Double sgRNA site knockout cassette suitable for fusarium oxysporum, crisper / cas9 system and construction method and application thereof
By constructing a dual sgRNA knockout cassette and a CRISPR/Cas9 system for Fusarium oxysporum, rapid and efficient gene knockout of Fusarium oxysporum was achieved, solving the problem of low efficiency in existing technologies and providing an efficient gene editing tool.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ZHEJIANG UNIV OF TECH
- Filing Date
- 2026-03-16
- Publication Date
- 2026-05-29
AI Technical Summary
Existing gene knockout methods for Fusarium oxysporum are inefficient and time-consuming, making it difficult to meet the needs of efficient gene editing.
We constructed a dual sgRNA knockout cassette and a CRISPR/Cas9 system suitable for Fusarium oxysporum. The dual sgRNA was released using the plasmid pFRCas9-G418, and the target gene was knocked out rapidly and efficiently by combining it with PEG-mediated protoplast transformation.
It significantly shortened the gene knockout cycle to 20 days, achieved a knockout efficiency of 77.8%, and successfully knocked out the FCC1 gene, providing an efficient gene editing method.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
(I) Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and specifically relates to a dual sgRNA site knockout cassette for efficient gene knockout in Fusarium oxysporum, a CRISPR / Cas9 system, its construction method and application. (II) Background Technology
[0002] Fusarium oxysporum is a globally distributed plant pathogenic fungus with multiple specialized serotypes. It can infect various plants, causing wilt disease and resulting in significant losses to crop varieties and the economy. Simultaneously, Fusarium oxysporum also produces a rich variety of secondary metabolites, including polyketides, terpenes, alkaloids, and phenolic peptides. These metabolites possess antibacterial, anticancer, and antiviral bioactivities and are important sources of drug lead compounds. Therefore, gene knockout systems of Fusarium oxysporum have significant application potential in both agriculture and pharmaceuticals.
[0003] Gene knockout is a common method for studying fungal gene function and fungal genetic modification. CRISPR / Cas9 technology, a third-generation gene editing technology, is characterized by high efficiency, ease of operation, low cost, and user-friendliness, and is currently widely used in gene editing of filamentous fungi. Currently, gene knockout in *Fusarium oxysporum* is mostly achieved through homologous recombination, which is time-consuming and has low knockout efficiency. Existing methods for gene knockout in *Fusarium oxysporum* using the CRISPR / Cas9 system involve single sgRNA knockout, which is also time-consuming and inefficient, requiring further improvement. (III) Summary of the Invention
[0004] The purpose of this invention is to provide a dual sgRNA knockout cassette, a CRISPR / Cas9 system, its construction method, and its applications suitable for Fusarium oxysporum. The gene knockout system provided by this invention can significantly shorten the gene knockout cycle of Fusarium oxysporum and has a high knockout efficiency, thus solving the problem of low gene knockout efficiency in Fusarium oxysporum.
[0005] The technical solution adopted in this invention is:
[0006] In a first aspect, the present invention provides a dual sgRNA knockout cassette suitable for efficient gene knockout in Fusarium oxysporum. The dual sgRNA knockout cassette includes a promoter, tRNA, sgRNA1, sgRNA2, a gRNA scaffold, and a T6 terminator. The knockout cassette enables the release of both sgRNAs, thereby achieving dual-site knockout of a single gene during gene knockout.
[0007] Preferably, the dual sgRNA knockout cassette is composed of the following elements connected in sequence: 5S rRNA promoter, tRNA, sgRNA1, sgRNA scafold, tRNA, sgRNA2, tRNA, sgRNA scafold, and T6 terminator.
[0008] Preferably, the 5S rRNA promoter nucleotide sequence is shown as 1-119 bp in SEQ ID NO.9, the tRNA nucleotide sequence is shown as 120-190 bp, 291-361 bp, and 462-533 bp in SEQ ID NO.9, the sgRNA backbone nucleotide sequence is shown as 211-290 bp and 382-461 bp in SEQ ID NO.9, and the T6 terminator nucleotide sequence is shown as 533-538 in SEQ ID NO.9. More preferably, the dual sgRNA site knockout cassette nucleotide sequence is shown in SEQ ID NO.9.
