A process for preparing N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient
By using an immobilized lipase catalyst to carry out the reaction of amidine and ester acyl chloride under mild conditions, the problems of reactivity and stability in the prior art have been solved, and the preparation of dabigatran ester active pharmaceutical ingredient with high selectivity and high purity has been achieved, reducing production costs and control difficulties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- JIANGSU ALPHA PHARM CO LTD
- Filing Date
- 2026-02-25
- Publication Date
- 2026-06-02
Smart Images
Figure SMS_1 
Figure SMS_2 
Figure REF-OBJ-1772000237281-000001
Abstract
Description
Technical Field
[0001] This invention relates to the field of enzyme-catalyzed synthesis technology, specifically to a process for preparing N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient. Background Technology
[0002] Dabigatran etexilate, chemically named N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester, with the chemical formula C34H41N7O5, is a cutting-edge next-generation oral anticoagulant, a direct thrombin inhibitor (DTI). Developed by Boehringer Ingelheim, Germany, dabigatran etexilate capsules (trade name Pradaxa) were first launched in Germany and the UK in April 2008, and received FDA approval on October 19, 2010, for the prevention of stroke and systemic embolism in patients with nonvalvular atrial fibrillation. Its chemical structure is as follows: [The chemical structure formula is shown below for the prevention of stroke and systemic embolism in patients with nonvalvular atrial fibrillation.] The main deficiency in the existing dabigatran ester active pharmaceutical ingredient preparation process lies in the reaction of the amidoyl group (BTS-1 intermediate) with the ester acyl chloride (n-hexyl chloroformate), a crucial step.
[0003] This reaction involves the key amide and ester bonds that form the core structure of dabigatran ester, but it does present some significant process defects and challenges. The main shortcomings are as follows: The inherent defects of the reaction reagent (n-hexyl chloroformate) are its high reactivity and instability. N-hexyl chloroformate is very reactive, readily hydrolyzed, and extremely sensitive to moisture. This requires the entire reaction system to be highly anhydrous, placing extremely stringent requirements on the sealing of equipment and the dryness of solvents and raw materials, which increases the difficulty and cost of production control. Due to its high reactivity, in addition to reacting with the target amidoamine group, it may also undergo side reactions with other potentially nucleophilic groups, leading to the generation of impurities. Summary of the Invention
[0004] To address the above shortcomings, the present invention provides the following technical solution: A process for preparing N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient includes the following steps: The first step is to load the lipase in the CALB lyophilized powder onto a fixation carrier to prepare an immobilized enzyme. In the second step, compound II was dissolved in an organic solvent, and an enzyme immobilized by a catalyst and a molecular sieve were added. The mixture was heated to 30–35 °C, and compound I was slowly added dropwise. The reaction was carried out at a constant temperature for 8–12 h. The reaction was monitored by HPLC. After the reaction was completed, the product was separated to obtain compound III.
[0005] Furthermore, the carrier resin for the immobilized enzyme is Immobead-150.
[0006] Furthermore, the organic solvent is one of tert-butyl methyl ether (MTBE), acetone, n-heptane, and isooctane, and the reagents used in the reaction are all dried anhydrous reagents.
[0007] Furthermore, the amount of compound I is 1.0 to 1.2 eq of compound II.
[0008] Furthermore, the amount of the immobilized enzyme is 10-20 wt% of compound II.
[0009] Furthermore, the molecular sieve is an activated 3Å or 4Å molecular sieve, obtained by activating at high temperature and then baking at 300°C for 3-4 hours, and the amount of molecular sieve used is 10-15% w / v of the reaction liquid volume.
[0010] Furthermore, the CALB lyophilized powder is prepared according to the technical solution of the published patent CN112342204B, and the nucleotide sequence of the enzyme in the CALB lyophilized powder is shown in SEQ ID NO: 1.
[0011] Furthermore, the amino acid sequence of the enzyme in the CALB lyophilized powder is shown in SEQ ID NO: 2.
