouse model according to claim 8, characterized in that: The injection dose of the recombinant adeno-associated virus is 1.25 × 10⁻⁶. 11 GC; The recombinant adeno-associated virus was injected on day 10.5 of pregnancy.

10. The method for increasing milk production in mice or constructing a high-milk-production mouse model according to claim 8, characterized in that: The injection volume of the recombinant adeno-associated virus is 25 μL; The recombinant adeno-associated virus was injected into the fourth pair of right mammary glands of the female mouse.

Images