Dumbbell siRNA and in vitro synthesis method thereof

Abstract

The application provides a dumbbell-shaped siRNA molecule and an in-vitro synthesis method thereof, and belongs to the technical field of genetic engineering. The application provides a DNA structure for constructing a dumbbell-shaped siRNA molecule, which comprises, from left to right, a T4 phage thymidylate synthetase 3' intron homologous arm, a 3' exon splicing sequence, a 5' exon splicing sequence and a T4 phage thymidylate synthetase 5' intron homologous arm; the 3' exon splicing sequence is CTAA or CTAC, and the 5' exon splicing sequence is TTGGGT. The dumbbell-shaped siRNA molecule provided by the application can simplify the process of siRNA synthesis, and can achieve the purpose of efficiently knocking down a target gene without modifying base replacement.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a dumbbell-shaped siRNA and its in vitro synthesis method. Background Technology

[0002] RNA interference (RNAi) is an ancient biological defense mechanism used to resist the invasion of foreign genes. Typically a single-stranded RNA fragment of 21-23 bases, it can silence and degrade disease-related genes in a sequence-specific manner, making small interfering RNA (siRNA) a promising therapeutic approach. Over the past 20 years, siRNA drugs have been successfully used in clinical treatment, with several drugs showing remarkable efficacy in the treatment of diseases such as hyperlipidemia and acute hepatic porphyria.

[0003] A major obstacle to the clinical application of small interfering RNA (SRNA) is its easy degradation by RNases in vivo, leading to insufficient duration of drug efficacy. Current pharmaceutical approaches to this problem primarily involve incorporating various chemically modified substituted bases, such as m6A and m5C, into the bases synthesized RNA. The addition of chemically modified base substitutes requires high-quality raw materials from specialized manufacturers, significantly increasing the cost of in vitro RNA synthesis. Another method to reduce the risk of RNase degradation and prolong the in vivo efficacy of small interfering RNA (siRNA) is the synthesis of circular siRNA. Studies have shown that circular double-stranded siRNA can indeed prolong the duration of action in vivo and reduce off-target effects. However, this type of circular siRNA is typically produced by using T4 RNA ligase to connect the synthesized single-stranded siRNA end-to-end into a circular shape or a dumbbell shape, which is relatively inefficient and costly.

[0004] Circular RNA (circRNA) is a single-stranded, covalently closed, non-coding form of RNA found in eukaryotic cells. Self-sponsoring of RNA transcripts using permuted intron-exon (PIE) rearrangements from Anabaena or T4 phage is an effective method for RNA circularization. Taking the PIE of T4 phage thymidylate synthase (Td) as an example, the DNA structure of this type I PIE is generally designed from left to right as follows: a 3' intron arm, a 3' exon splicing sequence (E2, CTACCGTTTAATATTGCGTCACC), the target gene coding sequence, a 5' exon splicing sequence (E1, TTGGGT), and a 5' intron arm. This DNA structure can undergo RNA transcription in vitro via the T7 / T3 / SP6 promoter, or intracellularly via the U6 or CMV promoter. The resulting RNA transcripts possess nuclease activity and can be transcribed in GTP and Mg2+. 2+ RNA splicing and circularization are performed under the action of [a specific mechanism]. The circularized RNA has its 3' and 5' intron homologous arms removed, retaining only part of the exon splicing sequence (E2-E1) and the target gene RNA inserted in the middle.

[0005] However, this conventional RNA circular splicing method leaves behind a long exon splicing sequence E2-E1 (CTACCGTTTAATATTGCGTCACC / TTGGGT), which can affect the sequence targeting of small interfering siRNAs. Overcoming this difficulty is the technical problem that this invention aims to solve. Summary of the Invention

[0006] The purpose of this invention is to provide a dumbbell-shaped siRNA molecule and its in vitro synthesis method, which can further improve the sequence targeting of siRNA.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] This invention provides a DNA structure for constructing a dumbbell-shaped siRNA molecule. The DNA structure, from left to right, includes a 3' intron homologous arm of T4 phage thymidine synthase, a 3' exon splicing sequence, a 5' exon splicing sequence, and a 5' intron homologous arm of T4 phage thymidine synthase. The 3' exon splicing sequence is CTAA or CTAC, and the 5' exon splicing sequence is TTGGGT.