[0009] The second invention provides a plasmid containing the dual sgRNA knockout cassette, wherein the plasmid is constructed by inserting the dual sgRNA knockout cassette into the filamentous fungal gene knockout plasmid pFC332.
[0010] Preferably, the plasmid is pFR5S-cass, and its nucleotide sequence is shown as the sequence of SEQ ID NO.7 + SEQ ID NO.8 linked end-to-end (the sequence is shown separately due to CPC submission error caused by its excessive length). Using plasmid pFR5S-cass as a template, the efficient construction of a CRISPR / Cas9 dual-site knockout plasmid can be achieved through three PCRs and one seamless cloning process simply by changing the sgRNA gene knockout target sequence.
[0011] Thirdly, the present invention provides a CRISPR / Cas9 system containing the dual sgRNA knockout cassette suitable for Fusarium oxysporum, the system comprising a CRISPR / Cas9 knockout vector pFRCas9-G418 containing the dual sgRNA knockout cassette; the knockout vector pFRCas9-G418 is wherein the nuclear localization sequence on the filamentous fungal gene knockout plasmid pFC332 is replaced with the endogenous nuclear localization sequence HTB of Fusarium oxysporum, and the hygromycin (Hyg) resistance is replaced with genimycin G418 resistance.
[0012] Preferably, the endogenous nuclear localization sequence HTB nucleotide sequence is shown in SEQ ID NO.1.
[0013] Preferably, the knockout vector pFRCas9-G418 is composed of the following elements connected in sequence: Cas9, endogenous nuclear localization sequence HTB, upstream fragment of hygromycin resistance (Hyg), G418 resistance, downstream fragment of hygromycin resistance (Hyg), and AmpR promoter.
[0014] Preferably, the nucleotide sequence of the knockout vector pFRCas9-G418 is shown as the sequence of SEQ ID NO.2 + SEQ ID NO.3 linked together (due to the excessive length of the sequence, CPC submission was incorrect, so it is shown separately).
[0015] Preferably, the *Fusarium oxysporum* is... Fusarium oxysporum CGMCC NO.17763.
[0016] Fourthly, the present invention provides a method for constructing the CRISPR / Cas9 system suitable for Fusarium oxysporum, the method comprising the following steps:
[0017] (1) The gene knockout target sites sgRNA1 and sgRNA2 of the target gene were analyzed and selected using the sgRNA design software CIDP.
[0018] (2) Based on the selected target site, the knockout cassette sequence containing sgRNA1 and sgRNA2 was amplified by PCR using pFR5S-cass as a template. It was then assembled into the CRISPR / Cas9 knockout vector pFRCas9-G418 using seamless cloning technology to construct a CRISPR / Cas9 system containing a dual sgRNA site knockout cassette.
[0019] Fifthly, the present invention provides a method for knocking out genes using the CRISPR / Cas9 system suitable for Fusarium oxysporum, the method comprising the following steps:
[0020] (1) Design donor DNA for homologous end repair of the genome according to the target gene to be knocked out.
[0021] (2) Prepare protoplasts of Fusarium oxysporum and transfer a CRISPR / Cas9 knockout vector containing a double sgRNA knockout cassette and Donor DNA into Fusarium oxysporum host cells via PEG-mediated protoplast transformation to achieve the knockout of the target gene.
[0022] Preferably, the target gene is the Fusarium phenotypic reporter gene FCC1, and the nucleotide sequence of sgRNA1 is shown in SEQ ID NO.5, and the nucleotide sequence of sgRNA2 is shown in SEQ ID NO.6.
[0023] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:
[0024] (1) Based on the filamentous fungal gene knockout plasmid pFC332, this invention constructs a new vector pFRCas9-G418 containing a double sgRNA knockout cassette, which is more suitable for gene knockout in Fusarium oxysporum. The invention also provides the double sgRNA knockout cassette, a template for constructing the cassette, and a construction method, which enables efficient and rapid construction of the knockout cassette plasmid.
