Application of osfbx148 gene in regulating cold tolerance of plants

Abstract

This invention belongs to the field of biotechnology and relates to a... OsFBX148 Application of genes in regulating plant cold tolerance. This invention reveals a gene in rice called... OsFBX148 Novel functions of the gene and its encoded protein were discovered. Tissue-specific expression analysis showed that the gene was highly expressed in rice roots, and its expression level was significantly upregulated by low-temperature stress. Targeted mutation was performed using gene editing technologies (such as CRISPR / Cas9). OsFBX148 The gene can significantly enhance the cold resistance of rice plants, indicating that the gene plays an important role in regulating the cold resistance of rice. This invention provides an important gene resource for the genetic improvement of cold resistance in rice, and has important application value for breeding crop varieties with enhanced cold resistance and ensuring food security in high-altitude and cold regions.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically involving OsFBX148 Its application in regulating plant cold tolerance specifically involves knockout. OsFBX148 Application of genes in improving the cold resistance of rice. Background Technology

[0002] Low temperature is one of the important abiotic stress factors affecting crop growth, development, yield, and quality. Rice ( Oryza sativa Rice (L.), a warm-loving crop native to tropical and subtropical regions, is particularly sensitive to low-temperature stress. Low-temperature stress leads to slow seedling growth, yellowing, and even death; it also causes pollen abortion and reduced seed setting rate in rice with a long reproductive growth period, resulting in severe yield reduction. In recent years, with the increasing frequency of extreme weather events caused by global climate change and the expansion of rice cultivation areas to higher altitudes and latitudes, low-temperature damage has become one of the key limiting factors restricting stable and high rice yields. Therefore, elucidating the molecular mechanisms of rice's response to low-temperature stress, discovering key cold-resistant gene resources, and creating new rice germplasm with enhanced cold resistance using modern biotechnology are of significant theoretical and applied value for ensuring food security.

[0003] Plants have developed complex signaling networks to sense and respond to low-temperature stress over long-term evolution. Among these, the ubiquitin-proteasome system (UPS)-mediated post-translational modification and degradation of proteins play a crucial role in regulating the stability and activity of stress-responsive proteins. The SCF (SKP1-Cullin-F-box) complex, the largest E3 ubiquitin ligase in the UPS, participates in regulating cell cycle, hormone signal transduction, and various abiotic stress responses by specifically recognizing target proteins through its F-box protein subunits. The F-box protein family is highly expanded in plants; for example, over 700 members have been identified in the rice genome. The functional identification of these genes in relation to low-temperature stress is still ongoing. Existing research indicates that some F-box proteins participate in plant responses to low-temperature stress. Discovering and identifying new F-box genes involved in regulating cold tolerance in rice is urgently needed and has broad application prospects for enriching the theory of plant cold tolerance and breeding cold-tolerant crop varieties. Summary of the Invention

[0004] The purpose of this invention is to provide OsFBX148 Application of genes in regulating cold tolerance in rice.

[0005] To achieve the above objectives, the technical solution adopted by this invention is summarized as follows: Based on the rice whole genome sequence published on the Rice Genome Annotation Project website (https: / / rice.uga.edu / ), rice... OsFBX148 Nucleotide sequence information of the gene (sequence number: LOC_Os04g48270). OsFBX148 The gene coding region has a nucleotide length of 915 bp, and the nucleotide sequence is shown in SEQ ID NO.1. It consists of 304 amino acids, and the amino acid sequence is shown in SEQ ID NO.2. The sequence can be obtained from the official website of Rice Genome Annotation Project.

[0006] The gene functions protected by this invention include not only those described above. OsFBX148 Genes, including those related to OsFBX148 The function of homologous genes with high homology (such as above 80%; more preferably above 90%; more preferably above 95%; more preferably above 98%) in low temperature tolerance.

[0007] This invention will purchase gene-edited osfbx148 The mutant plant was subjected to gene sequencing, which confirmed that it was... OsFBX148 Plants with gene mutations were self-crossed for multiple generations to obtain homozygous seeds. The biological functions under low-temperature stress were analyzed. A low-temperature stress experiment was simulated in a temperature-controlled incubator. The results showed that under low-temperature stress… OsFBX148 Loss-of-function mutants ( osfbx148 The mutant plants showed less leaf curling and wilting, and less leaf damage compared to the wild type. After returning to normal temperature, the survival rate of the mutant plants was significantly higher than that of the wild type, indicating that… osfbx148 The mutant plants are more cold-resistant.

