A nucleic acid aptamer for norfloxacin, its intelligent enzyme-linked aptamer sensor, and its application.

By performing 'shortening-end locking' synergistic optimization on norfloxacin nucleic acid aptamers, a high-performance norfloxacin enzyme-linked aptamer sensor was constructed, which solved the problems of low sensitivity and insufficient specificity of norfloxacin detection in existing technologies, and realized efficient and convenient norfloxacin detection.

CN122128313APending Publication Date: 2026-06-02OCEAN UNIV OF CHINA

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
OCEAN UNIV OF CHINA
Filing Date
2026-05-08
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing technologies lack high-performance norfloxacin nucleic acid aptamers and their intelligent enzyme-linked aptamer sensors, making it impossible to effectively identify and detect norfloxacin, resulting in problems such as low detection sensitivity and insufficient specificity.

Method used

A 'shortening-end locking' synergistic optimization strategy was adopted to improve the structure of the norfloxacin nucleic acid aptamer. By shortening the connection region between key stem-loop structures and introducing an end-locking structure, the affinity and structural stability of the aptamer were improved. An enzyme-linked aptamer sensor based on this aptamer was constructed, and the detection of norfloxacin was achieved by utilizing the changes in the catalytic activity of the composite nanozyme.

Benefits of technology

It significantly enhances the affinity of norfloxacin nucleic acid aptamers, improves the sensor's recognition performance and signal transduction efficiency, and possesses high specificity and ease of operation. It is suitable for the detection of norfloxacin in complex matrices and has good potential for rapid on-site detection applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128313A_ABST
    Figure CN122128313A_ABST
Patent Text Reader

Abstract

This invention discloses a nucleic acid aptamer for norfloxacin, its intelligent enzyme-linked aptamer sensor, and its applications, belonging to the field of nucleic acid aptamer technology. The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.7. This invention also provides an enzyme-linked aptamer sensor based on this aptamer, comprising the aptamer, histidine-modified gold nanoparticle composite nanozyme, chitosan, and TMB chromogenic solution. The nucleic acid aptamer of this invention is obtained through a "gap-locking" synergistic optimization strategy, exhibiting high affinity and specificity for norfloxacin. The sensor of this invention couples target recognition events with the regulation of the catalytic activity of the composite nanozyme, and combines this with a smart terminal for quantitative analysis, achieving efficient, stable, and visualized detection of norfloxacin, with promising applications in the field of aquatic product safety monitoring.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a nucleic acid aptamer for norfloxacin, its intelligent enzyme-linked aptamer sensor, and its application, belonging to the field of nucleic acid aptamer technology. Background Technology

[0002] Norfloxacin (NOR) is a common fluoroquinolone antibiotic that has been widely used in clinical anti-infective treatment and the prevention and control of bacterial diseases in animal husbandry. Despite continuous improvement of relevant regulations, irregular use of the drug still exists in some stages of animal husbandry, resulting in the continued risk of norfloxacin residues in animal-derived foods.

[0003] Nucleic acid aptamers are single-stranded DNA or RNA molecules that specifically recognize corresponding targets, obtained through in vitro screening using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technique. They possess advantages such as high specificity and ease of preparation and modification. Currently, there are no reports on nucleic acid aptamers or intelligent enzyme-linked aptamer sensors targeting norfloxacin. Therefore, developing high-performance norfloxacin nucleic acid aptamers and their intelligent enzyme-linked aptamer sensors has significant research value and application prospects. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a norfloxacin nucleic acid aptamer obtained through a "gap-locking" collaborative optimization strategy, and an intelligent enzyme-linked aptamer sensor based on this aptamer. The technical solution of this invention achieves significant improvements in the affinity of the recognition element, structural stability, and signal transduction efficiency of the sensor.

[0005] The technical solution adopted in this invention is as follows: In a first aspect, the present invention provides a nucleic acid aptamer for norfloxacin, the nucleotide sequence of which is shown in SEQ ID NO.7 (named Apt-NOR-2-TF).

[0006] The nucleic acid aptamer of the present invention is obtained by using the original aptamer Apt-NOR (as shown in SEQ ID NO.1), which has a certain affinity for norfloxacin, as the initial sequence, through a “shortening-end locking” synergistic improvement strategy.

