A probe combination, a kit and a detection method for detecting nucleic acid

By combining a specific hairpin switch probe (HSP) with a universal molecular beacon, the problems of high cost and limited multiplexing capability of existing qPCR and ddPCR methods are solved, achieving highly specific and economical nucleic acid detection, especially accurate detection of low-frequency mutation sites.

CN122104883APending Publication Date: 2026-05-29WUXI PEOPLES HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
WUXI PEOPLES HOSPITAL
Filing Date
2026-04-14
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing qPCR and ddPCR methods rely on target-specific fluorescent probes, which are costly and have long synthesis cycles, making them difficult to widely apply in clinical and research fields, and their multiplexing capabilities are limited.

Method used

The method employs a combination of a specific hairpin switch probe (HSP) and a universal molecular beacon. The HSP consists of a prominent sequence, a target nucleic acid-specific binding region, and a complementary sequence. The universal molecular beacon is labeled with a fluorescent group and a quenching group. Fluorescent signals are generated through changes in the hairpin structure during PCR, achieving highly specific and economical detection.

Benefits of technology

It achieves highly specific and economical nucleic acid detection, accurately detects low-frequency mutation sites, is suitable for real-time fluorescence quantitative PCR and digital PCR, and improves detection sensitivity and multiplexing capability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104883A_ABST
    Figure CN122104883A_ABST
Patent Text Reader

Abstract

The application provides a probe combination, a kit and a detection method for detecting nucleic acid, and belongs to the technical field of nucleic acid detection. The application provides a probe combination for detecting nucleic acid, wherein the probe combination comprises a specific hairpin switch probe HSP and a universal molecular beacon; the HSP is composed of a middle template binding sequence, two end beacon binding sequences and complementary sequences. The universal molecular beacon comprises a short stem structure and a long loop sequence, and the loop sequence is designed to be complementary to the beacon binding sequence region of the HSP. When the temperature is increased or there is a DNA strand complementary to the middle loop sequence, the universal molecular beacon is unfolded from a hairpin structure to a linear structure, the 5' and 3' end groups are far away from each other, and the fluorescence is significantly increased. The HSP and the universal molecular beacon provided by the application are suitable for the detection of qPCR and ddPCR, and can meet the detection of nucleic acid and mutant nucleic acid, and have high sensitivity and strong specificity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid detection technology, specifically relating to a probe combination, reagent kit, and detection method for detecting nucleic acids. Background Technology

[0002] Nucleic acid amplification is crucial in clinical diagnostics and biomedical research, with core applications including gene expression analysis, genotyping, and pathogen load quantification. Polymerase chain reaction (PCR) methods have demonstrated exceptional efficiency in amplifying minute amounts of target nucleic acids. Over the years, PCR technology has evolved from gel detection to quantitative real-time PCR (qPCR), and further to digital PCR (ddPCR) technology, which distributes the reaction system into numerous independent microreaction units.

[0003] Current qPCR and ddPCR methods primarily rely on two types of detection systems: non-selective intercalation dyes or target-specific fluorescent probes. While fluorescent dye methods are inexpensive, their multiplex detection capabilities are limited and they are prone to generating non-specific signals. In contrast, target-specific probes such as TaqMan probes or molecular beacons can achieve highly specific detection and possess multiplex detection capabilities. However, these probes must be labeled with fluorescent groups and quenchers, and their cost increases with the number of targets, while the probe synthesis cycle is significantly longer than that of conventional primers. These limitations severely restrict the widespread application of qPCR and ddPCR in clinical and research fields.

[0004] Therefore, there is a clear clinical need to develop a universal fluorescent probe qPCR / ddPCR platform that combines high specificity and cost-effectiveness. Summary of the Invention

[0005] This invention provides a probe combination, kit, and detection method for detecting nucleic acids. The probe combination is characterized by high specificity and cost-effectiveness, and can also accurately detect low-frequency mutation sites.

[0006] This invention provides a probe assemblies for detecting nucleic acids, the probe assemblies comprising a specific hairpin switch probe (HSP) and a universal molecular beacon; The structure of the specific hairpin switch probe HSP includes, from the 5' end to the 3' end, a protruding sequence, a target nucleic acid-specific binding region, and a complementary sequence. The complementary sequence is complementary to the protruding sequence to form a hairpin structure, and the protruding sequence is not complementary to the target nucleic acid sequence. The structure of the universal molecular beacon includes a circular sequence and complementary stem sequences at both ends of the circular sequence, the circular sequence being complementary to the protruding sequence of the specific hairpin switch probe HSP.