[0008] In addition, physiological indicators were measured before and after low-temperature stress treatment. Before treatment at 5°C, the mutant... Osfbx148 There was no significant difference in proline and malondialdehyde content between the mutant and wild-type ZH11. After treatment at 5℃, the mutant... Osfbx148 The proline content of the mutant was significantly higher than that of the wild-type ZH11, while the mutant... Osfbx148 The malondialdehyde (MDA) content in the mutant was significantly lower than that in the wild-type ZH11. Simultaneously, analysis of soluble protein and total soluble sugar content revealed that, after treatment at 5°C, both levels decreased in the mutant. Osfbx148 The content of these components was higher than that of wild-type ZH11. The measured values ​​of the above physiological indicators were all consistent with... Osfbx148 The cold resistance phenotype is consistent with that of wild-type ZH11, which strongly supports the phenotypic result that its cold resistance is stronger than that of wild-type ZH11.

[0009] Furthermore, the aforementioned OsFBX148 After gene mutation, under low temperature stress, compared to the wild type, osfbx148 mutant plants OsDREB1A , OsCBF2 , OsCBF3 and OsP5CS2 Gene expression levels were significantly upregulated.

[0010] In practical applications, cold-resistant plants can be obtained through gene editing or mRNA interference. OsFBX148 Genes are knocked out or their expression levels are reduced in plant cells, tissues, or organs. The transformed plant material is then cultured into complete plants, and plant materials with improved cold tolerance are selected. Specifically, this can be achieved by reducing... OsFBX148 Gene expression in the target plant yields a transgenic plant, which is more cold-resistant than the target plant.

[0011] More specifically, it can be based on OsFBX148 Primers were designed based on the Genomic DNA sequence of the gene, and a gene-editing vector was constructed. This vector was then introduced into rice callus tissue via Agrobacterium-mediated genetic transformation, ultimately yielding... OsFBX148 Homozygous gene knockout strains.

[0012] This invention also discloses a method for cultivating transgenic rice with enhanced cold resistance, by reducing the amount of cold in rice. OsFBX148 Gene expression and / or the activity of the proteins they encode can enhance the cold tolerance of rice.

[0013] In addition, a plant breeding method is disclosed, wherein the method is as follows (1) or (2): (1) By reducing the activity of OsFBX148 protein in the target plant, plants with stronger cold resistance than the target plant were obtained. (2) By reducing the content of the target plant OsFBX148 Gene expression was used to obtain plants that were more cold-resistant than the target plant. Preferably, the target plant is rice.

[0014] In addition, the present invention also discloses a method for screening plants with enhanced cold tolerance, the method comprising detecting in the plant OsFBX148 The level of the gene or its expression product, selected compared to the wild type. OsFBX148 Plants with reduced gene expression levels or loss of activity of their encoded proteins are considered candidates for enhanced cold tolerance.

[0015] The term "plant" as used in this invention includes the whole rice plant, its parent and offspring plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots, flowers, and other tissues and organs. OsFBX148 Both genes and nucleic acids were edited.

[0016] This invention also extends to the harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, and other tissues and organs. It further relates to other derivatives of the plant after harvest, such as dried granules or powders, oils, fats and fatty acids, starches, or proteins. This invention also relates to foods or food additives obtained from the relevant plants.

[0017] Advantages of this invention: This invention has identified a rice species using molecular biology techniques. OsFBX148 Genes, experiments have shown that low-temperature treatment significantly induced OsFBX148 Gene expression was analyzed, and then, compared with the wild type, the mutant material treated with low temperature showed significantly enhanced tolerance to low temperature stress. Through experiments simulating low temperature stress in an incubator, the effects of knockout were revealed. OsFBX148 Gene( osfbx148 Mutants can improve the cold resistance of plants and provide genetic resources for molecular breeding of rice with low-temperature tolerance. Attached Figure Description

[0018] Figure 1 for OsFBX148 The specific expression of genes in different tissues.

[0019] Figure 2 Under low temperature stress OsFBX148 Gene expression status.

[0020] Figure 3 for osfbx148 In mutants OsFBX148 Gene editing status. A represents normal. OsFBX148 Genomic DNA map of genes; B is osfbx148 In mutants OsFBX148 The status of gene editing.