[0025] (2) This invention provides a method for knocking out genes in the CRISPR / Cas9 system with dual sgRNA sites in Fusarium oxysporum. This method can achieve rapid knockout of Fusarium oxysporum genes, shorten the knockout cycle to 20 days, and achieve a knockout efficiency of up to 77.8%.
[0026] (3) The present invention successfully knocked out the FCC1 gene using the CRISPR / Cas9 system containing the dual sgRNA site knockout cassette. After knockout, the center of the strain showed a yellow solid and the strain growth morphology was small. Subsequently, the FCC1 gene can be used as a Fusarium oxysporum phenotypic reporter gene for gene editing verification. (iv) Description of the attached drawings
[0027] Figure 1 This is a schematic diagram of the construction process for plasmid pFRCas9-G418.
[0028] Figure 2 This is a schematic diagram of plasmid pFRCas9-G418.
[0029] Figure 3 This is a schematic diagram of the nucleic acid sequence composition of plasmid pFRCas9-G418.
[0030] Figure 4 This is a schematic diagram of a knockout cassette for a dual sgRNA gene knockout target site.
[0031] Figure 5 This is a schematic diagram of the template plasmid pFR5S-cass being knocked out.
[0032] Figure 6 This is a schematic diagram of the process for constructing a two-site knockout plasmid.
[0033] Figure 7 This is a schematic diagram of plasmid pFRCas9-G418-FCC1.
[0034] Figure 8 This is a schematic diagram of the nucleic acid sequence composition of plasmid pFRCas9-G418-FCC1.
[0035] Figure 9 Construct a sequencing validation plot for Donor DNA.
[0036] Figure 10This is an electrophoresis diagram verifying successful FCC1 gene knockout in positive transformants. Lanes 1-9 represent transformants.
[0037] Figure 11 This is a sequencing verification diagram of the FCC1 knockout strain.
[0038] Figure 12 The images show the morphological characteristics of the FCC1 strains that were successfully knocked out and those that were not, as described in Example 3.
[0039] Figure 13 This is a morphological diagram of the strain after homologous recombination and FCC1 knockout in Example 4. (V) Detailed Implementation Methods
[0040] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:
[0041] The room temperature mentioned in the embodiments of the present invention refers to 25-30 ℃.
[0042] In this invention, Fusarium oxysporum R1 is used as the Fusarium oxysporum species. Fusarium oxysporum The abbreviation of CGMCC No. 17763 has been disclosed in patent application CN110563740A; with Up as the abbreviation for upstream and Down as the abbreviation for downstream, it can be clearly determined that the above abbreviations of the present invention have exactly the same meaning as the original terms.
[0043] LB liquid medium consists of 10g tryptone, 5g yeast extract, and 10g NaCl, diluted to 1 L with water. LB solid medium is LB liquid medium with 20g / L agar added.
[0044] Example 1: Construction of plasmid pFRCas9-G418 for building the CRISPR / Cas9 system
[0045] 1. Replacement of nuclear localization sequence (NLS)
[0046] (1) The endogenous nuclear localization sequence of Fusarium oxysporum R1 was compared with the R1 genome sequence (NCBI accession number: GCA_042608555.1) from the literature (DOI: 10.1021 / acssynbio.8b00478), and the similarity was 94.2%. The NLS sequence (107-265bp in SEQ ID NO.1) in the R1 genome was predicted using the NLStradamus tool (http: / / www.moseslab.csb.utoronto.ca / NLStradamus / ), which consists of 159 base pairs.
[0047] The NLS sequence is:
[0048] CCTCCCAAGGCCGCCGACAAGAAGCCCGCCTCCAAGGCTCCCGCCACTGCCTCCAAGGCTCCCGAGAAGAAGGATGCCGGCAAGAAGACCGCTGCTTCTGGTGACAAGAAGAAGCGCTCCAAGACCCGCAAGGAGACTTACTCTTCTTACATCTACAAG
[0049] (2) Using the filamentous fungal gene editing plasmid pFC332 (purchased from Miaoling Company) as a template, the base fragment between the BmgBI and PmlI sites in pFC332 (i.e., the HTB sequence) was amplified by PCR using primers HTB-F / HTB-R in Table 2. The nucleotide sequence is shown in SEQ ID NO.1 (1-106bp and 266-492bp are the protective sequences, and 107-265bp is the NLS sequence in the R1 genome). This sequence was used to replace the original SV40 sequence of pFC332 with the above-mentioned HTB sequence. The HTB sequence consists of the sequence from the BmgBI site to the SV40 sequence in plasmid pFC332 (as a protective base), the NLS sequence (159 base pairs) in the R1 genome, and the sequence from the SV40 sequence to the PmlI site (as a protective base).