[0009] Preferably, the nucleotide sequence of the DNA structure is shown in SEQ ID NO.1.

[0010] Preferably, the primers for amplifying the DNA structure are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0011] The present invention also provides an expression vector comprising the DNA structure described above.

[0012] This invention also provides a DNA molecule for constructing a dumbbell-shaped siRNA molecule using the aforementioned DNA structure or expression vector, wherein the sense and antisense strands of siRNA are inserted between the 3' exon splicing sequence and the 5' exon splicing sequence of the DNA structure, and the sense and antisense strands are connected by a linker; the structure of the DNA molecule, from left to right, includes a 3' intron homologous arm, a 3' exon splicing sequence, an antisense strand of siRNA, a linker, a sense strand of siRNA, a 5' exon splicing sequence, and a 5' intron homologous arm.

[0013] Preferably, the DNA molecule is transcribed in vitro by a T7, T3, or SP6 promoter and transcribed intracellularly by a U6 or CMV promoter.

[0014] Preferably, the siRNA is 22-27 bp in length; the bases of the siRNA include chemically modified bases.

[0015] The present invention also provides an expression vector comprising a DNA molecule including the aforementioned transcribed dumbbell-shaped siRNA molecule.

[0016] The present invention also provides a method for constructing dumbbell-shaped siRNA molecules using the aforementioned DNA molecule or the aforementioned expression vector, comprising the following steps:

[0017] (1) Construct siRNA targeting the target gene and insert it into the DNA structure to obtain a DNA molecule capable of transcribing dumbbell-shaped siRNA molecules;

[0018] (2) The DNA molecule is linked to a plasmid vector to obtain an expression vector capable of expressing the DNA molecule;

[0019] (3) Obtain a linearized DNA in vitro transcription template from the expression vector and perform in vitro transcription to obtain siRNA;

[0020] (4) After opening the secondary structure of the siRNA, GTP is added to allow the siRNA to self-splice and circularize under the mediation of T4 phage thymidine synthase TdPIE, resulting in dumbbell-shaped siRNA molecules.

[0021] The present invention also provides a dumbbell-shaped siRNA molecule constructed according to the method described above.

[0022] The method for in vitro synthesis of circular small interfering RNA provided by this invention targets the PIE structure of T4 phage thymidine synthase Td. It uses a degenerate E2 (CTAA or CTAC) / E1 (TTGGGT) splicing sequence design to circularize the small interfering RNA, ultimately forming a dumbbell-shaped small interfering RNA (siRNA). The process is as follows: Figure 1 As shown in the diagram. This structure allows for the low-cost synthesis of circular small interfering RNAs for any target gene. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of the in vitro synthesis of dumbbell-shaped small interfering RNA;

[0024] Figure 2 The sequence map of the Db siRNA (dumbbell-shaped siRNA) backbone constructed in Example 1;

[0025] Figure 3 The separation effect of Db-siRNA-Luc869-891 by PAGE electrophoresis in Experiment Example 1;

[0026] Figure 4 The results show the knockdown efficiency of Db-siRNA-Luc869-891 in Experiment Example 1. Detailed Implementation

[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0028] Example 1

[0029] Construction of pcDNA3.1-Db siRNA (dumbbell-shaped siRNA) backbone expression vector

[0030] 1.1 Synthesis of dumbbell-shaped siRNA sequence template

[0031] The DNA sequence Td 3'arm-E2-E1-Td5'arm was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0032] The specific DNA sequence of Td 3'arm-E2-E1-Td5'arm is as follows:

[0033]

[0034] The 3' exon splicing sequence (E2) is either CTAA or CTAC;

[0035] The 5' exon splicing sequence (E1) is: TTGGGT;

[0036] The sequence of Td 3'arm is: SEQ ID NO.2

[0037]

[0038] The sequence of Td 5'arm is: SEQ ID NO.3

[0039]

[0040] 1.2 PCR amplification of the Db-siRNA template fragment

[0041] Primers HindIII-5'arm-F / Xho1-3'arm-R were designed, and PCR was performed using the synthesized Td3'arm-E2-E1-Td5'arm DNA as a template to amplify the amplified product Db-siRNA DNA. Figure 2 ).