[0012] Furthermore, the preparation process of the immobilized enzyme is as follows: S1. Dissolution and crude purification of enzyme lyophilized powder Prepare 0.05 M phosphate-buffered saline (PBS) buffer (pH 7.0-8.0). Suspend a certain amount of CALB lyophilized powder in the pre-cooled PBS buffer (material-to-liquid ratio 1:10–1:20 w / v). Gently stir at 4°C for 2–4 hours to ensure complete dissolution and release of the enzyme protein. Centrifuge at 10,000–15,000 rpm for 30 minutes at 4°C. Carefully aspirate the supernatant to obtain the crude enzyme solution. Determine its protein concentration (Bradford method or BCA method) and enzyme activity (using p-nitrophenol ester hydrolysis as the standard method) to calculate the efficiency of subsequent immobilization and activity recovery.
[0013] S2. Carrier Pretreatment Take a certain amount of epoxy resin carrier, soak it in 10 times the volume of anhydrous ethanol for 15 minutes, stir gently to wet and remove air from the carrier gaps, filter with a Buchner funnel to remove ethanol, rinse with plenty of deionized water until there is no alcohol smell, and then equilibrate the carrier with 0.05MPBS (pH 7.5) buffer for later use. S3. Immobilization reaction Add the pretreated wet carrier to the crude enzyme solution. The mass ratio of carrier to enzyme protein is 1:1. Place the mixture in a constant temperature water bath shaker at 25-30℃ and 150-200 rpm for 12-24 hours with gentle shaking. During this process, the enzyme molecules covalently bind to the epoxy groups of the carrier. S4. Termination of reaction and cleaning After the reaction was completed, the immobilized enzyme was separated by filtration using a Buchner funnel. It was then washed 3-5 times with PBS buffer to remove unimmobilized free proteins, followed by 2 washes with deionized water and 2 washes with 0.5 M NaCl solution to remove contaminating proteins adsorbed on the carrier by ionic forces, ensuring the stability of the immobilization. S5. Closed: To reduce the risk of unreacted epoxy groups on the carrier reacting with the product or substrate in subsequent use, the enzyme can be blocked with a small molecule. The immobilized enzyme is transferred to a 1.0 M glycine solution (pH 8.0) or a 1.0 M ethanolamine solution (pH 9.0) and gently shaken at room temperature for 2-4 hours; then filtered and washed with plenty of PBS and deionized water. S6. Drying and Storage: The final immobilized enzyme particles were dried to constant weight in a vacuum drying oven or freeze dryer. The dried immobilized enzymes were then sealed and stored at 4°C or -20°C in the dark.
[0014] The beneficial effects of this invention are: 1. This invention, through the high regioselectivity of the enzyme, accurately identifies primary amines (with low steric hindrance and strong nucleophilicity) at the amidine end and uses them as the preferred acylation site, while hardly acting on aromatic amines on the benzene ring, thus fundamentally avoiding side reactions such as diacylation; 2. Enzyme-catalyzed reactions are usually carried out under mild near-neutral conditions and at room temperature, completely eliminating the need for a strongly alkaline environment and low-temperature cooling, greatly reducing energy consumption and the complexity of production control; 3. This invention has high reaction selectivity, few byproducts, high product purity, and convenient post-processing, which conforms to the concept of green chemistry. Detailed Implementation
[0015] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0016] Preparation of immobilized enzymes S1. Dissolution and crude purification of enzyme lyophilized powder Prepare 0.05 M phosphate-buffered saline (PBS) buffer (pH 7.0–8.0). Suspend a certain amount of CALB lyophilized powder in the pre-cooled PBS buffer (material-to-liquid ratio 1:10–1:20 w / v). Gently stir at 4°C for 2–4 hours to ensure complete dissolution and release of the enzyme protein. Centrifuge at 10,000–15,000 rpm for 30 minutes at 4°C. Carefully aspirate the supernatant to obtain the crude enzyme solution. Determine its protein concentration (Bradford method or BCA method) and enzyme activity (using p-nitrophenol ester hydrolysis as the standard method) to calculate the efficiency of subsequent immobilization and activity recovery.