[0007] In one specific embodiment of the present invention, in the specific hairpin switch probe HSP, the length of the protruding sequence is 10-25 bases, the length of the region specifically binding to the target nucleic acid is 20-40 bases, and the length of the complementary sequence is 5-20 bases.

[0008] In one specific embodiment of the present invention, the 5' end and 3' end of the universal molecular beacon are modified with a fluorescent group and a quenching group, respectively.

[0009] In one specific embodiment of the present invention, the target nucleic acid includes natural nucleic acid, synthetic nucleic acid, mutated nucleic acid, or modified nucleic acid with altered hybridization affinity.

[0010] This invention also provides the application of the above-mentioned probe combination in the preparation of nucleic acid detection kits.

[0011] In one specific embodiment of the present invention, the nucleic acid detection kit includes either a real-time fluorescence quantitative PCR kit or a digital PCR kit.

[0012] The present invention also provides a method for detecting nucleic acids, comprising the following steps: designing specific primer pairs based on the target nucleic acid and constructing an amplification system with the above-mentioned probe combination, and performing a real-time fluorescence quantitative PCR reaction or a digital PCR reaction.

[0013] In one specific embodiment of the present invention, when the nucleic acid is detected by real-time quantitative PCR, the concentration of the specific primer pairs in the real-time quantitative PCR system is 0.03~1μM, the concentration of the specific hairpin switch probe is 0.01~3μM, and the concentration of the general molecular beacon is 0.01~1μM.

[0014] In one specific embodiment of the present invention, when the nucleic acid is detected by digital PCR, the concentration of the specific primer pairs in the digital PCR system is 0.1~3μM, the concentration of the specific hairpin switch probe is 0.1~3μM, and the concentration of the universal molecular beacon is 0.1~3μM.

[0015] In one specific embodiment of the present invention, when constructing the amplification system, the template is any one of the following: extracted sample DNA containing rare mutant or wild-type genes, cDNA obtained by reverse transcription, synthetic plasmid DNA, and single-stranded DNA.

[0016] Beneficial Effects: This invention provides a probe assemblies for detecting nucleic acids, comprising a specific hairpin switch probe (HSP) and a universal molecular beacon. The HSP consists of a central template-binding sequence, two beacon-binding sequences, and complementary sequences. The universal molecular beacon is labeled with a fluorescent group and a quencher group, and includes a short stem structure and a long circular sequence. The circular sequence is designed to be complementary to the beacon-binding sequence region of the HSP. At low temperatures or in the absence of hybridization strands, the universal molecular beacon folds into a hairpin structure, with the 5' and 3' end groups close to each other, and does not emit fluorescence. Upon increasing temperature or in the presence of a DNA strand complementary to the central circular sequence, the universal molecular beacon unfolds from the hairpin structure into a linear structure, with the 5' and 3' end groups moving further apart, and fluorescence significantly increases.

[0017] The HSP and universal molecular beacon described in this invention are suitable for detection in qPCR and ddPCR. During the annealing and extension phase of PCR, the intermediate sequence of the HSP hybridizes with the template, the hairpin structure rapidly unfolds, and it is cleaved by enzymes during primer extension, releasing its 5' protruding sequence to form mediating DNA. The mediating DNA and the intermediate circular sequence of the universal molecular beacon then undergo complementary hybridization, causing the molecular beacon to unfold, increasing fluorescence, and generating a fluorescence enhancement signal. The fluorescence enhancement detected in qPCR or ddPCR indicates the presence of the target template.