[0050] The sequence of SEQ ID NO.1 is:
[0051] GCGATACACGTCCACAAAGGAGGTGCTTGATGCGACCCTGATTCATCAATCCATCACTGGGCTCTATGAAACCCGTATCGACCTTAGTCAACTGGGGGGGCGACCCTCCTCCCAAGGCCGCCGACAAGAAGCCCGCCTCCAAGGCTCCCGCCACTGCCTCCAAGGCTCCCGAGAAGAAGGATGCCGGCAAGAAGACCGCTGCTTCTGGTGACAAGAAGAAGCGCTCCAAGAACCGCAAGGAGACTTA CTCTTCTTACATCTACAAGTGAGCGGACATTCGATTTATGCCGTTATGACTTCCTTAAAAAAGCCTTTACGAATGAAAGAAATGGAATTAGACTTGTTATGTAGTTGATTCTACAATGGATTATGATTCCTGAACTTCAAATCCGCTGTTCATTATTAATCTCAGCTCTTCCCGTAAAGCCAATGTTGAAACTATTCGTAAATGTACCTCGTTTTGCGTGTACCTTGCTTATCACGTGATATTACA.
[0052] (3) The pFC332 and the HTB sequence synthesized in step (2) were double-digested with BmgBI and PmlI to obtain linearized vectors and fragments, respectively. After digestion, the two fragments were detected by agarose gel electrophoresis, and the DNA was recovered using a DNA gel recovery kit. Recombination was then performed using T4 ligase, and the preparation system is shown in Table 1.
[0053] Table 1. T4-linked recombination reaction system
[0054]
[0055] The reaction conditions were 16 °C overnight for 8 h.
[0056] (4) Take 10 L-linked product added to 100 L's E. coli In DH5α competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min. Heat shock in a 42°C water bath for 45 sec, then immediately cool on ice. Add 900 ml of [unspecified substance] to a clean bench. In LB broth, the cells were incubated at 37 °C for 1 h (180 rpm). After centrifugation at 5000 rpm for 5 min, 900 μL of supernatant was discarded, and the cells were resuspended and spread onto a medium containing 50 μL of LB broth. LB plates with g / L ampicillin (Amp) resistance were incubated at 37 °C for 12–16 h.
[0057] (5) After culturing, single clones were selected and sequenced to verify that the vector pFC332-HTB, which successfully replaced the original NLS with HTB, was obtained. Figure 1 ).
[0058] 2. Resistance selection marker replacement
[0059] (1) Using the pFC332-HTB plasmid successfully constructed in step 1 as a template, PCR was performed using primer pairs Hyg-Up-F / Hyg-Up-R and Hyg-Down-F / Hyg-Down-R (Table 2) to obtain the upstream sequence of Hyg (between PmlI enzyme and Hyg, denoted as fragment 1) and the downstream sequence (between Hyg and PvuI enzyme, denoted as fragment 2). The G418 sequence (denoted as fragment 3) was obtained by PCR from plasmid pAG1-H3-G418 using G418-F / G418-R. The specific PCR amplification conditions are shown in Table 3.
[0060] Table 2 Primers
[0061]
[0062] Table 3 PCR recovery reaction system and procedure
[0063]
[0064] pFC332-HTB was digested with PmlI and PvuI to obtain a linearized vector. The above PCR fragments (fragment 1, fragment 2, fragment 3) and the linearized vector were excised and recovered from the gel. The three fragments were then recombined using a seamless cloning kit (ClonExpress Ultra One StepCloning Kit C115). The configuration system is shown in Table 4.