[0007] The core design logic of this strategy is as follows: First, through molecular docking and secondary structure prediction, the key binding domains between the original aptamer Apt-NOR and norfloxacin are analyzed, identifying the core stem-loop structures and their spatial arrangement that affect recognition efficiency. Based on this, "shortening" optimization is performed: that is, by appropriately shortening the connection region between the key stem-loop structures, unnecessary spatial distances are compressed, which helps optimize the conformation of the aptamer's recognition pocket, facilitating the entry of target molecules and the formation of a stable complex. Through this step, a shortened aptamer Apt-NOR-2 (SEQ ID NO.3) with initially improved affinity is obtained.

[0008] Furthermore, this invention optimizes the "locking end": artificially designed end-locking structures are introduced at both ends of the shortened-length aptamer Apt-NOR-2. By forming stable end hairpins, the spatial conformation of the aptamer is constrained as a whole, improving its "pre-organization" degree and structural stability. This synergistic optimization makes the aptamer's recognition conformation more stable before and after target binding, thereby significantly reducing the dissociation rate.

[0009] The final obtained Apt-NOR-2-TF has the following secondary structure: Figure 3 As shown, the red box indicates the compact recognition core region formed after "shortening" optimization, and the blue box indicates the end-stabilizing structure introduced by "locking" optimization. The dissociation constant of Apt-NOR-2-TF and norfloxacin was determined by biomembrane interferometry (BLI). K d The value was 23.98 nM, compared to the original aptamer Apt-NOR ( K d =283.9 nM), with affinity increased by approximately 11.9 times.

[0010] Secondly, the present invention provides the application of the aforementioned norfloxacin nucleic acid aptamer in the preparation of reagents, kits, or enzyme-linked aptamer sensors for detecting norfloxacin.

[0011] Thirdly, the present invention provides an enzyme-linked aptamer sensor, the construction principle of which is as follows: the aptamer Apt-NOR-2-TF specifically recognizes NOR, affecting the distribution state of chitosan trisaccharide (COS3) in the AuNPs / His / COS3 composite nanozyme system, thereby changing the catalytic activity of the composite nanozyme and generating a color response, thus enabling the recognition and detection of NOR with high sensitivity.

[0012] Specifically, in the absence of norfloxacin, the aptamer Apt-NOR-2-TF exists primarily in a relatively loose secondary structure, exhibiting weak binding affinity for COS3. In this case, COS3 is more readily adsorbed onto the surface of histidine-modified gold nanoparticles (AuNPs / His), forming an AuNPs / His / COS3 composite nanozyme system with a pronounced colorimetric reaction. In the presence of norfloxacin, the aptamer specifically binds to the target and folds to form a stable three-dimensional structure, thereby enhancing its binding affinity for COS3. COS3 gradually transfers from the AuNPs surface and binds into the aptamer structure, leading to a decrease in the number of AuNPs / His / COS3 composite nanozymes, a decline in the system's catalytic activity, a reduction in the TMB oxidation rate, and a weakening of the colorimetric reaction.

[0013] The enzyme-linked aptamer sensor comprises the following components: the nucleic acid aptamer, the composite nanozyme, chitosan (COS3), and TMB chromogenic solution; wherein the composite nanozyme is histidine (His) modified gold nanoparticles (AuNPs).

[0014] Furthermore, the enzyme-linked aptamer sensor comprises the following components in the following amounts: 5-15 μL of the nucleic acid aptamer solution at a concentration of 0.1-1.0 μM, 40-80 μL of the composite nanozyme solution, 5-15 μL of the chitosan solution at a concentration of 1-5 μg / mL, and 20-40 μL of TMB chromogenic solution.

[0015] The composite nanozyme is prepared by the following method: a prepared AuNPs solution is mixed with a histidine solution, wherein the concentration of the AuNPs solution is 0.5~1.0 nM and the amount is 20~40 μL, and the concentration of the histidine solution is 2~6 mM and the amount is 20~40 μL. The mixture is stirred and incubated to allow histidine to modify the surface of AuNPs through electrostatic adsorption or coordination, thereby obtaining the composite nanozyme.

[0016] Furthermore, the AuNPs solution is prepared by sodium citrate reduction; the specific preparation method includes: adding tetrachloroauric acid solution to ultrapure water, heating to boiling, then adding trisodium citrate solution, and continuing to heat until the solution turns into a stable wine-red color, which is the AuNPs solution, for later use.