[0018] This invention also establishes a novel qPCR / ddPCR method for nucleic acid target detection, using universal molecular beacons and HSP for detection, the principle of which is as follows: Figure 1 As shown, during the PCR denaturation step, the double-stranded template, HSP, and molecular beacon all transform into a single-stranded state. Subsequently, during the cooling phase before primer annealing and extension, the template-binding sequence of the HSP hybridizes with the template. Mediated DNA release occurs in each PCR cycle as primer extension and Taq polymerase cleaves the HSP. This mediated DNA binds to the loop region of the universal molecular beacon, causing the molecular beacon hairpin to open and generate an enhanced fluorescence signal. The enhanced fluorescence detected in qPCR or ddPCR indicates the presence of the target template. When the specific template is missing, primer extension, HSP cleavage, and mediated DNA generation cannot occur. Simultaneously, during the annealing / extension step, the HSP rapidly folds to form a stable hairpin structure. This stable hairpin structure effectively blocks the interaction between its beacon-binding sequence and the molecular beacon, thus ensuring that the molecular beacon remains folded, ultimately achieving a low-level fluorescence signal. Attached Figure Description

[0019] Figure 1 A schematic diagram illustrating the principle of a universal molecular beacon detection system for nucleic acid detection; Figure 2The graph shows a comparison of the detection results of the HSP system and specific probes for nucleic acid targets. In the graph, A: signal acquisition for HPV18 detection using HSP qPCR; B: linearity graph for HPV18 detection; C: signal acquisition for HPV16 detection using HSP qPCR; D: linearity graph for HPV16 detection. Figure 3 To improve the universal probe system for detecting HPV18 targets, the figure shows: A: qPCR program, B: signal acquisition with and without low temperature program, C: signal acquisition at different low temperatures, and D: linearity graph of HPV18 detection at low temperature. Figure 4 The results of establishing a multiplex HSP system and testing clinical samples are shown in the figure. A: Design diagram of the universal molecular beacon detection system; B: Linear graph of different samples; C: Data on cervical samples for detecting four HPV types and comparison with commercial kits; D: Sensitivity, specificity and accuracy of clinical sample testing. Figure 5 The diagram shows the establishment of an HSP digital PCR (ddPCR) system. A: Schematic diagram of the principle of HSP digital PCR; B: Sequences and modifications of three different molecular beacons; C: Fluorescence patterns of digital PCR obtained based on different molecular beacons; D: Quantitative gradient dilution of template using HSP digital PCR and specific probe digital PCR; E: Fluorescence patterns of HSP digital PCR detecting different concentrations of DNA. Figure 6 The diagram shows the results of HSP-based ddPCR detection of mutant DNA. Figure A: Schematic diagram of HSP digital PCR detection of mutant DNA, using a pair of HSPs and a pair of universal molecular beacons; B: Quantitative data of simulated samples with different mutation frequencies detected by HSP digital PCR; C: Raw fluorescence images of simulated samples with different mutation frequencies quantified by HSP digital PCR; D: Detection of clinical plasma ctDNA samples using HSP digital PCR and specific probe digital PCR; E: Results of detecting EGFR L858R mutation using the two methods. Detailed Implementation

[0020] This invention provides a probe assemblies for detecting nucleic acids, the probe assemblies comprising a specific hairpin switch probe (HSP) and a universal molecular beacon; The structure of the specific hairpin switch probe HSP includes, from the 5' end to the 3' end, a protruding sequence, a target nucleic acid-specific binding region, and a complementary sequence. The complementary sequence is complementary to the protruding sequence to form a hairpin structure, and the protruding sequence is not complementary to the target nucleic acid sequence. The structure of the universal molecular beacon includes a circular sequence and complementary stem sequences at both ends of the circular sequence, the circular sequence being complementary to the protruding sequence of the specific hairpin switch probe HSP.

[0021] The HSP of this invention has an intermediate sequence of 20-40 bases that is a specific template-binding sequence, a 10-25 bases protrusion at the 5' end (an artificially modified sequence that is not complementary to any sequence of the target nucleic acid), and a 5-20 bases complementary sequence at the 3' end that can complement the 5' protrusion to form a hairpin structure. The 5' and 3' ends of the universal molecular beacon described in this invention are modified with fluorescent groups and quenching groups, respectively. There are no special limitations on the types of fluorescent groups and quenching groups. Any fluorescent group and quenching group in the art can be used. When used for multiple detection, different fluorescent groups can be used on the universal molecular beacon designed for different detection targets.

[0022] The probe combination described in this invention can be used to detect target nucleic acids, including natural nucleic acids, synthetic nucleic acids, mutated nucleic acids, or modified nucleic acids that alter hybridization affinity.