[0065] Table 4 Seamless Cloning Three-Fragment Recombination Reaction System
[0066]
[0067] The reaction conditions were 50 °C for 15 min.
[0068] (2) Take 10 L-linked product added to 100 L's E. coli DH5 In competent cells, gently tap the tube wall to mix, and let stand on ice for 30 min. Heat shock in a 42°C water bath for 45 sec, then immediately place on ice to cool. Add 900 ml of [unspecified substance] to a clean bench. In LB broth, the cells were incubated at 37 °C for 1 h (180 rpm). After centrifugation at 5000 rpm for 5 min, 900 μl of supernatant was discarded, and the cells were resuspended and spread onto a medium containing 50 μL of LB broth. LB plates containing g / L ampicillin Amp resistance were incubated at 37 °C for 12–16 h.
[0069] (3) After culture, single clones were selected and sequenced to verify that the plasmid pFRCas9-G418, which successfully replaced the pFC332 resistance selection marker gene G418, was obtained. Figure 1 , Figure 2 and Figure 3 The nucleotide sequence is shown as the sequence of SEQ ID NO.2 + SEQ ID NO.3 connected end to end, where 3698-3856 of SEQ ID NO.3 represents HTB and 4682-6740 represents G418.
[0070] Example 2: Rapid construction of the CRISPR / Cas9 dual-site knockout plasmid pFRCas9-G418-FCC1 for the FCC1 gene using the template plasmid pFR5S-cass containing a dual sgRNA knockout cassette.
[0071] (1) Based on the Fusarium R1 genome sequencing and data alignment, the gene sequence of the Fusarium R1 phenotypic reporter gene FCC1 (nucleotide sequence as shown in SEQ ID NO.4) was determined, totaling 1012 bp. Using the sgRNA design tool CIDP, the target sequence was uploaded and analyzed to obtain all potential sgRNAs of the target gene, i.e., all 20 bp sequences downstream containing NGG characteristic bases. The sequences with high comprehensive scores and located in the exon region were selected as the knockout target sgRNA1 (sequence GCCATCGACACGTCCAAGCT, SEQ ID NO.5) and sgRNA2 (sequence GCCCAAAGAGAAGCAGCAGC, SEQ ID NO.6).
[0072] (2) Reference Figure 6 The flowchart shows the construction of the pFR5S-cass plasmid (containing a double sgRNA site knockout cassette insert plasmid pFC332). Figure 5Using the sequence shown in SEQ ID NO.7+SEQ ID NO.8 (connected end-to-end) as a template, and primers P1-F / P1-R, P2-F / P2-R, and P3-F / P3-R from Table 2, PCR amplification was performed according to Table 3 to obtain three parts of the dual sgRNA knockout cassette: Part 1 (containing a 5S rRNA promoter, tRNA-spacer, and sgRNA1), Part 2 (containing sgRNA1, gRNA scaffold, tRNA-spacer, and sgRNA2), and Part 3 (containing sgRNA2, gRNA scaffold, tRNA-spacer, and T6 terminator). pFRCas9-G418 was digested with BglII and PacI to obtain a linearized vector. After gel extraction and recovery of the above fragments and the linearized vector, three-fragment recombination was performed using the seamless cloning kit C115 according to the system in Table 4. Figure 4 The reaction conditions were 50 °C for 15 min. Based on the pFR5S-cass plasmid template, by simply changing the sgRNA gene knockout target sequence, the CRISPR / Cas9 dual-site knockout plasmid can be efficiently constructed through three PCRs and one seamless cloning.
[0073] (3) Take 10 L-linked product added to 100 L's E. coli DH5 In competent cells, gently tap the tube wall to mix, and let stand on ice for 30 min. Heat shock in a 42°C water bath for 45 sec, then immediately place on ice to cool. Add 900 ml of [unspecified substance] to a clean bench. In LB broth, the cells were incubated at 37 °C for 1 h (180 rpm). After centrifugation at 5000 rpm for 5 min, 900 μL of supernatant was discarded, and the cells were resuspended and spread onto a medium containing 50 μL of LB broth. LB plates containing g / L ampicillin Amp resistance were incubated at 37 °C for 12–16 h.