[0017] Furthermore, the TMB colorimetric solution comprises a TMB solution and a hydrogen peroxide solution.

[0018] Fourthly, the present invention provides the application of the enzyme-linked aptamer sensor in the detection of norfloxacin.

[0019] Fifthly, the present invention provides a method for detecting norfloxacin, comprising the following steps: (1) Take norfloxacin standard solution, add the nucleic acid aptamer, and incubate; then add chitosan and incubate; then add composite nanozyme and incubate; finally add TMB colorimetric solution, use a smartphone to collect color intensity (RGB) values, calculate color intensity change values, and plot the standard curve of norfloxacin. (2) Take the sample to be tested, and test and calculate the color intensity change value according to the same method as in step (1); (3) Substitute the color intensity change value of the sample to be tested into the standard curve to calculate the concentration of norfloxacin in the sample to be tested.

[0020] Further, the incubation conditions in step (1) are as follows: after adding the nucleic acid aptamer, react at room temperature for 20-40 min; after adding chitosan, incubate for 5-15 min; and after adding the composite nanozyme, incubate for 3-10 min. Furthermore, the formula for calculating the color intensity change value in step (1) is as follows: The RGB values ​​of the blank control group were denoted as R0, G0, and B0, respectively, and the RGB values ​​of the test samples were denoted as R. i G i B i .

[0021] Compared with the related technologies known to the inventors, one of the technical solutions of the present invention has the following beneficial effects: (1) Significantly improved recognition element performance: This invention obtains a nucleic acid aptamer Apt-NOR-2-TF with high affinity for norfloxacin through a "shortening-locking" synergistic optimization strategy. K d =23.98 nM), representing an approximately 11.9-fold increase in affinity compared to the original aptamer. This optimization strategy embodies a targeted structural design approach to meet the molecular recognition requirements of norfloxacin.

[0022] (2) Advanced signal transduction principle: The sensor of the present invention does not rely on the assembly and disassembly of DNA nanostructures, but achieves signal output by regulating the effect of target recognition events on the catalytic activity of the composite nanozyme interface, and has low background signal and high signal amplification efficiency.

[0023] (3) High specificity: The sensor of the present invention has excellent specific recognition ability for norfloxacin, and has no obvious response to structural analogs such as enrofloxacin, ciprofloxacin, ofloxacin and other antibiotics such as chloramphenicol.

[0024] (4) Simple operation and strong applicability: The sensor constructed in this invention has simple operation steps, requires no complicated separation and washing processes, and provides intuitive colorimetric results. It can be combined with a smart terminal for quantitative analysis and has good potential for rapid on-site detection. Actual sample spike recovery experiments and actual sample detection results show that the smart sensor has high accuracy and good repeatability, and can meet the detection requirements of norfloxacin in complex matrices. It has broad application prospects in actual food safety monitoring, and this invention opens up a new avenue for the detection of norfloxacin. Attached Figure Description

[0025] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0026] Figure 1 : Schematic diagram of the secondary structure of the aptamer Apt-NOR.

[0027] Figure 2 Schematic diagram of affinity test results between aptamer Apt-NOR and NOR.

[0028] Figure 3 : Schematic diagram of the secondary structure of adapters Apt-NOR-1, Apt-NOR-2, Apt-NOR-3, Apt-NOR-4, Apt-NOR-1-TF, Apt-NOR-2-TF, Apt-NOR-3-TF and Apt-NOR-4-TF; the red box indicates the compact recognition core area formed after "shortening" optimization, and the blue box indicates the end-stabilizing structure introduced by "locking end" optimization.

[0029] Figure 4 Schematic diagram of affinity test results between aptamers Apt-NOR-1, Apt-NOR-2, Apt-NOR-3, and Apt-NOR-4 and norfloxacin, where A represents the test result of aptamer Apt-NOR-1; B represents the test result of aptamer Apt-NOR-2; C represents the test result of aptamer Apt-NOR-3; and D represents the test result of aptamer Apt-NOR-4.

[0030] Figure 5Schematic diagram of affinity test results between aptamers Apt-NOR-1-TF, Apt-NOR-2-TF, Apt-NOR-3-TF, and Apt-NOR-4-TF and norfloxacin, where A represents the test result of aptamer Apt-NOR-1-TF; B represents the test result of aptamer Apt-NOR-2-TF; C represents the test result of aptamer Apt-NOR-3-TF; and D represents the test result of aptamer Apt-NOR-4-TF.