[0023] In one embodiment of the present invention, the HPV18 target is used as the target nucleic acid for detection. The nucleotide sequences of the designed HSP and universal molecular beacon are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively. The nucleotide sequences from the 5' end to the 3' end are as follows: SEQ ID No. 3: CAGCACGACTGTCGCTAGCATTGTTCCATGCGCAGGAGGTCCACAACAGTCGTGCTaa (the bolded area is the template complementary sequence); SEQ ID No.4: FAM-CCCCCTTAGCGACAGTCGTGCTGAGAGGGGG-BHQ1; When HPV16 is the target, the designed HSP sequence is shown in SEQ ID No. 8, and the universal molecular beacon is shown in SEQ ID No. 4. SEQ ID No. 8: CAGCACGACTGTCGCTAACAAGCAGAACCGGACAGAGCCCATACAGTCGTGCaa (The bolded area is the template complementary sequence). When HPV31 is the target, the nucleotide sequences of the designed specific HSP and universal molecular beacon are shown in SEQ ID No. 12 and SEQ ID No. 13, respectively: SEQ ID No. 12: TGAGCTCACTGAGTCAATGTTATAGACAGTCCAGCTGGACAAGCATCAGTGAGCTa (The bolded area is the template complementary sequence); SEQ ID No.13: ROX-CCCCTTGACTCAGTGAGCTCACAGAGGGGG-BHQ2; When HPV33 is used as the target, the nucleotide sequence of the designed specific HSP is shown in SEQ ID No. 16; HPV33 can be detected using the universal molecular beacon shown in SEQ ID No. 13. SEQ ID No. 16: TGAGCTCACTGAGTCAACAGCAAGTGACCTACGAACCATACAGCATCAGTGAGCTat (The bolded area is the template complementary sequence). When EGFR is used as the target, the nucleotide sequence of the designed specific HSP is shown in SEQ ID No. 22. Three universal molecular beacons were designed to screen for molecular beacons suitable for digital PCR. The nucleotide sequences of the three designed universal molecular beacons are shown in SEQ ID No. 23~SEQ ID No. 25. SEQ ID No. 22: CAGCACGACTGTCGCTAACAGATTTTGGGCTGGCCAAACTGCTACAGTCGTGCaa (the bolded area is the template complementary sequence); SEQ ID No.23: FAM-CCCACTTAGCGACAGTCGTGCTGAGACTAGTGGG-BHQ1; SEQ ID No.24: ROX-CCCACTTGACTCAGTGAGCTCACAGACTAGTGGG-BHQ2; SEQ ID No. 25: FAM-CCCCCTTAGCGACAGTCGTGCTGAGAGGGGG-DABCYL; When the EGFRL858R mutation is used as the target, the sequence of the wild-type specific HSP is shown in SEQ ID No. 22, and the sequence of the mutant specific HSP is shown in SEQ ID No. 27; the nucleotide sequences of the designed universal molecular beacon B (corresponding to the wild-type HSP) and universal molecular beacon A (corresponding to the mutant HSP) are shown in SEQ ID No. 23~SEQ ID No. 24, respectively. SEQ ID No. 27: TGAGCTCACTGAGTCAACAGATTTTGGGCGGGCCAAACTGCaTCAGTGAGCTat (The bolded area is the template complementary sequence).

[0024] This invention also provides the application of the above-mentioned probe combination in the preparation of nucleic acid detection kits.

[0025] The nucleic acid detection kits described in this invention include real-time fluorescence quantitative PCR kits or digital PCR kits. The kits also include other reagents that can meet the requirements of the PCR system, such as hot-start polymerase, polymerase buffer, dNTPs, and MgCl2.

[0026] The present invention also provides a method for detecting nucleic acids, comprising the following steps: designing specific primer pairs based on the target nucleic acid and constructing an amplification system with the above-mentioned probe combination, and performing a real-time fluorescence quantitative PCR reaction or a digital PCR reaction.

[0027] When the nucleic acid is detected using real-time quantitative PCR, the concentrations of the specific primer pairs in the real-time quantitative PCR system of the present invention are all 0.03~1μM, the concentrations of the specific hairpin switch probes are 0.01~3μM, and the concentrations of the general molecular beacons are 0.01~1μM.

[0028] When the nucleic acid is detected using digital PCR, the concentrations of the specific primer pairs, the specific hairpin switch probes, and the general molecular beacons in the digital PCR system of the present invention are all 0.1~3 μM.