[0017] S2. Carrier Pretreatment Take a certain amount of epoxy resin carrier, soak it in 10 times the volume of anhydrous ethanol for 15 minutes, stir gently to wet and remove air from the carrier gaps, filter with a Buchner funnel to remove ethanol, rinse with plenty of deionized water until there is no alcohol smell, and then equilibrate the carrier with 0.05MPBS (pH 7.5) buffer for later use. S3. Immobilization reaction The pretreated wet carrier was added to the crude enzyme solution, with a carrier-to-enzyme protein mass ratio of 1:1. Place the mixture in a constant temperature water bath shaker at 25-30℃ and 150-200 rpm for 12-24 hours with gentle shaking. During this process, the enzyme molecules covalently bind to the epoxy groups of the carrier. S4. Termination of reaction and cleaning After the reaction was completed, the immobilized enzyme was separated by filtration using a Buchner funnel. It was then washed 3-5 times with PBS buffer to remove unimmobilized free proteins, followed by 2 washes with deionized water and 2 washes with 0.5 M NaCl solution to remove contaminating proteins adsorbed on the carrier by ionic forces, ensuring the stability of the immobilization. S5. Closed: To reduce the risk of unreacted epoxy groups on the carrier reacting with the product or substrate in subsequent use, the enzyme can be blocked with a small molecule. The immobilized enzyme is transferred to a 1.0 M glycine solution (pH 8.0) or a 1.0 M ethanolamine solution (pH 9.0) and gently shaken at room temperature for 2-4 hours; then filtered and washed with plenty of PBS and deionized water. S6. Drying and Storage: The final immobilized enzyme particles were dried to constant weight in a vacuum drying oven or freeze dryer. The dried immobilized enzymes were then sealed and stored at 4°C or -20°C in the dark.
[0018] Example 1 0.05 mol (25.0 g) of compound II was dissolved in 300 ml of acetone, an organic solvent. 2.5 g of the catalyst-immobilized enzyme prepared above was added, along with 35 g of molecular sieve (obtained by activation at high temperature and baking at 300 °C for 3–4 h). The mixture was heated to 30–35 °C, and 1.0 eq of compound I was slowly added dropwise. The reaction was carried out at a constant temperature for 8–12 h, and the reaction was monitored by HPLC. After the reaction was completed, the reaction mixture was cooled to room temperature, filtered, and the immobilized enzyme catalyst and molecular sieve were separated. The filter cake was washed 2–3 times with a small amount of drying solvent. The filtrate and washing liquid were combined, and the organic phase of the filtrate was separated by saturated sodium bicarbonate solution. The filtrate was dried with anhydrous sodium sulfate or magnesium sulfate, filtered to remove the drying agent, and distilled under reduced pressure to obtain the crude product. The crude product was recrystallized from 40 ml of toluene to obtain 29.7 g of compound III, with a yield of 94.6% and a purity of 98.8%.
[0019] Example 2 0.05 mol (25.0 g) of compound II was dissolved in 300 ml of acetone, an organic solvent. 5 g of the catalyst-immobilized enzyme prepared above was added, along with 35 g of molecular sieve (obtained by activation at high temperature and baking at 300 °C for 3–4 h). The mixture was heated to 30–35 °C, and 1.0 eq of compound I was slowly added dropwise. The reaction was carried out at a constant temperature for 8–12 h, and the reaction was monitored by HPLC. After the reaction was completed, the reaction mixture was cooled to room temperature, filtered, and the immobilized enzyme catalyst and molecular sieve were separated. The filter cake was washed 2–3 times with a small amount of drying solvent. The filtrate and washing liquid were combined, and the organic phase of the filtrate was separated by saturated sodium bicarbonate solution. The filtrate was dried with anhydrous sodium sulfate or magnesium sulfate, filtered to remove the drying agent, and distilled under reduced pressure to obtain the crude product. The crude product was recrystallized from 40 ml of toluene to obtain 29.8 g of compound III, with a yield of 94.9% and a purity of 98.7%.
[0020] Example 3 0.05 mol (25.0 g) of compound II was dissolved in 300 ml of acetone, an organic solvent. 2.5 g of the catalyst-immobilized enzyme prepared above was added, along with 35 g of molecular sieve (obtained by activation at high temperature and baking at 300 °C for 3–4 h). The mixture was heated to 30–35 °C, and 1.2 eq of compound I was slowly added dropwise. The reaction was carried out at a constant temperature for 8–12 h, and the reaction was monitored by HPLC. After the reaction was completed, the reaction mixture was cooled to room temperature, filtered, and the immobilized enzyme catalyst and molecular sieve were separated. The filter cake was washed 2–3 times with a small amount of drying solvent. The filtrate and washing liquid were combined, and the organic phase of the filtrate was separated by saturated sodium bicarbonate solution. The filtrate was dried with anhydrous sodium sulfate or magnesium sulfate, filtered to remove the drying agent, and distilled under reduced pressure to obtain the crude product. The crude product was recrystallized from 40 ml of toluene to obtain 29.5 g of compound III, with a yield of 93.7% and a purity of 98.5%.