[0042] The primer sequences are as follows:

[0043] HindIII-5'arm-F SEQ ID NO.4:

[0044]

[0045] Xho1-3'arm-R SEQ ID NO.5:

[0046]

[0047] The high-fidelity PCR amplification reaction system is shown in Table 1.

[0048] Table 1. Amplification reaction system

[0049] Composition Dosage 2×PhantaMaxBuffer 25μl dNTP(10mMeach) 1μl Primer HindIII-5'arm-F 2μl Primer Xho1-3'arm-R 2μl amplification template 1ng PhantaMaxSuper-FidelityDNAPolymerase 1μl <![CDATA[ddH2O]]> Make up to 50 μl of the mixture.

[0050] The high-fidelity PCR amplification reaction procedure is shown in Table 2.

[0051] Table 2. Amplification reaction procedure

[0052]

[0053] 1.3 Cloning Db-siRNA DNA into the vector pcDNA 3.1

[0054] The pcDNA3.1 plasmid was digested with restriction endonucleases HindIII and Xho1 (NEB) at 37°C for 2 hours. The DNA product was recovered using a kit (Novizan, catalog number: DC301-01) to obtain the linear vector.

[0055] Using a One-Step Cloning Kit (Yisheng, 10911ES50), the Db-siRNA DNA fragment obtained in step 1.2 was recombined with linear pcDNA3.1 DNA digested with HindIII+Xho1 in vitro. The recombinant product was transformed into competent Dh5α cells (Qingke, catalog number: TSC-C14), single clones were screened, and sequenced to obtain the pcDNA3.1-DbsiRNAbackbone expression vector. The sequence map is shown below. Figure 2 As shown.

[0056] The T7 sequencing primer is: TAATACGACTCACTATAGG SEQ ID NO.6

[0057] Experimental Example 1

[0058] 1.1 Construction of Db-siRNA-Luc869-891 plasmid targeting luciferase

[0059] 1.1.1 Construct a Db-siRNA-Luc transcription vector targeting a site (869-891, antisense strand) on the luciferase gene.

[0060] Db-siRNA-Luc sequence:

[0061]

[0062] Using the following long primers, the PCR amplification product Db-siRNA-Luc was obtained.

[0063] Db-siRNA-Luc-F SEQ ID NO.8:

[0064]

[0065] Db-siRNA-Luc-R SEQ ID NO.9:

[0066]

[0067] PCR was performed using Db-siRNA-Luc as a template, and approximately 5.7 kb of the PCR product was recovered using a kit (Novazan, catalog number: DC301-01).

[0068] The high-fidelity PCR amplification reaction system is shown in Table 1 of the examples. The amounts of primers Db-siRNA-Luc-F and Db-siRNA-Luc-R are the same as those of the two primers in Table 1.

[0069] The high-fidelity PCR amplification reaction procedure is shown in Table 3.

[0070] Table 3. Amplification reaction procedure

[0071]

[0072] 1.1.2 The pcDNA3.1-Db-siRNA-Luc869-891 plasmid was obtained through transformation.

[0073] The Db-siRNA-Luc869-891 product obtained by the above amplification was transformed into competent Dh5α cells (Qingke, catalog number: TSC-C14), single clones were screened, and sequenced for identification to obtain the transcription plasmid pcDNA3.1-Db-siRNA-Luc869-891.

[0074] The T7 sequencing primers are as described in Example 1, section 1.3.

[0075] 1.2Db-siRNA-Luc869-891 in vitro transcription and RNA circularization

[0076] 1.2.1 Preparation of Db-siRNA-Luc869-891 in vitro transcription template

[0077] The following in vitro transcription primers IVT-F / IVT-R were designed. Using a high-fidelity enzyme (Novazia, P501-d1), PCR was performed with the plasmid pcDNA3.1-Db-siRNA-Luc869-891 obtained in section 1.1.2 above as a template. The in vitro transcription template with the T7 promoter was recovered.

[0078] IVT-F:GCAGAGCTCTCTGGCTAACTAGAG SEQ ID NO.10

[0079] IVT-R: GCTAGAAATCTGATAAATGGAATTAG SEQ ID NO.11

[0080] The linearized transcription template was recovered using a kit (Novizan, catalog number: DC301-01).