[0029] When constructing the amplification system, the template used in this invention is any one of the following: extracted sample DNA containing rare mutant or wild-type genes, cDNA obtained by reverse transcription, synthetic plasmid DNA, and single-stranded DNA.

[0030] The working principle of the detection method described in this invention is as follows: Figure 1As shown, qPCR / ddPCR can be used for nucleic acid target detection. This method employs a universal molecular beacon and an unmodified specific hairpin switch probe (HSP). The HSP consists of a central template-binding sequence, beacon-binding sequences at both ends, and complementary sequences. The universal molecular beacon is labeled with a fluorescent group and a quencher group, and includes a short stem structure and a long circular sequence designed to be complementary to the beacon-binding sequence region of the HSP. During the PCR denaturation step, the double-stranded template, HSP, and molecular beacon all transform into a single-stranded state. Subsequently, during the cooling phase before primer annealing and extension, the template-binding sequence of the HSP hybridizes with the template. Mediated DNA release occurs in each PCR cycle as primer extension and Taq polymerase cleaves the HSP. The mediated DNA binds to the circular region of the universal molecular beacon, causing the molecular beacon hairpin to open and generating an enhanced fluorescence signal. The enhanced fluorescence detected in qPCR or ddPCR indicates the presence of the target template. When the specific template is missing, primer extension, HSP cleavage, and mediated DNA generation cannot occur. Simultaneously, during the annealing / extension step, the HSP can rapidly fold to form a stable hairpin structure. This stable hairpin structure effectively blocks the interaction between its beacon binding sequence and the molecular beacon, thereby ensuring that the molecular beacon remains in a folded state, ultimately achieving a low-level fluorescence signal.

[0031] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a probe combination, kit, and detection method for detecting nucleic acids provided by the present invention, should not be construed as limiting the scope of protection of the present invention.

[0032] The target plasmid used in this embodiment of the invention is a pUC-GW plasmid in which a segment of the target sequence is inserted. Sma The template plasmid was constructed by cloning the I site. The sequences corresponding to each target are shown below: HPV16 target (SEQ ID No. 28): CTGTTATGAGCAATTAAATGACAGCTCAGAGGAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATTACAATATTGTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGTTGTGCGTACAAAGCACACACGTAGACATTCGT; HPV18 target (SEQ ID No. 29): AGGGTCGGATATGGTAGATTTTATTGATACACAAGGAACATTTTGTGAACAGGCAGAGCTAGAGACAGCACAGGCATTGTTCCATGCGCAGGAGGTCCACAATGATGCACAAGTGTTGCATGTTTTAAAACGAAAGTTTGCAGGAGGCAGCACAGAAAACAG; HPV31 target (SEQ ID No. 30): TGTGTTAGATTTGCAACCTGAGGCAACTGACCTCTACTGTTATGAGCAATTACCCGACAGCTCAGATGAGGAGGATGTTATAGACAGTCCAGCTGGACAAGCAAAACCGGACACATCCAATTACAATATCGTTACCTTTTGTTGTCAGTGTGAGTCTACACTTCGT; HPV33 target (SEQ ID No. 31): ACCTATACTGCTATGAGCAATTAAGTGACAGCTCAGATGAGGATGAAGGCTTGGACCGGCCAGATGGACAAGCACAACCAGCCACAGCTGATTACTACATTGTAACCTGTTGTCACACTTGTAACAC; ACTB target (SEQ ID No. 32): GCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCT; EGFR target (SEQ ID No. 33): GCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCTGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGG.

[0033] Example 1 A highly efficient universal probe detection system was used to detect HPV18 and HPV16, as shown in steps 1)-3): 1) Based on the HPV18 target, using the synthesized plasmid DNA (with a background of 3 ng / μL of 293T genomic DNA) as a template, upstream primers, downstream primers, a specific HSP (SEQ ID No. 3), and a universal molecular beacon (SEQ ID No. 4) were designed, and a specific probe (SEQ ID No. 5) was designed as a comparison; Upstream primer (SEQ ID No. 1): AGAACATTTTGTGAACAGGCA; Downstream primer (SEQ ID No. 2): AACATGCAACACTTGTGC; Probe (SEQ ID No. 5): FAM-CATTGTTCCATGCGCAGGAGGT-BHQ1; The reaction system consisted of 30 μL of the following: 2 mM MgCl2, 0.2 mM dNTPs, 0.25 μM upstream and downstream primers, 0.06 μM specific fluorescent probe or universal molecular beacon, 0.03 U / μL hot-start polymerase, and 10 μL of template at different concentrations. The specific probe and HSP system were each in their own tubes.