[0021] Figure 4 For ZH11 and under low temperature stress osfbx148 Phenotypes of mutants. A shows the phenotypic observation; B shows the survival rate comparison after recovery.

[0022] Figure 5 For low-temperature treatment of wild-type rice ZH11 and Osfbx148 Statistical results of proline content, malondialdehyde content, soluble protein content, and total soluble sugar content in the mutant. In the figure, A represents the statistical results of proline content; B represents the statistical results of malondialdehyde content; C represents the statistical results of soluble protein; and D represents the statistical results of total soluble sugar content.

[0023] Figure 6 For wild-type rice ZH11 and Osfbx148Expression of cryostatin marker genes in mutants. A represents... OsDREB1A The relative expression of genes, B being... OsCBF2 The relative expression of genes, where C represents... OsCBF3 The relative expression of genes, where D represents... OsP5CS2 The relative expression of genes. Detailed Implementation

[0024] The principles and features of the present invention will now be described in detail with reference to the accompanying drawings. These embodiments will provide a more thorough explanation of the invention and fully convey its scope to those skilled in the art.

[0025] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used are commercially available.

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0027] Unless otherwise stated, the present invention will be practiced using conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques are fully explained in the published literature, and except for the methods used in the embodiments described below, all methods disclosed in the prior art can be employed.

[0028] The wild-type rice materials used in this experiment were all japonica rice varieties ZH11 (Zhonghua 11).

[0029] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.

[0030] In addition, to provide a more intuitive understanding of the technical solution of this invention, some technical terms involved in this invention are explained as follows: A "mutant" is an individual that has undergone a mutation and has phenotypic characteristics that differ from the wild type.

[0031] Example 1 OsFBX148 Gene expression analysis 1.1 OsFBX148 Tissue-specific expression analysis of genes To investigate OsFBX148 To investigate gene expression characteristics in different rice tissues, this study used rice roots, stems, leaves, leaf sheaths, and panicles as materials. Total RNA was extracted from each tissue and reverse transcribed into cDNA. OsFBX148 Gene-specific primers were used as tools, and real-time quantitative PCR (qRT-PCR) technology was employed to detect its expression level. This study used rice endogenous... UBQ5 The gene was used as an internal reference, and the relative expression level of the gene in each tissue was calculated by comparing Ct values.

[0032] qRT-PCR analysis showed that, OsFBX148 The gene exhibits significantly dominant expression in rice roots, with transcription levels far exceeding those in stems, leaves, leaf sheaths, and panicles, suggesting that this gene primarily exerts its biological function in rice roots. Figure 1 ). Combination OsFBX148 The mutant's enhanced cold tolerance suggests that this gene may act as a negative regulator of cold stress response, specifically mediating the balance of low-temperature response in the root region. Under normal growth conditions, OsFBX148The gene is highly expressed in roots and may maintain normal root growth and metabolism by inhibiting excessive activation of root cold signaling pathways. When this gene mutates and loses its function, this inhibition is relieved, allowing the roots to quickly initiate a protective response under low-temperature stress, enhancing root vigor and indirectly improving the cold resistance of the above-ground parts through hormone signaling, water and nutrient transport, thus conferring an overall enhanced cold tolerance phenotype on the plant. This result reveals... OsFBX148 The key negative regulatory role of genes in the adaptive regulation of root cold stress provides new evidence for elucidating the molecular mechanism of cold tolerance in rice.

[0033] 1.2 Under low temperature stress OsFBX148 Gene expression status The cells were cultured for 10 days under 12 h light / 12 h darkness conditions at 30 °C and 50% relative humidity, followed by a 5 °C cryogenic treatment. Leaf samples were collected at 0 h, 3 h, 6 h, and 12 h, with three biological replicates at each time point. The collected leaf tissues were rapidly cryopreserved in liquid nitrogen for subsequent RNA extraction. cDNA was obtained through reverse transcription and analyzed by real-time quantitative PCR (qPCR). The results showed that cryogenic treatment significantly induced... OsFBX148 Gene expression ( Figure 2 ).according to OsFBX148 Design specific real-time quantitative PCR primers (qRT) for gene cDNA sequence. OsFBX148 -F and qRT OsFBX148 -R, the internal reference gene is selected from rice. UBQ5 Gene (primer use) UBQ5 -F and UBQ5 -R). Detected via qPCR. OsFBX148 The expression levels of the gene in rice ZH11, and the primer sequences are as follows: qRT OsFBX148 -F:CCATGTCGGGGACTTTGTCG qRT OsFBX148 -R:AACGCATAGACCGCCTTTTG UBQ5 -F: ACCACTTCGACCGCCACTACT UBQ5 -R:ACGCCTAAGCCTGCTGGTT.