[0031] Figure 6 Schematic diagram of affinity test results for aptamer Apt-NOR-2-TF with ofloxacin (OFL), ciprofloxacin (CIP), enrofloxacin (ENR), and chloramphenicol (CHL), where A represents the result of ofloxacin assay; B represents the result of ciprofloxacin assay; C represents the result of enrofloxacin assay; and D represents the result of chloramphenicol assay.

[0032] Figure 7 Schematic diagram of the secondary structure of the aptamer Apt-NOR-2-TF.

[0033] Figure 8 Signal response curve of NOR Figure 9 : The standard curve of NOR.

[0034] Figure 10 : A schematic diagram of the color intensity changes of four antibacterial drugs, where MIX represents a mixture of the four antibacterial drugs. Detailed Implementation

[0035] The present invention will be further described below with reference to embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present invention without departing from the spirit and scope thereof.

[0036] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.

[0037] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0038] Method for determining aptamer affinity and specificity: This invention employs a biomembrane interferometer (BII) to determine the specific affinity of nucleic acid aptamers for norfloxacin (NOR) using high-throughput measurement. The BII is a real-time analytical tool for detecting interactions between biomolecules. The detection method involves modifying one end of the nucleic acid aptamer with biotin. The aptamer is then immobilized on the sensor surface by the binding of biotin to streptavidin. The instrument parameters are set as follows: sensor equilibration 60 s, nucleic acid aptamer immobilization 300 s, equilibration 150 s, target binding and dissociation both 180 s, temperature 25℃, and frequency 2 Hz. The affinity dissociation constant can be obtained by fitting the obtained curve. K d value).

[0039] Example 1: Optimization of the original aptamer for norfloxacin The nucleotide sequence of the proaptamer of norfloxacin—aptamer Apt-NOR—is shown in SEQ ID NO.1, as shown below (direction 5'-3'): CCCATCAGGGGGCTAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTAT.

[0040] The secondary structure of the aptamer Apt-NOR was predicted using the online tool "the mfold web server". A schematic diagram of the secondary structure of the aptamer Apt-NOR is shown below. Figure 1 As shown.

[0041] The binding of aptamers to NOR was simulated using the molecular docking simulation software Autodock. Based on the clustering results and the principle of minimum energy, the key sites for the interaction between aptamer Apt-NOR and NOR were predicted to be G11, G12, C13, C36, T37, and G38.

[0042] The affinity between aptamer Apt-NOR and norfloxacin was detected using a biomembrane interference molecular interaction analyzer. A schematic diagram of the affinity detection results between aptamer Apt-NOR and NOR is shown below. Figure 2 As shown, the results indicate that the aptamer Apt-NOR and NOR... K d The value is 283.9 nM. From a kinetic perspective, the aptamer Apt-NOR... K on It is 7.33×10 4 M -1 ·s -1 , K off 2.08×10 -2 s -1Although the aptamer has a certain binding capacity, its dissociation rate is relatively high, indicating that there is still room for improvement in the stability of the aptamer-target complex. Therefore, further structural optimization strategies are needed to improve the binding performance of the aptamer.

[0043] Based on this, the present invention proposes a “shortening-end locking” collaborative optimization strategy: First, by shortening the distance between the key stem-loop of the aptamer, the initial sequence is structurally modified to obtain four shortened aptamers: Apt-NOR-1, Apt-NOR-2, Apt-NOR-3, and Apt-NOR-4; then, in order to further stabilize the aptamer conformation and enhance its recognition ability, an end locking strategy is introduced into the candidate sequence based on the shortening optimization, resulting in four improved aptamers: Apt-NOR-1-TF, Apt-NOR-2-TF, Apt-NOR-3-TF, and Apt-NOR-4-TF. The secondary structure diagrams of aptamers Apt-NOR-1, Apt-NOR-2, Apt-NOR-3, Apt-NOR-4, Apt-NOR-1-TF, Apt-NOR-2-TF, Apt-NOR-3-TF, and Apt-NOR-4-TF are shown below. Figure 3 As shown.

[0044] The nucleotide sequence of aptamer Apt-NOR-1 is shown in SEQ ID NO.2, as follows (direction 5'-3'): CCCATCAGGGGGCAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTAT.