[0034] 2) Based on the HPV16 target, using the synthesized plasmid DNA (with a background of 3 ng / μL of 293T genomic DNA) as a template, upstream primers, downstream primers, a specific HSP (SEQ ID No. 8), and a universal molecular beacon (SEQ ID No. 4) were designed, and a specific probe was designed as a comparison. Upstream primer (SEQ ID No. 6): AATGACAGCTCAGAGGAGGAG; Downstream primer (SEQ ID No. 7): GCACAACCGAAGCGTAGA; Probe (SEQ ID No.9): FAM-CAAGCAGAACCGGACAGAGCC-BHQ1; The reaction system consisted of 30 μL of the following: 2 mM MgCl2, 0.2 mM dNTPs, 0.3 μM each of upstream and downstream primers, 0.08 μM specific fluorescent probe / 0.06 μM universal molecular beacon, 0.03 U / μL hot-start polymerase, and 10 μL of templates of different concentrations. The specific probe and HSP system were each in their own tubes.

[0035] 3) qPCR amplification was performed using the following procedure: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 55℃ for 20 s; 50 cycles. The Shanghai Hongshi SLAN-96S system was used for qPCR amplification and signal acquisition. The results are as follows: Figure 2As shown, the universal probe system and the specific probe are similar. In experiments based on HPV18 and HPV16 targets, both can effectively detect 10 copies of the nucleic acid target per reaction, demonstrating excellent sensitivity and linearity.

[0036] Example 2 1) Based on the HPV18 target, using plasmid DNA (293T genomic DNA with a background of 3 ng / μL) as a template, upstream primers, downstream primers, specific HSPs and universal molecular beacons were designed, and the nucleotide sequences are shown in SEQ ID No. 1~SEQ ID No. 4, respectively; The reaction system consisted of 30 μL of the following: 3 mM MgCl2, 0.2 mM dNTPs, 0.25 μM each of upstream and downstream primers, 0.06 μM universal molecular beacon, 0.03 U / μL hot-start polymerase, and 10 μL of templates of different concentrations. Each template of different concentrations was used in a separate tube for qPCR amplification.

[0037] 2) qPCR amplification was performed. The specific reaction procedure including the low-temperature step was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 58℃ for 20 s; low-temperature illumination for 15 s; for 50 cycles. Five temperature gradients were designed for comparison during the illumination step: 58℃, 54℃, 50℃, 46℃, and 42℃. The specific reaction procedure without the low-temperature step was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 58℃ for 20 s; for 50 cycles.

[0038] 3) qPCR amplification and signal acquisition were performed using the Shanghai Hongshi SLAN-96S system. The results are as follows: Figure 3 As shown, adding a low-temperature step increases fluorescence intensity and advances the Ct value, indicating improved qPCR performance. Furthermore, 50℃ and 46℃ were found to be optimal low-temperature values. Template concentration gradient experiments demonstrated excellent detection sensitivity and linearity.