[0081] 1.2.2 In vitro transcription of Db-siRNA-Luc869-891

[0082] Using a high-yield T7 in vitro transcription reagent (Hanhai New Enzyme, HBP001506), the in vitro transcription reaction system was prepared according to Table 4. The components were gently mixed with a pipette and incubated at 37°C for 12 hours. Then, 2 μL of DNase I was added to the reaction system and incubated at 37°C for 15 minutes to digest the transcribed linearized plasmid DNA template, yielding transcribed RNA. ， The sequence is as follows:

[0083]

[0084] Table 4. Reaction system for in vitro transcription

[0085]

[0086]

[0087] 1.2.3 In vitro circularization of Db-siRNA-Luc869-891

[0088] The RNA obtained from in vitro transcription was heated to 70°C for 5 min, and then immediately placed on ice to cool for 3 min to open the secondary structure of the RNA; then GTP solution (Sangon Biotech, catalog number: A620332-0250) was added to a final concentration of 2 mM and treated at 55°C for 15 min; the siRNA obtained from in vitro transcription self-sponge and circularize under the mediation of Td PIE.

[0089] 1.3Db-siRNA-Luc869-891 purification

[0090] 1.3.1 Preliminary purification: LiCl precipitation method

[0091] (1) Add 160 μl of RNase-free ddH2O to dilute the product to 180 μl;

[0092] (2) Add an equal volume of LiCl solution (5M) to the reaction product;

[0093] (3) After mixing, precipitate at -20℃ for 30 min, centrifuge at 12000 rpm at 4℃ for 15 min, and discard the supernatant;

[0094] (4) Add 200 μL of 70% ice-point ethanol to wash the RNA precipitate, centrifuge at 12000 rpm for 15 min at 4℃, and discard the supernatant;

[0095] (5) Open the lid and dry for 5-10 minutes. After confirming that it is completely dry, add 50 μL of RNase-free ddH2O to dissolve the Db-siRNA-Luc869-891 RNA precipitate.

[0096] 1.3.2 Further purification: Urea-PAGE method

[0097] 10% urea gel was prepared using the Urea-PAGE gel preparation kit (Beyotime, R0218S), and the preparation method is shown in Table 5.

[0098] Table 5. Preparation method of 10% Urea-PAGE adhesive

[0099]

[0100]

[0101] RNA sample pretreatment: Mix the pre-purified Db-siRNA-Luc869-891 with an equal volume of 2×RNA loading buffer (Beyotime, R0215), incubate at 95℃ for 1 min to fully denature the RNA and open its secondary structure, and then immediately place it in an ice water bath.

[0102] Electrophoresis: Add 1×TBE electrophoresis buffer to the electrophoresis tank. Before loading the samples, rinse each well with 1×TBE electrophoresis buffer to remove urea, then quickly add the RNA samples. After loading, perform electrophoresis at constant voltage (180V) for 60 minutes.

[0103] Staining: After electrophoresis, remove the gel and place it in a clean container. Add approximately 30 ml of nucleic acid staining solution and stain on a shaker at room temperature for 15 min at 25 rpm. Finally, rinse with DEPC water for 2 min and transfer to a gel imaging device to observe the staining results after electrophoresis. Figure 3 );

[0104] Gel cutting: Locate the band of the target size (indicated by the arrow), and cut the single-component circular Db-siRNA-Luc869-891 gel into an RNase-free EP tube.

[0105] 1.3.3 Urea-PAGE Gel Recovery of Db-siRNA-Luc869-891: CRUSHAND SOAK Method

[0106] Accurately weigh the gel in the EP tube, add gel-soaking buffer at a volume ratio of 2, then crush the gel as much as possible using an RNase-free pipette tip, and place it in a rotary mixer for overnight processing; Gel-soaking buffer preparation: 0.41g NaOAc, 0.4mL EDTA (0.5M, pH 8.0), and DEPC water to a final volume of 100mL.

[0107] Centrifuge at 12000 rpm for 1 min, collect the supernatant, and repeat the centrifugation once to prevent the collection of gel fragments;

[0108] Add 0.1 volume of NaOAc (3M, pH 5.2) and 3 volume of anhydrous ethanol, mix well, place in a -20℃ freezer, precipitate for 1 hour, centrifuge at 12000 rpm for 15 minutes at 4℃, and discard the supernatant.