[0045] The nucleotide sequence of aptamer Apt-NOR-2 is shown in SEQ ID NO.3, as shown below (direction 5'-3'): CCCATCAGGGGGCGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTAT.

[0046] The nucleotide sequence of aptamer Apt-NOR-3 is shown in SEQ ID NO.4, as shown below (direction 5'-3'): CCCATCAGGGGGCGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTAT.

[0047] The nucleotide sequence of aptamer Apt-NOR-4 is shown in SEQ ID NO.5, as shown below (direction 5'-3'): CCCATCAGGGGGCCTAACACGGTTCGGCTCTCTGAGCCCGGGTTAT.

[0048] The nucleotide sequence of the aptamer Apt-NOR-1-TF is shown in SEQ ID NO.6, as shown below (direction 5'-3'): GGGGGGTTCCCATCAGGGGGCAGGCTAACACGGTTCGGCTTCTCTGAGCCCGGGTTATCCCCCCC.

[0049] The nucleotide sequence of the aptamer Apt-NOR-2-TF is shown in SEQ ID NO.7, as shown below (direction 5'-3'): GGGGGGTTCCCATCAGGGGGCGGCTAACACGGTTCGGCTTCTCTGAGCCCGGGTTATCCCCCCC.

[0050] The nucleotide sequence of the aptamer Apt-NOR-3-TF is shown in SEQ ID NO.8, as shown below (direction 5'-3'): GGGGGGTTCCCATCAGGGGGCGCTAACACGGTTCGGCTTCTCTGAGCCCGGGTTATCCCCCCC.

[0051] The nucleotide sequence of the aptamer Apt-NOR-4-TF is shown in SEQ ID NO.9, as shown below (direction 5'-3'): GGGGGGTTCCCATCAGGGGGGCCTAACACGGTTCGGCTTCTCTGAGCCCGGGTTATCCCCCCC.

[0052] The affinities of four contracted aptamers, Apt-NOR-1, Apt-NOR-2, Apt-NOR-3, and Apt-NOR-4, with NOR were determined using a biomembrane interference molecular interaction analyzer. The results are as follows: Figure 4 As shown. The results indicate that aptamers Apt-NOR-1, Apt-NOR-2, Apt-NOR-3, and Apt-NOR-4 are effective against NOR. K d The values ​​were 48.58 nM, 40.68 nM, 58.27 nM, and 124.5 nM, respectively. Apt-NOR-1 and Apt-NOR-2 showed the most significant optimization effects, improving by approximately 5.8 times and 7.0 times, respectively, compared to the initial aptamer Apt-NOR. This result indicates that moderately shortening the spatial distance between the key stem-loop helps optimize the conformation of the aptamer's recognition pocket, making it easier for the target to enter the binding region and form a stable complex. From a kinetic perspective, Apt-NOR-1 and Apt-NOR-2...K on They are 7.55×10 4 M -1 ·s -1 and 5.48×10 4 M -1 ·s -1 , with the initial aptamer Apt-NOR (7.33 × 10 4 M -1 ·s -1 The fact that the values ​​are on the same order of magnitude indicates that shortening the critical stem-loop distance did not significantly affect the initial binding process between the aptamer and the target. However, its K off Reduced to 3.67×10 -3 s -1 and 2.23×10 -3 s -1 The affinity was significantly lower than that of the initial aptamer, indicating a significant enhancement in complex stability, which led to a substantial increase in overall affinity. To further stabilize the aptamer conformation and enhance its recognition ability, an end-locking strategy was introduced into the candidate sequences based on the shortening optimization, resulting in four improved aptamers: Apt-NOR-1-TF, Apt-NOR-2-TF, Apt-NOR-3-TF, and Apt-NOR-4-TF. The affinity of the four locked-end sequence aptamers (Apt-NOR-1-TF, Apt-NOR-2-TF, Apt-NOR-3-TF, and Apt-NOR-4-TF) for NOR was determined using a biomembrane interferometer, and the results are as follows: Figure 5 As shown. The aptamers Apt-NOR-1-TF, Apt-NOR-2-TF, Apt-NOR-3-TF, and Apt-NOR-4-TF were fitted and calculated to support NOR. K d The affinity values ​​were 28.65 nM, 23.98 nM, 35.82 nM, and 49.50 nM, respectively, all superior to the corresponding unlocked sequences. Among them, the aptamer Apt-NOR-2-TF showed the most significant affinity enhancement. K d The secondary structure of the aptamer Apt-NOR-2-TF is shown in the diagram, representing an improvement of approximately 11.9 times over the original sequence. Figure 7 As shown in the figure. This result indicates that the end-locking structure can effectively stabilize the secondary structure of the aptamer, reduce ineffective folding, and make the recognition conformation more conducive to target binding.