[0021] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, it is intended that all variations falling within the meaning and scope of equivalents of the claims be included within the present invention.
[0022] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
[0023] sequence list <110> Jiangsu Alpha Pharmaceutical Co., Ltd. <120> An enzyme-catalyzed synthesis method for dabigatran intermediates and lipase <160> 5 <170> SIPOSequenceListing1.0 <210> 1 <211> 1026 <212> DNA <213> CALB (Artificial Sequence) <400> 1 atgaaactgc tgtctctgac cggtgttgct ggtgttctgg cgacttgtgt agcagctacc 60 ccactggtta aacgtctgcc gtctggctct gacccggcat tctctcagcc aaaaagcgtt 120 ctggacgctg gtctgacctg tcagggtgct tccccgtcta gcgtctctaa acctattctg 180 ctggtgccgg gtactggtac taccggtcca cagtccttcg acagcaactg gattccgctg 240 tctacccagc tgggctatac cccgtgttgg atttccccgc cgcctttcat gctgaacgat 300 acgcaggtca acaccgaata tatggtgaac gcaatcactg cgctgtatgc cggctccggc 360 aacaacaaac tgccagtgct gacctggtcc cagggtggtc tggttgccca gtggggtctg 420 actttcttcc cgagcattcg ttctaaagtt gaccgcctga tggcgttcgc tcctgattac 480 aagggcaccg ttctggcagg tccgctggat gctctggctg tgtccgctcc atctgtctgg 540 cagcaaacca cgggtagcgc actgaccact gcactgcgta acgctggcgg cctgactcag 600 attgttccaa ccaccaacct gtactctgcc actgacgaaa tcgtgcaacc tcaggtttct 660 aacagcccac tggactctag ctacctgttt aacggtaaaa acgtacaagc gcaggctgtg 720 tgtggcccgc tgttcgttat tgatcacgcg ggctccctga cttctcagtt cagctatgtt780 gtgggtcgtt ccgctctgcg ttccaccact ggtcaggcac gttccgctga ttacggtatc 840 accgattgta acccgctgcc tgctaatgat ctgactccgg aacaaaaagt tgctgctgct 900 gcactgctgg ctccagcagc agcagctatt gtcgcaggtc caaaacagaa ctgcgaacca 960 gatctgatgc cgtacgctcg tccgtttgcg gttggtaaac gcacctgctc cggtatcgtt1020 access 1026 <210> 2 <211> 342 <212> PRT <213> CALB(ArtificialSequence) <400> 2 Put Lys Leu Leu Ser Leu Thr Gly Val Ala Gly Val Leu Ala Thr Cys 1 5 10 15 Val Ala Ala Thr Pro Leu Val Lys Arg Leu Pro Ser Gly Ser Asp Pro 20 25 30 Ala Phe Ser Gln Pro Lys Ser Val Leu Asp Ala Gly Leu Thr Cys Gln 35 40 45 Gly Ala Ser Pro Ser Ser Val Ser Lys Pro Ile Leu Leu Val Pro Gly 50 55 60 Thr Gly Thr Thr Gly Pro Gln Ser Phe Asp Ser Asn Trp Ile Pro Leu 65 70 75 80 Ser Thr Gln Leu Gly Tyr Thr Pro Cys Trp Ile Ser Pro Pro Pro Phe 85 90 95 Met Leu Asn Asp Thr Gln Val Asn Thr Glu Tyr Met Val Asn Ala Ile 100 105 110 Thr Ala Leu Tyr Ala Gly Ser Gly Asn Asn Lys Leu Pro Val Leu Thr 115 120 125 Trp Ser Gln Gly Gly Leu Val Ala Gln Trp Gly Leu Thr Phe Phe Pro 130 135 140 Ser Ile Arg Ser Lys Val Asp Arg Leu Met Ala Phe Ala Pro Asp Tyr 145 150 155 160 Lys Gly Thr Val Leu Ala Gly Pro Leu Asp Ala Leu Ala Val Ser Ala 165 170 175 Pro Ser Val Trp Gln Gln Thr Thr Gly Ser Ala Leu Thr Thr Ala Leu 180 185 190 Arg Asn Ala Gly Gly Leu Thr Gln Ile Val Pro Thr Thr Asn Leu Tyr 195 200 205 