[0039] Example 3 A multiplex HSP detection system was established and applied to clinical sample testing. Different samples were amplified by qPCR in separate tubes, as shown in steps 1-4). 1) Based on the HPV18 target, design upstream primer (SEQ ID No.1), downstream primer (SEQ ID No.2), specific HSP (SEQ ID No.3), and universal molecular beacon (UMB 1, SEQ ID No.4). Based on the HPV16 target, an upstream primer (SEQ ID No. 6), a downstream primer (SEQ ID No. 7), a specific HSP (SEQ ID No. 8), and a universal molecular beacon (UMB 1, SEQ ID No. 1) were designed. Based on the HPV31 target, an upstream primer (SEQ ID No. 10), a downstream primer (SEQ ID No. 11), a specific HSP (SEQ ID No. 12), and a universal molecular beacon (UMB 2, SEQ ID No. 13) were designed, with nucleotide sequences shown in SEQ ID No. 10~SEQ ID No. 13, respectively. SEQ ID No.10: CTGAGGCAACTGACCTCTAC; SEQ ID No.11:AACGATATTGTAATTGGATGTGTC; Based on the HPV33 target, an upstream primer (SEQ ID No. 14), a downstream primer (SEQ ID No. 15), a specific HSP (SEQ ID No. 16), and a universal molecular beacon (UMB 2, SEQ ID No. 13) were designed. SEQ ID No.14: CAATTAAGTGACAGCTCAGA; SEQ ID No.15: AGGTTACAATGTAGTAATCAGC; Based on the ACTB target, upstream primer (SEQ ID No. 17), downstream primer (SEQ ID No. 18), and specific probe (SEQ ID No. 19) were designed. SEQ ID No.17: AGGCATCCTCACCCTGAAG; SEQ ID No.18: CATTGTAGAAGGTGTGGTGCC; SEQ ID No.19: HEX-GCATCGTCACCAACTGGGACG-BHQ1; 2) The reaction system for each sample was 30 μL: 3 mM MgCl2, 0.2 mM dNTPs, and universal molecular beacon concentrations of 0.06 (UMB 1) and 1 μM (UMB 2), respectively; upstream and downstream primers for HPV18 were 0.4 μM, and HSP was 0.4 μM; upstream and downstream primers for HPV16 were 0.2 μM, and HSP was 0.3 μM; upstream and downstream primers for HPV31 were 0.2 μM, and HSP was 0.3 μM; upstream and downstream primers for HPV33 were 0.3 μM, and HSP was 0.3 μM; upstream and downstream primers for ACTB were 0.05 μM, and the specific probe was 0.02 μM; and 0.05 U / μL hot-start polymerase and 10 μL template DNA were included.

[0040] 3) qPCR amplification was performed using the following procedure: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 58℃ for 20 s; and low-temperature (50℃) light exposure for 15 s, for 50 cycles. The Shanghai Hongshi SLAN-96S system was used for qPCR amplification and signal acquisition.

[0041] 4) Results are as follows Figure 4 As shown, the HSP system can perform multiplex nucleic acid detection with excellent performance. Concentration gradient experiments demonstrate that 200 copies of different HPV target DNA can be successfully detected by the multiplex HSP. In the detection of 46 cervical DNA samples, the multiplex HSP method achieved a detection accuracy of 95.6% compared to commercial kits.

[0042] Example 5 Apply the HSP system to the digital PCR (ddPCR) platform, and the detection system components are as shown in steps 1-3): 1) Based on the EGFR target, upstream primer (SEQ ID No. 20), downstream primer (SEQ ID No. 21), specific HSP (SEQ ID No. 22), and universal molecular beacon (UMB-I, II, III) were designed, and a specific probe (SEQ ID No. 26) was designed as a control, thereby screening for UMB suitable for digital PCR; SEQ ID No.20: AACGTACTGGTGAAAACACCG; SEQ ID No.21: ATGGTATTCTTTTCTCTTCCGCAC; UMB-I (SEQ ID No. 23): FAM-CCCACTTAGCGACAGTCGTGCTGAGACTAGTGGG-BHQ1; UMB-II (SEQ ID No. 24): ROX-CCCACTTGACTCAGTGAGCTCACAGACTAGTGGG-BHQ2; UMB-III (SEQ ID No. 25): FAM-CCCCCTTAGCGACAGTCGTGCTGAGAGGGGG-DABCYL; SEQ ID No.26: FAM-CAGTTTGGCCAGCCCAAAATCT-BHQ1; 2) The reaction system consisted of 15 μL of each component, containing 3 μL of digital PCR reaction mix, 1.2 μM of upstream and downstream primers, 0.6 μM of a universal molecular beacon or 0.3 μM of a specific probe, and 5 μL of genomic DNA template. Templates of different concentrations were packaged separately for each ddPCR amplification. After sample injection into the chip, reaction droplets were generated, followed by ddPCR amplification. The specific procedure was: enzyme activation at 95℃ for 10 min; denaturation at 95℃ for 30 s; annealing and extension at 58℃ for 30 s; 55 cycles. Fluorescence was read after the reaction.

[0043] 3) Droplet generation, ddPCR amplification, and signal acquisition were performed using the Leading Technology AD3200 digital PCR system. The results are as follows: Figure 5 As shown, UMB-I, II, and III can all be used in digital ddPCR, with UMB-II showing the best performance and the most significant difference between positive and negative droplet signals. Further HSP ddPCR experiments based on UMB-II demonstrated that it can achieve accurate nucleic acid quantification consistent with specific ddPCR, and exhibits excellent linearity.