[0074] (4) After culturing, single clones were selected and sequenced for verification, and the plasmid pFRCas9-G418-FCC1 for dual-target knockout of FCC1 was successfully constructed. Figure 7 , Figure 8 ).
[0075] Example 3: Knockout of Fusarium R1 phenotypic reporter gene FCC1 and morphological changes in strains
[0076] 1. Construction of Donor DNA
[0077] (1) When using CRISPR / Cas9 knockout, a homology repair template (i.e., donor DNA) is required. According to the literature, this invention selects about 1000 bp upstream and downstream of the FCC1 gene as the length of the homology arm. Using the Fusarium oxysporum R1 genome as a template, PCR amplification is performed using the primers Up-F / Up-R and Down-F / Down-R in Table 2 according to Table 3 to obtain the upstream sequence of the FCC1 gene of 1217 bp and the downstream sequence of 1179 bp. The upstream and downstream homology arms are connected together as the donor DNA.
[0078] (2) pFRCas9-G418 was digested with BglII and PacI to obtain a linearized vector. The Donor DNA fragment and the linearized vector were then gel-recovered and double-fragmented using the seamless cloning kit C115. The configuration system is shown in Table 5.
[0079] Table 5 Seamless Cloning Two-Fragment Recombination Reaction System
[0080]
[0081] The reaction conditions were 50 °C for 15 min.
[0082] (3) Take 10 Step (2) The ligation product is added to 100 L's E. coli DH5 In competent cells, gently tap the tube wall to mix, and let stand on ice for 30 min. Heat shock in a 42°C water bath for 45 sec, then immediately place on ice to cool. Add 900 ml of [unspecified substance] to a clean bench. In LB broth, the cells were incubated at 37 °C for 1 h (180 rpm). After centrifugation at 5000 rpm for 5 min, 900 μL of supernatant was discarded, and the cells were resuspended and spread onto a medium containing 50 μL of LB broth. LB plates containing g / L ampicillin Amp resistance were incubated at 37 °C for 12–16 h.
[0083] (4) After culturing, single clones were selected and sequenced to verify the successful construction of Donor DNA. Figure 9 ).
[0084] 2. Preparation of Fusarium R1 protoplasts
[0085] (1) Fusarium R1 was activated on PDA plate medium and cultured at 30 °C for 2 days to obtain activated strains; the composition of PDA medium was: glucose 20 g / L, potato 200 g / L, agar 20 g / L, solvent was distilled water, and pH was natural.
[0086] (2) Add 10 mL of 0.1% Tween-80 (solvent is water) to the plate contaminated with spores from step (1), gently scrape it off with an inoculation loop, filter it through a small funnel with cotton to obtain a spore suspension, and dilute the spore suspension with 0.1% Tween-80 to 1×10⁻⁶. 7 Approximately 1 conidia / mL; 1 mL of the diluted spore suspension was inoculated into 30 mL of CMC-Na medium and cultured at 28 ℃ and 180 rpm for approximately 72 h, then conidia were collected. The CMC-Na medium consisted of: CMC-Na 15 g / L, NaNO3 2 g / L, KH2PO4 1 g / L, MgSO4 0.5 g / L, yeast extract 1 g / L, distilled water as solvent, and natural pH.
[0087] (3) Take 2 mL of 1×10 7 A spore suspension of 100 spores / mL was placed in 100 mL of YEPD medium and incubated at 28°C. Once the spores germinated into young mycelia, the mycelia were filtered through sterile gauze and washed with 0.7 M NaCl buffer. The YEPD medium consisted of: 20 g / L peptone, 10 g / L yeast extract, 0.5 g / L MgSO4, 20 g / L glucose, and distilled water as the solvent, with a natural pH.