Ser Ala Thr Asp Glu Ile Val Gln Pro Gln Val Ser Asn Ser Pro Leu 210 215 220 Asp Ser Ser Tyr Leu Phe Asn Gly Lys Asn Val Gln Ala Gln Ala Val 225 230 235 240 Cys Gly Pro Leu Phe Val Ile Asp His Ala Gly Ser Leu Thr Ser Gln 245 250 255 Phe Ser Tyr Val Val Gly Arg Ser Ala Leu Arg Ser Thr Thr Gly Gln 260 265 270 Ala Arg Ser Ala Asp Tyr Gly Ile Thr Asp Cys Asn Pro Leu Pro Ala 275 280 285 Asn Asp Leu Thr Pro Glu Gln Lys Val Ala Ala Ala Ala Leu Leu Ala 290 295 300 Pro Ala Ala Ala Ala Ile Val Ala Gly Pro Lys Gln Asn Cys Glu Pro 305 310 315 320 Asp Leu Met Pro Tyr Ala Arg Pro Phe Ala Val Gly Lys Arg Thr Cys 325 330 335 Ser Gly Ile Val Thr Pro 340 <210>3 <211>31 <212>DNA <213>Primer F(ArtificialSequence) <400>3cgcggatccaatgaaactgctgtctctgacc31 <210>4 <211>28 <212>DNA <213>Primer R(ArtificialSequence) <400>4cccaagctttggggtaacgataccggag28 <210>5 <211>1029 <212>DNA <213>Candida antarctica <400>5 Atgaagctac tctctctgac cggtgtggct ggtgtgcttg cgacttgcgt tgcagccact60 Cctttggtga agcgtctacc ttccggttcg gaccctgcct tttcgcagcc caagtcggtg120 Ctcgatgcgg gtctgacctg ccagggtgct tcgccatcct cggtctccaa acccatcctt180 Ctcgtccccg gaaccggcac cacaggtcca cagtcgttcg actcgaactg gatccccctc240 Tcaacgcagt tgggttacac accctgctgg atctcacccc cgccgttcat gctcaacgac300 Acccaggtca acacggagta catggtcaac gccatcaccg cgctctacgc tggttcgggc360 Aacaacaagc ttcccgtgct tacctggtcc cagggtggtc tggttgcaca gtggggtctg420 Accttcttcc ccagtatcag gtccaaggtc gatcgactta tggcctttgc gcccgactac480 Aagggcaccg tcctcgccgg ccctctcgat gcactcgcgg ttagtgcacc ctccgtatgg540 Cagcaaacca ccggttcggc actcaccacc gcactccgaa acgcaggtgg tctgacccag600 Atcgtgccca ccaccaacct ctactcggcg accgacgaga tcgttcagcc tcaggtgtcc660 Aactcgccac tcgactcatc ctacctcttc aacggaaaga acgtccaggc acaggccgtg720 Tgtgggccgc tgttcgtcat cgaccatgca ggctcgctca cctcgcagtt ctcctacgtc780 Gtcggtcgat ccgccctgcg ctccaccacg ggccaggctc gtagtgcaga ctatggcatt840 Acggactgca accctcttcc cgccaatgat ctgactcccg agcaaaaggt cgccgcggct900 Gcgctcctggc gccggcagct gcagccatcg tggcgggtcc aaagcagaac tgcgagccc960 Gacctcatgc cctacgcccg cccctttgca gtaggcaaaa ggacctgctc cggcatcgtc1020 accccctga1029
Claims
1. A process for preparing N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient, characterized in that... Includes the following steps: The first step is to load the lipase in the CALB lyophilized powder onto a fixation carrier to prepare an immobilized enzyme. In the second step, compound II was dissolved in an organic solvent, and an enzyme immobilized by a catalyst and a molecular sieve were added. The mixture was heated to 30–35 °C, and compound I was slowly added dropwise. The reaction was carried out at a constant temperature for 8–12 h. The reaction was monitored by HPLC. After the reaction was completed, the product was separated to obtain compound III.