[0053] Further analysis of kinetic parameters revealed that the effect of lock-end modification on aptamer binding kinetics is mainly reflected in the enhanced stability of the complex. For example, the aptamer Apt-NOR-2-TF... Koff Reduced to 9.77×10 -4 s -1 The value was the lowest among all candidate sequences, indicating that the complex formed with norfloxacin had the highest stability.

[0054] In addition, BLI was used to determine the interfering antibiotics of the aptamer Apt-NOR-2-TF, which have similar structures to NOR or may coexist in aquatic products: ofloxacin (OFL), ciprofloxacin (CIP), enrofloxacin (ENR), and chloramphenicol (CHL). The results are as follows: Figure 6 As shown in the figure, the binding signal of the aptamer Apt-NOR-2-TF to ofloxacin showed no linear gradient; the binding response values ​​with ciprofloxacin and enrofloxacin at the highest concentration were still below 0.01 nm, and were therefore deemed invalid; no obvious binding signal was observed with chloramphenicol, indicating that the aptamer Apt-NOR-2-TF has good specific recognition ability for norfloxacin.

[0055] Example 2 Construction of an enzyme-linked aptamer sensor The enzyme-linked aptamer sensor consists of the following components (the amounts of each component described below are the minimum required for a single sample detection): 10 μL of 0.5 μM Apt-NOR-2-TF aptamer solution; 60 μL of composite nanozyme (AuNPs / His) solution; 10 μL of 3.33 μg / mL chitosan solution; and 30 μL of TMB chromogenic solution (composed of 15 μL of TMB solution, 10 μL of H2O2 solution, and the remainder being acetate buffer). All solutions are used in ultrapure water as the solvent.

[0056] The preparation method of the composite nanozyme (AuNPs / His) solution is as follows: AuNPs solution was prepared by sodium citrate reduction: 1 mL of 1% tetrachloroauric acid solution was added to 95 mL of ultrapure water and heated to boiling. Then, 4 mL of 1% trisodium citrate solution was quickly added, and heating continued until the solution turned a stable wine-red color, which is the AuNPs solution. 30 μL of the prepared 0.75 nM AuNPs solution was mixed with 30 μL of 4 mM histidine solution and incubated at room temperature with stirring for 10–30 minutes. This allowed histidine to modify the AuNPs surface through electrostatic adsorption or coordination, yielding the AuNPs / His composite nanozyme.

[0057] The chitosan trisaccharide was purchased from Qingdao Bozhi Huili Biotechnology Co., Ltd. (chitosan oligosaccharide DP3).

[0058] The TMB colorimetric solution was purchased from Beijing Solarbio Technology Co., Ltd. as a 1% TMB solution, product number: T8120.

[0059] The H2O2 solution was 30% H2O2 purchased from Sinopharm Chemical Reagent Co., Ltd., product number: 10011208.

[0060] The acetate buffer solution has a concentration of 1 M and a pH of 4.0.

[0061] Example 3: Detection of norfloxacin using a smart enzyme-linked aptamer sensor The following steps were taken to detect NOR using the intelligent enzyme-linked aptamer sensor constructed in Example 2: (1) Take 10 μL of NOR standard solution, add 10 μL of aptamer Apt-NOR-2-TF solution, and react at room temperature for 30 min; add 10 μL of 3.33 μg / mL COS3 solution, mix well and continue incubation for 10 min; then add 60 μL of composite nanozyme (AuNPs / His) solution, mix well and incubate for 5 min, then add 30 μL of TMB colorimetric solution, mix thoroughly and react at room temperature in the dark; to evaluate the quantitative detection performance of the constructed intelligent enzyme-linked aptamer sensing system, NOR standard solutions of different concentration gradients were detected, color intensity (RGB) values ​​were collected using a smartphone, and color intensity change values ​​were calculated. The RGB values ​​of the blank control group were denoted as R0, G0, and B0, respectively, and the RGB values ​​of the test samples were denoted as R. i G i B i A standard curve was plotted to show the change in color intensity as a function of NOR concentration. The concentration gradients of the NOR standard solutions were 0 nM, 3 nM, 15 nM, 75 nM, 375 nM, 750 nM, 1500 nM, and 3000 nM.