[0088] (4) Take 1 g of the cleaned mycelial clump and resuspend it in 10 mL of enzymatic hydrolysate (the solvent is 0.7 M NaCl buffer solution, the total amount of enzyme is 20 mg / mL, and the mass ratio is 3:1:1 for lysozyme: yatalase: lysozyme). Remove the wall at 36 ℃ and 180 r / min for 4 h. Take samples at regular intervals to observe the protoplasts under a microscope. When vacuoles appear in most spore cells, it indicates that most spores have formed protoplasts. Filter with four layers of gauze, centrifuge at 4 ℃ and 2000 rpm for 15 min, discard the supernatant, and collect the protoplasts at the bottom of the tube.
[0089] (5) After enzymatic hydrolysis, the protoplasts were washed twice with pre-cooled STC solution, centrifuged at 2000 rpm for 5 min at 4 ℃, and the supernatant was removed. The precipitate was resuspended in 1 mL of STC solution and added at 100... Protoplast preparation is complete, dispensed in L / tubes. The STC solution composition is: sorbitol 218 g / L, 1M Tris-HCl (pH 7.5) 10 mL, CaCl2·2H2O 1.47 g / L, solvent is distilled water, pH is natural, and it is stored at 4 ℃.
[0090] 3. pFRCas9-G418-FCC1 and Donor DNA were co-transformed into protoplasts to obtain FCC1 knockout transformants.
[0091] (1) To 100 10 mmol / L of Fusarium R1 protoplasts were added respectively. L pFRCas9-G418-FCC1, 10 LDonor DNA and 5 Mix L-heparin sodium aqueous solution (5 mg / mL) by gently stirring the centrifuge tube with your finger, and incubate on ice for 30 min.
[0092] (2) After the ice bath, remove and add 200 Mix L SPTC solution gently with your finger, incubate on ice for 20 min, then remove from the ice bath and add 800 mL of solution. L SPTC solution was allowed to stand at 26°C for 20 min. The SPTC solution composition was: PEG6000 400 g / L, solvent was STC solution, pH was natural, and it was stored at 4°C.
[0093] (3) Transfer the above system to approximately 40 mL of a 45 °C container containing G418 (30) g / mL) and Amp (100 g / mL) Immediately mix the solution with TB3 transformation medium (g / mL) and transfer to two sterile plates. Incubate at 25°C for 5-7 days. Subsequent incubation should be carried out with a solution containing 30 g / mL. Transformants were passaged on PDA plates containing G418 resistance at a concentration of g / mL, and successfully transformed were selected. The cells were passaged three times on PDA plates containing the G418 resistance marker, then transferred to ordinary PDA plates for two more passages to obtain stable transformants. The cycle was approximately 20 days. The transformation medium TB3 consisted of: 3.0 g / L yeast extract, 3.0 g / L acid-hydrolyzed casein, 200 g / L sucrose, 20 g / L agar, and distilled water as the solvent, with a natural pH.
[0094] 4. Validation of knockout mutants
[0095] (1) The DNA of wild-type R1 and 9 mutant strains screened in step 3 were amplified using primers YZ-F / YZ-R (Table 2). These primers were located upstream and downstream of the FCC1 gene. Wild-type R1 showed a clear amplification of a 5787 bp band, while the knockout mutants showed a 4522 bp band after the FCC1 gene was knocked out. This proves that the FCC1 gene has been successfully knocked out. The specific PCR amplification conditions are shown in Table 6.
[0096] Table 6 PCR Validation Reaction System and Procedure
[0097]
[0098] (2) Based on the gel electrophoresis diagram of the PCR products ( Figure 10 ) and sequencing validation diagram ( Figure 11The results showed that 7 out of 9 transformants were successfully knocked out, with a knockout efficiency of 77.8%.
[0099] 5. Morphological changes in FCC1 knockout strains
[0100] Successfully validated FCC1 knockout strains and unsuccessfully knocked-out strains were cultured on PDA plates at 25°C for 3 days. Photographs were taken and observed, revealing significant phenotypic changes in the FCC1 knockout strains. Figure 12 The fact that the center of the strain is solid yellow and the strain is small in size proves that the FCC1 gene can be used as a phenotypic reporter gene.