[0044] Example 6 DNA mutations were detected using HSP-based ddPCR, with the detection system and components shown in steps 1-3). 1) Based on the EGFR L858R mutation, upstream primer (SEQ ID No. 20), downstream primer (SEQ ID No. 21), wild-type HSP (SEQ ID No. 22), mutant HSP (SEQ ID No. 27), universal molecular beacon B corresponding to wild-type HSP (SEQ ID No. 23), and universal molecular beacon A corresponding to mutant HSP (SEQ ID No. 24) were designed respectively. 2) During detection, wild-type and mutant samples were placed in a single 15 μL tube to construct the reaction system. Each tube contained 3 μL of digital PCR reaction mix, 1.2 μM upstream and downstream primers, 0.6 μM universal molecular beacon, and 5 μL of genomic DNA template. Different template concentrations were used in separate tubes for ddPCR amplification. After sample injection into the chip, reaction droplets were generated, followed by ddPCR amplification. The specific procedure was: enzyme activation at 95°C for 10 min; denaturation at 95°C for 30 s; annealing and extension at 58°C for 30 s; 55 cycles. Fluorescence was read after the reaction.

[0045] 3) Droplet generation, ddPCR amplification, and signal acquisition were performed using the Leading Technology AD3200 digital PCR system. The results are as follows: Figure 6 As shown, the HSP ddPCR method can accurately quantify mutant DNA and wild-type DNA, and the detection of plasma ctDNA mutations yielded results consistent with those obtained by specific ddPCR.

[0046] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A probe assembly for detecting nucleic acids, characterized in that, The probe assembly includes a specific hairpin switch probe (HSP) and a universal molecular beacon. The structure of the specific hairpin switch probe HSP includes, from the 5' end to the 3' end, a protruding sequence, a target nucleic acid-specific binding region, and a complementary sequence. The complementary sequence is complementary to the protruding sequence to form a hairpin structure, and the protruding sequence is not complementary to the target nucleic acid sequence. The structure of the universal molecular beacon includes a circular sequence and complementary stem sequences at both ends of the circular sequence, the circular sequence being complementary to the protruding sequence of the specific hairpin switch probe HSP.

2. The probe assembly according to claim 1, characterized in that, In the specific hairpin switch probe HSP, the length of the protruding sequence is 10-25 bases, the length of the region specifically binding to the target nucleic acid is 20-40 bases, and the length of the complementary sequence is 5-20 bases.

3. The probe assembly according to claim 1, characterized in that, The 5' and 3' ends of the universal molecular beacon are modified with fluorescent and quenching groups, respectively.

4. The probe assembly according to claim 1, characterized in that, The target nucleic acid includes natural nucleic acid, synthetic nucleic acid, mutated nucleic acid, or modified nucleic acid that alters hybridization affinity.

5. The use of the probe combination according to any one of claims 1 to 4 in the preparation of a nucleic acid detection kit.

6. The application according to claim 5, characterized in that, The types of nucleic acid detection kits include real-time fluorescence PCR kits or digital PCR kits.

7. A method for detecting nucleic acids, characterized in that, Includes the following steps: Based on the target nucleic acid, design specific primer pairs and construct an amplification system using the probe combination described in any one of claims 1 to 4, and perform real-time quantitative PCR or digital PCR.

8. The method according to claim 7, characterized in that, When the nucleic acid is detected using real-time quantitative PCR, the concentrations of specific primer pairs in the real-time quantitative PCR system are all 0.03–1 μM, the concentrations of specific hairpin switch probes are 0.01–3 μM, and the concentrations of general molecular beacons are 0.01–1 μM.

9. The method according to claim 7, characterized in that, When the nucleic acid is detected using digital PCR, the concentrations of specific primer pairs, specific hairpin switch probes, and general molecular beacons in the digital PCR system are all 0.1–3 μM.

10. The method according to any one of claims 7 to 9, characterized in that, When constructing the amplification system, the template can be any of the following: extracted sample DNA containing rare mutations or wild-type genes, cDNA obtained by reverse transcription, synthetic plasmid DNA, and single-stranded DNA.