[0062] The NOR standard solution is prepared by the following method: take norfloxacin standard, dissolve it in an appropriate amount of 1M NaOH solution, add buffer solution, and prepare to the required concentration.

[0063] The buffer solution consists of the following components: 8 mM disodium hydrogen phosphate (Na2HPO4), 137 mM sodium chloride (NaCl), 2 mM potassium dihydrogen phosphate (KH2PO4), 2.7 mM potassium chloride (KCl), with the balance being water, pH 7.4.

[0064] (2) Establishment of the standard curve Color intensity (RGB) values ​​of NOR standard solutions at different concentration gradients were collected, and the color intensity changes were calculated to obtain the signal response curve of NOR, as shown below. Figure 8As shown in the figure, with the increase of NOR concentration, the color of the system gradually becomes lighter, and the corresponding change in color intensity gradually increases. A standard curve for NOR is plotted with the logarithmic value of NOR concentration on the x-axis and the change in color intensity on the y-axis. The standard curve for NOR is shown below. Figure 9 As shown, the linear range of the intelligent enzyme-linked aptamer sensor is calculated to be 3~3000 nM, and the detection limit is 1.78 nM.

[0065] (3) Selectivity evaluation of intelligent enzyme-linked aptamer sensor Antibiotics with structures similar to NOR or that may coexist in aquatic products were selected as interfering agents for comparative experiments, including chloramphenicol (CHL), ofloxacin (OFL), enrofloxacin (ENR), and ciprofloxacin (CIP).

[0066] Chloramphenicol, ofloxacin, enrofloxacin, and ciprofloxacin were each prepared into a solution with a concentration of 750 nM.

[0067] Prepare a mixture solution containing the above four antibacterial drugs, wherein the concentrations of chloramphenicol, ofloxacin, enrofloxacin, and ciprofloxacin are all 750 nM.

[0068] When preparing the solution, first prepare a 10 mM stock solution in a 1 M NaOH solution; then dilute it to 750 nM using the buffer solution from step (1) above.

[0069] Following the detection method in step (1), take 10 μL of the test solution, add 10 μL of the aptamer Apt-NOR-2-TF solution, and react at room temperature for 30 min; add 10 μL of 3.33 μg / mL COS3 solution, mix well, and continue incubation for 10 min; then add 60 μL of AuNPs / His solution, mix well, and incubate for 5 min; then add 30 μL of TMB colorimetric solution, mix thoroughly, and react at room temperature in the dark. Use a smartphone to collect color intensity (RGB) values ​​and calculate the color intensity change value. The schematic diagram of the color intensity change values ​​of the four antibacterial drugs is shown below. Figure 10 As shown in the figure, there is a clear signal only when NOR is present, indicating that the enzyme-linked aptamer sensor of the present invention has good selectivity.

[0070] Example 4: Evaluation of recovery rate of intelligent enzyme-linked aptamer sensor and detection of NOR in aquatic products (1) To evaluate the detection accuracy of the constructed sensor, a spiked recovery experiment was conducted on actual aquatic product samples. Different concentrations of NOR were added to sample solutions of Litopenaeus vannamei, large yellow croaker, and blackhead fish, respectively, and analyzed using the enzyme-linked aptamer sensor constructed in Example 2 (method as in Example 3). The recovery rate and relative standard deviation (RSD) were calculated. The recovery rate evaluation results are shown in Table 1. The recovery rate ranged from 89.54% to 111.27%, and the relative standard deviation (RSD) ranged from 2.05% to 6.95%. The results indicate that the sensor has good detection accuracy and repeatability, and can meet the requirements for NOR detection in actual samples.

[0071] Table 1 Recovery Rate Evaluation Information

[0072] (2) Inspect the whiteleg shrimp, large yellow croaker and blackhead fish purchased from the market. Sample preparation: 4 g of muscle tissue was taken from each sample (Litopenaeus vannamei, large yellow croaker and blackhead fish) and mixed with 20 mL of acetonitrile solution containing 25 mM phosphate. The mixture was homogenized for 5 minutes and centrifuged at 4500 rpm for 20 minutes. The supernatant was collected and centrifuged again at 4500 rpm for 20 minutes. The supernatant was filtered through a 0.22 μm filter membrane to obtain sample 1, sample 4 and sample 6.