[0101] Example 4: Knockout of endogenous phenotypic reporter base FCC1-homologous recombination
[0102] The method of Example 3 was adopted, except that pFRCas9-G418-FCC1 in step 3 was omitted. The selected transformants were passaged for 5 generations in PDA plates containing the G418 resistance marker, and then passaged for 2 more generations in ordinary PDA plates. After observation, it was found that one strain lost growth during passage, and the remaining 9 FCC1 knockout strains did not show obvious phenotypic changes. Figure 13 The knockout efficiency is 0%.
Claims
1. A dual sgRNA site knockout cassette for highly efficient gene knockout in Fusarium oxysporum, characterized in that, The dual sgRNA site knockout cassette includes a promoter, tRNA, sgRNA1, sgRNA2, gRNA backbone, and T6 terminator.
2. The dual sgRNA site knockout cassette as described in claim 1, characterized in that, The dual sgRNA site knockout cassette is composed of the following components connected in sequence: 5S rRNA promoter, tRNA, sgRNA1, sgRNA backbone, tRNA, sgRNA2, tRNA, sgRNA backbone, and T6 terminator.
3. The dual sgRNA site knockout cassette as described in claim 2, characterized in that, The 5S rRNA promoter nucleotide sequence is shown as 1-119bp in SEQ ID NO.9, the tRNA nucleotide sequence is shown as 120-190bp, 291-361bp, and 462-533bp in SEQ ID NO.9, the sgRNA backbone nucleotide sequence is shown as 211-290bp and 382-461bp in SEQ ID NO.9, and the T6 terminator nucleotide sequence is shown as 533-538 in SEQ ID NO.
9.
4. A plasmid containing the dual sgRNA site knockout cassette as described in claim 1, characterized in that, The plasmid was constructed by inserting the double sgRNA site knockout cassette into the filamentous fungus gene knockout plasmid pFC332.
5. A CRISPR / Cas9 system comprising the dual sgRNA site knockout cassette of claim 1, characterized in that, The system includes a CRISPR / Cas9 knockout vector pFRCas9-G418 containing a dual sgRNA site knockout cassette; the knockout vector pFRCas9-G418 replaces the nuclear localization sequence on the filamentous fungal gene knockout plasmid pFC332 with the endogenous nuclear localization sequence HTB of Fusarium oxysporum, and replaces hygromycin (Hyg) resistance with genimycin G418 resistance.
6. The CRISPR / Cas9 system as described in claim 5, characterized in that, The endogenous nuclear localization sequence HTB nucleotide sequence is shown in SEQ ID NO.
1.
7. The CRISPR / Cas9 system as described in claim 5, characterized in that, The knockout vector pFRCas9-G418 is composed of the following elements connected in sequence: Cas9, endogenous nuclear localization sequence HTB, upstream fragment for hygromycin (Hyg) resistance, G418 resistance, downstream fragment for hygromycin (Hyg) resistance, and AmpR promoter.
8. The CRISPR / Cas9 system as described in claim 5, characterized in that, The nucleotide sequence of the knockout vector pFRCas9-G418 is shown as the sequence of SEQ ID NO.2 + SEQ ID NO.3 linked end to end.
9. A method for constructing the CRISPR / Cas9 system according to claim 5, characterized in that, The method includes the following steps: (1) The gene knockout target sites sgRNA1 and sgRNA2 of the target gene were analyzed and selected using the sgRNA design software CIDP. (2) Based on the selected target sites, the knockout cassette sequences containing sgRNA1 and sgRNA2 were PCR-generated using pFR5S-cass as a template. The sequences were then assembled into the CRISPR / Cas9 knockout vector pFRCas9-G418 using seamless cloning technology to construct a CRISPR / Cas9 system containing dual sgRNA site knockout cassettes.
10. A method for gene knockout using the CRISPR / Cas9 system as described in claim 5, characterized in that, The method includes the following steps: (1) Design Donor DNA for homologous end repair of the genome according to the target gene to be knocked out; (2) Prepare protoplasts of Fusarium oxysporum and transfer a CRISPR / Cas9 knockout vector containing a double sgRNA knockout cassette and Donor DNA into Fusarium oxysporum host cells via PEG-mediated protoplast transformation to achieve the knockout of the target gene.