[0034] Example 2 Wild-type rice and osfbx148 Comparison of cold tolerance of mutant strains 2.1 osfbx148 Identification and Acquisition of Mutants In order to investigate OsFBX148The function of genes in rice response to low-temperature stress was determined based on the rice whole genome sequence published on the Rice Genome Annotation Project website (https: / / rice.uga.edu / ). OsFBX148 Nucleotide sequence information of the gene. Purchase gene-edited [genes] from Hangzhou Biogle Biotechnology Co., Ltd. (http: / / biogle.cn / ). osfbx148 The mutant plants were purified through multiple generations of cultivation in our laboratory, and homozygous seeds were obtained through primer identification (primers: CGTCGTCGTTGAATCGCTTC and TGATCATGGCTGCGGAGGAG). Sequencing analysis revealed that this mutant involves the insertion of a T base 188 bases downstream of the ATG gene, resulting in a frameshift mutation and premature termination of subsequent amino acid translation. Figure 3 A and B) to achieve OsFBX148 Loss of gene function.

[0035] 2.2 Low-temperature treatment method Under conditions of 16 h light / 8 h darkness, 30 °C, 50% relative humidity, and 250 μmolm light intensity. -2 s -1 After 12 days of hydroponics under the specified conditions, the plants were subjected to a 5℃ low-temperature treatment (with the same light intensity, photoperiod, and humidity as above) for 5 days, and then returned to a 30℃ incubation room for 5 days to recover. Phenotypic images were taken after recovery, and the survival rate was calculated.

[0036] 2.3 Phenotype after low-temperature treatment like Figure 4 As shown, after low-temperature treatment, the leaves of wild-type ZH11 exhibited more severe curling and wilting compared to the wild type. Figure 4 (A); while mutant Osfbx148 The leaves of this mutant showed less curling than those of ZH11, exhibiting a clear low-temperature resistance phenotype. After culturing at normal temperature for 5 days, the survival rate was calculated, and the mutant... Osfbx148 The survival rate was significantly higher than that of wild-type ZH11 ( Figure 4 (B)

[0037] Physiological parameters were measured before and after low-temperature stress treatment. Before treatment at 5°C, the mutant... Osfbx148 The proline content of the mutant was not significantly different from that of the wild-type ZH11. After treatment at 5℃, the mutant... Osfbx148 The proline content was significantly higher than that of wild-type ZH11. Figure 5 (A). Further testing for malondialdehyde revealed that after treatment at 5°C, a mutant was found. Osfbx148 The malondialdehyde content of the mutant was not significantly different from that of the wild-type ZH11. After treatment at 5℃, the mutant... Osfbx148The malondialdehyde content was significantly lower than that of wild-type ZH11 ( Figure 5 (B). Simultaneously, analysis of soluble protein and total soluble sugar content revealed that, after treatment at 5℃, both decreased in the mutant. Osfbx148 The content in all of them was higher than that in wild-type ZH11 ( Figure 5 (C and D). The measured values ​​of the above physiological indicators are all consistent with... Osfbx148 The cold resistance phenotype is consistent with that of wild-type ZH11, which strongly supports the phenotypic result that its cold resistance is stronger than that of wild-type ZH11.