[0109] Add 200 μL of 70% ice-point ethanol to wash the RNA precipitate, centrifuge at 12,000 rpm for 15 min at 4 °C, and discard the supernatant;

[0110] After drying for 5-10 minutes with the lid off, add 20 μL of DEPC water to dissolve the RNA precipitate.

[0111] 1.4Db-siRNA-Luc869-891 Functional Testing

[0112] Dual-luciferase assay for Db-siRNA-Luc869-891 knockdown efficiency

[0113] HEK293T cells were passaged and seeded evenly in 24-well plates. Transfection was performed when cell confluence reached 70-80%. The Db-siRNA-Luc869-891 transfection system / well consisted of: 125 ng pGL3-Basic, 5 ng pRL-TK, 12.5 μL DMEM, and 0.25 μL Lipo8000 (Beyotime, C0533). The linear siRNA transfection system / well consisted of: 400 ng siRNA (final concentration approximately 40 nM), 25 μL DEME, and 1 μL Lipo8000.

[0114] The Db-siRNA-Luc869-891 transfection system and the linear siRNA transfection system were added to cells, respectively, with cells without transfection systems serving as a blank control. Each group was replicated in triplicate. Cells were harvested after 24 hours, and the siRNA knockdown effect was detected using the Dual Luciferase Reporter Assay Kit (Novizan, DL101-01). Results are as follows: Figure 4 As shown.

[0115] from Figure 4 As can be seen, compared with the control, Db-siRNA-Luc869-891 can achieve gene knockdown efficiency comparable to that of synthesized linear siRNA.

[0116] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A DNA structure for constructing dumbbell-shaped siRNA molecules, characterized in that, The DNA structure, from left to right, includes a 3' intron homologous arm of T4 phage thymidine synthase, a 3' exon splicing sequence, a 5' exon splicing sequence, and a 5' intron homologous arm of T4 phage thymidine synthase; the 3' exon splicing sequence is CTAA or CTAC, and the 5' exon splicing sequence is TTGGGT.

2. The DNA structure according to claim 1, characterized in that, The nucleotide sequence of the DNA structure is shown in SEQ ID NO.

1.

3. The DNA structure according to claim 2, characterized in that, The primers for amplifying the DNA structure are shown in SEQ ID NO.4 and SEQ ID NO.

5.

4. An expression vector comprising the DNA structure described in any one of claims 1 to 3.

5. A DNA molecule for constructing a dumbbell-shaped siRNA molecule using the DNA structure according to any one of claims 1 to 3 or the expression vector according to claim 4, characterized in that, The sense and antisense strands of siRNA are inserted between the 3' exon splicing sequence and the 5' exon splicing sequence of the DNA structure, and the sense and antisense strands are linked by a linker; the structure of the DNA molecule from left to right includes a 3' intron homologous arm, a 3' exon splicing sequence, an antisense strand of siRNA, a linker, a sense strand of siRNA, a 5' exon splicing sequence, and a 5' intron homologous arm.

6. The DNA molecule for transcribing dumbbell-shaped siRNA according to claim 5, characterized in that, The DNA molecule is transcribed in vitro by a T7, T3, or SP6 promoter and transcribed intracellularly by a U6 or CMV promoter.

7. The DNA molecule for transcribing dumbbell-shaped siRNA according to claim 6, characterized in that, The siRNA is 22-27 bp in length; the bases of the siRNA include chemically modified bases.

8. An expression vector comprising a DNA molecule comprising a transcribed dumbbell-shaped siRNA molecule as described in any one of claims 5 to 7.

9. A method for constructing dumbbell-shaped siRNA molecules using the DNA molecule according to any one of claims 5 to 7 or the expression vector according to claim 8, characterized in that, Includes the following steps: (1) Construct siRNA targeting the target gene and insert it into the DNA structure to obtain a DNA molecule capable of transcribing dumbbell-shaped siRNA molecules; (2) The DNA molecule is linked to a plasmid vector to obtain an expression vector capable of expressing the DNA molecule; (3) Obtain a linearized DNA in vitro transcription template from the expression vector and perform in vitro transcription to obtain siRNA; (4) After opening the secondary structure of the siRNA, GTP is added to allow the siRNA to self-splice and circularize under the mediation of T4 phage thymidine synthase Td PIE, resulting in dumbbell-shaped siRNA molecules.

10. A dumbbell-shaped siRNA molecule constructed according to the method of claim 9.

Images