[0073] Add NOR stock solution to sample 1 to make the final NOR concentration 50 nM, thus obtaining sample 2.

[0074] Add NOR stock solution to sample 1 to make the final NOR concentration 500 nM, thus obtaining sample 3.

[0075] Add NOR stock solution to sample 4 to make the final NOR concentration 300 nM, thus obtaining sample 5.

[0076] Add NOR stock solution to sample 6 to make the final NOR concentration 200 nM, thus obtaining sample 7.

[0077] The intelligent ELISA sensor constructed in Example 2 was used to analyze samples 1-7 (using the same method as in Example 3) to calculate the NOR concentration. Simultaneously, HPLC was used to verify samples 1-7. The verification results of the intelligent ELISA sensor and HPLC are shown in Table 2. As can be seen from Table 2, samples 1, 4, and 6 were all negative, while spiked samples 2, 3, 5, and 7 were all positive. Furthermore, the quantitative analysis results showed high accuracy with minimal deviation, and the analytical results were consistent with the HPLC verification results.

[0078] Table 2. Test results of the intelligent enzyme-linked aptamer sensor and HPLC (n=3)

[0079] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A nucleic acid aptamer for norfloxacin, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

7.

2. The use of the norfloxacin nucleic acid aptamer according to claim 1 in the preparation of reagents, kits or enzyme-linked aptamer sensors for detecting norfloxacin.

3. An enzyme-linked aptamer sensor, characterized in that it comprises the following components: the nucleic acid aptamer as described in claim 1, a composite nanozyme, chitosan, and TMB chromogenic solution; wherein, The composite nanozyme is a histidine (His) modified gold nanoparticle (AuNPs).

4. The enzyme-linked aptamer sensor as described in claim 3, characterized in that, The enzyme-linked aptamer sensor comprises the following components in the following amounts: 5-15 μL of the nucleic acid aptamer solution of claim 1 at a concentration of 0.1-1.0 μM, 40-80 μL of the composite nanozyme solution, 5-15 μL of the chitosan solution at a concentration of 1-5 μg / mL, and 20-40 μL of TMB chromogenic solution.

5. The enzyme-linked aptamer sensor as described in claim 4, characterized in that, The composite nanozyme solution was prepared by the following method: the prepared AuNPs solution was mixed with histidine solution and stirred and incubated. The concentration of the AuNPs solution was 0.5~1.0 nM and the amount was 20~40 μL. The concentration of the histidine solution was 2~6 mM and the amount was 20~40 μL. Histidine was modified onto the surface of AuNPs through electrostatic adsorption or coordination to obtain the composite nanozyme. The TMB colorimetric solution comprises a TMB solution and a hydrogen peroxide solution.

6. The use of the enzyme-linked aptamer sensor according to any one of claims 3-5 in the detection of norfloxacin.

7. A method for detecting norfloxacin, characterized in that, Includes the following steps: (1) Take norfloxacin standard solution, add the nucleic acid aptamer described in claim 1, and incubate; then add chitosan trisaccharide and incubate; then add composite nanozyme and incubate; finally add TMB colorimetric solution, use a smartphone to collect color intensity (RGB) values, calculate color intensity change values, and plot the standard curve of norfloxacin. (2) Take the sample to be tested, test it in the same way as in step (1), and use a smartphone to collect the color intensity (RGB) value and calculate the color intensity change value; (3) Substitute the color intensity change value of the sample to be tested into the standard curve to calculate the concentration of norfloxacin in the sample to be tested.

8. The method of claim 7, characterized in that, The incubation conditions described in step (1) are as follows: after adding the nucleic acid aptamer, react at room temperature for 20-40 min; after adding chitosan, incubate for 5-15 min; and after adding the composite nanozyme, incubate for 3-10 min.

9. The method of claim 7, characterized in that, The formula for calculating the color intensity change value mentioned in step (1) is as follows: The RGB values ​​of the blank control group were denoted as R0, G0, and B0, respectively, and the RGB values ​​of the test samples were denoted as R. i G i B i .