2. The preparation process of N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient according to claim 1, characterized in that: The carrier for the immobilized enzyme is Immobead-150 resin.
3. The preparation process of N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient according to claim 1, characterized in that: The organic solvent is one of tert-butyl methyl ether (MTBE), acetone, n-heptane, and isooctane, and the reagents used in the reaction are all dried anhydrous reagents.
4. The preparation process of N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient according to claim 1, characterized in that: The amount of compound I used is 1.0 to 1.2 eq of compound II.
5. The preparation process of N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient according to claim 1, characterized in that: The amount of the immobilized enzyme used is 10-20 wt% of compound II.
6. The preparation process of N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient according to claim 1, characterized in that: The molecular sieve is an activated 3Å or 4Å molecular sieve, obtained by activating at high temperature and then baking at 300°C for 3-4 hours. The amount of molecular sieve used is 10-15% w / v of the reaction liquid volume.
7. The preparation process of N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient according to claim 1, characterized in that: The CALB freeze-dried powder was prepared according to the technical solution of the published patent CN112342204B.
8. The preparation process of N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient according to claim 1, characterized in that: The nucleotide sequence of the enzyme in the CALB lyophilized powder is shown in SEQ ID NO:
1.
9. The preparation process of N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient according to claim 1, characterized in that: The amino acid sequence of the enzyme in the CALB lyophilized powder is shown in SEQ ID NO:
2.
10. The preparation process of N-[3-amino-4-(methylamino)benzoyl]-N-2-pyridine-β-alanine ethyl ester active pharmaceutical ingredient according to claim 1, characterized in that: The preparation process of the immobilized enzyme is as follows: S1. Dissolution and crude purification of enzyme lyophilized powder Prepare 0.05 M phosphate-buffered saline (PBS) buffer (pH 7.0-8.0). Suspend a certain amount of CALB lyophilized powder in the pre-cooled PBS buffer (material-to-liquid ratio 1:10–1:20 w / v). Gently stir at 4°C for 2–4 hours to ensure complete dissolution and release of the enzyme protein. Centrifuge at 10,000–15,000 rpm for 30 minutes at 4°C. Carefully aspirate the supernatant to obtain the crude enzyme solution. Determine its protein concentration (Bradford method or BCA method) and enzyme activity (using p-nitrophenol ester hydrolysis as the standard method) to calculate the efficiency and activity recovery rate of subsequent immobilization. S2. Carrier Pretreatment Take a certain amount of epoxy resin carrier, soak it in 10 times the volume of anhydrous ethanol for 15 minutes, stir gently to wet and remove air from the carrier gaps, filter with a Buchner funnel to remove ethanol, rinse with plenty of deionized water until there is no alcohol smell, and then equilibrate the carrier with 0.05MPBS (pH 7.5) buffer for later use. S3. Immobilization reaction The pretreated wet carrier was added to the crude enzyme solution, with a carrier-to-enzyme protein mass ratio of 1:
1. Place the mixture in a constant temperature water bath shaker at 25-30℃ and 150-200 rpm for 12-24 hours with gentle shaking. S4. Termination of reaction and cleaning After the reaction was completed, the immobilized enzyme was separated by filtration using a Buchner funnel. It was then washed 3-5 times with PBS buffer to remove unimmobilized free proteins, followed by 2 washes with deionized water and 2 washes with 0.5 M NaCl solution to remove contaminating proteins adsorbed on the carrier by ionic forces. S5. Closed: Transfer the immobilized enzyme to a 1.0 M glycine solution (pH 8.0) or a 1.0 M ethanolamine solution (pH 9.0), and gently shake at room temperature for 2–4 hours; filter and wash thoroughly with large amounts of PBS and deionized water. S6. Drying and Storage: The final immobilized enzyme particles were dried in a vacuum drying oven or freeze dryer until constant weight. The dried immobilized enzymes were sealed and stored at 4℃ or -20℃ in the dark.