[0038] 2.4 Expression of low-temperature response marker genes The expression of cryomarker genes is a core method for verifying whether plants have successfully sensed low-temperature signals and initiated a defense response. This is for research purposes. Osfbx148 This study investigated whether the enhanced cold tolerance of mutants was correlated with the expression of cold stress marker genes in vivo. Osfbx148 Cold stress marker genes in mutant and wild-type ZH11 plants ( OsDREB1A , OsCBF2 , OsCBF3 and OsP5CS2 The expression of ) in rice endogenous UBQ5 Genes were used as internal controls. The relative expression levels of each gene were calculated by comparing Ct values. qPCR was used to detect the expression levels of each gene in rice ZH11 and... Osfbx148 Expression levels in mutants ( Figure 6 The primer sequences are as follows: qRT OsDREB1A -F:ACCTGTACTACGCGAGCTTG qRT OsDREB1A -R:TAGTAGCTCCAGAGTGGGAC qRT OsCBF2 -F:TACGGCAACATGGACTTCGA qRT Os CBF2 -R:CCCATCCCGTCGTAGTAGTAG qRT Os CBF3 -F:AGCGACCTGGCGTTCG qRT Os CBF3 -R:TCGCGTAGTACAGGTCCCA qRT OsP5CS2 -F:ATGACGCCATCAGTACCAG qRT Os P5CS2 -R:ATTCCACCTCTTCCCACAC qRT UBQ5 -F: ACCACTTCGACCGCCACTACT qRT UBQ5 -R:ACGCCTAAGCCTGCTGGTT.

[0039] OsDREB1A This gene encodes a core transcription factor in rice that responds to cold stress. Its expression changes under cold stress directly determine whether rice can effectively initiate the expression of downstream cold-resistant genes. Its expression is rapidly and strongly induced by cold treatment. Detection results show that this gene... Osfbx148 Both the mutant and wild-type ZH11 were strongly induced by cold treatment, but in Osfbx148 The expression level in the mutant was significantly higher than that in the wild-type ZH11 ( Figure 6 (A) OsCBF2 and OsCBF3 The expression of these two genes was also strongly induced by cold stress. The test results showed that these two genes... Osfbx148 The expression level in the mutant was also significantly higher than that in the wild-type ZH11 ( Figure 6 (B and C). When plants are subjected to low-temperature stress, proline accumulation is promoted. OsP5CS2 This gene is a key rate-limiting enzyme gene for proline synthesis in rice. Its upregulation directly leads to proline accumulation, thereby enhancing the cold tolerance of rice. The results showed that low-temperature stress induced the expression of this gene, especially after 24 hours of low-temperature treatment, the expression level of this gene was significantly higher. Osfbx148 Upregulated by thousands of times in mutants ( Figure 6 (D), indicating OsFBX148 Possibly through influence OsP5CS2 The expression of [a substance] can affect proline synthesis, thereby affecting the tolerance of rice to low temperature stress.

[0040] The above description is only a preferred embodiment of the present invention and is used only to explain the present invention. It is not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. All changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. OsFBX148 The application of genes in regulating plant cold tolerance is characterized by, The OsFBX148 The CDS sequence of the gene is shown in SEQ ID NO.1, and the regulation is manifested as: inhibiting or reducing the... OsFBX148 After the gene is expressed, the plant's cold resistance increases; the plant in question is rice.

2. The application according to claim 1, characterized in that, Suppress or reduce the OsFBX148 The gene is expressed by knockout. OsFBX148 Gene.

3. The application according to claim 1, characterized in that, Knockout OsFBX148 The gene was generated using CRISPR / Cas9 technology.

4. The application according to claim 1, characterized in that, The OsFBX148 After gene mutation, under low temperature stress, rice OsDREB1A , OsCBF2 , OsCBF3 and OsP5CS2 Gene expression levels were significantly upregulated.

5. A method for cultivating transgenic plants with enhanced cold tolerance, characterized in that, The method is to inhibit or reduce the levels of [something] in plants. OsFBX148 By reducing gene expression or decreasing the activity of the OsFBX148 protein, plants with enhanced cold tolerance were screened. OsFBX148 The CDS sequence of the gene is shown in SEQ ID NO.1, the amino acid sequence of the OsFBX148 protein is shown in SEQ ID NO.2, and the plant is rice.

6. The method according to claim 5, characterized in that, In the rice genome OsFBX148 Gene knockout yields OsFBX148 Gene knockout plants, from OsFBX148 Homozygous individuals were obtained from the self-pollination offspring of gene knockout plants. OsFBX148 Gene knockout plants.

7. A method for screening plants with enhanced cold tolerance, characterized in that, Detection of plants OsFBX148 The level of genes or their expression products, selection OsFBX148 Plants with reduced gene expression levels or loss of activity of their encoded proteins are considered candidate plants for enhanced cold tolerance. OsFBX148 The CDS sequence of the gene is shown in SEQ ID NO.1, and the plant is rice.

Images