One-step detection technology of LAMP / CRISPR-Cas12b and application thereof in nucleic acid instant detection

Abstract

This invention discloses a one-step LAMP / CRISPR-Cas12b detection technology and its application in point-of-care nucleic acid detection. The invention involves completely mixing the components for LAMP nucleic acid amplification and the components for CRISPR-Cas detection in a single-tube system before initiating the reaction. The primers for LAMP nucleic acid amplification consist of normal primers and mutant primers. The sgRNA for CRISPR-Cas12b detection has a sequence identical or complementary to the product amplified by the mutant primers. The amplicon obtained from the mutant primers is recognized and cleaved by the introduced mutant sgRNA, without cleaving the test template or normal amplicon, allowing for the smooth accumulation of normal amplicon. This invention has advantages such as simple and rapid operation, high sensitivity, and good specificity, effectively solving the problem of low sensitivity when CRISPR cleavage and nucleic acid amplification reactions are performed in the same system. It offers advantages such as high sensitivity and specificity, simple and rapid operation, and low cost.

Description

Technical Field

[0001] This invention belongs to the field of biological detection, and specifically relates to a one-step LAMP / CRISPR-Cas12b detection technology and its application in nucleic acid point detection. Background Technology

[0002] Isothermal amplification of nucleic acids (AAMP) refers to the technique of increasing the copy number of specific DNA or RNA fragments at a constant temperature. Compared with PCR, isothermal AAMP simplifies instrument requirements and significantly shortens reaction time, allowing for reactions to be completed with simple equipment such as heating modules and water baths. It holds significant value in the field of point-of-care testing (POCT). Loop-mediated isothermal amplification (LAMP) is the most widely used technique in nucleic acid POCT due to its high sensitivity, good stability, and low cost. However, LAMP amplification is prone to false positives. Even with carefully designed and repeatedly validated detection systems, it is difficult to completely avoid non-specific amplification signals appearing around 30-35 minutes, making it impossible to distinguish from low-copy-count samples. Therefore, developing novel nucleic acid POCT techniques that can completely avoid false positives in LAMP is of great importance.

[0003] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a natural immune system found in bacteria and archaea, helping these microorganisms resist viral invasion. Due to its high efficiency, precision, and ease of operation, CRISPR-Cas technology has become a highly regarded and important tool in modern gene editing technology and is widely used in nucleic acid point-of-care testing (POCT). The CRISPR-Cas system mainly consists of Cas protein and sgRNA. The complex formed by Cas protein and sgRNA can bind to targets with PAM motifs (TTN) and cleave double-stranded DNA or single-stranded RNA, activating the paracleavage activity of the Cas protein. The activated paracleavage Cas protein can cleave single-stranded DNA probes (ssDNA reporters) with fluorescent and quenching groups, producing a significant fluorescent signal. CRISPR-Cas technology has good specificity; when the target has single or multiple base mismatches, the reactivity of the CRISPR-Cas system will be significantly reduced or completely absent. Therefore, the CRISPR-Cas system can only specifically recognize and cleave specific fragments of the target amplification product, improving detection specificity and solving the false positive problem caused by non-specific amplification in isothermal amplification techniques.

[0004] The most widely used CRISPR-Cas systems in in vitro diagnostics include CRISPR-Cas12a, CRISPR-Cas12b, and CRISPR-Cas13a. Currently, the CRISPR-Cas12a system is mainly used in conjunction with RPA amplification, while CRISPR-Cas12b, due to its heat resistance and excellent paracleavage activity, is primarily used in the development of LAMP-CRISPR-Cas12b nucleic acid POCT technology. Because the CRISPR-Cas system has low sensitivity (detection limit 10pM-1000pM) for direct detection, it is necessary to first amplify the template nucleic acid using LAMP, and then use the CRISPR-Cas12a or CRISPR-Cas12b system for signal generation. Since the CRISPR-Cas system recognizes and cleaves the detection template molecule before amplification, significantly reducing detection sensitivity, detection requires first performing LAMP amplification in one PCR tube, and then transferring the amplified product to another PCR tube containing the CRISPR-Cas12b system. This process is complex, time-consuming, and prone to aerosol contamination, which is the biggest bottleneck limiting its clinical application.

[0005] Achieving highly sensitive detection using both LAMP and CRISPR-Cas12b systems in the same system is currently a challenge and a hot research topic in this field. There are two main methods: ① Modifying the sgRNA of CRISPR-Cas12b with a photosensitive group to inactivate it, and then activating its activity using light after nucleic acid amplification. This technique completely solves the problem of CRISPR-Cas cleavage of template DNA and has the advantage of high sensitivity. However, this method only solves the problem of isothermal amplification and CRISPR-Cas being in the same system, and still suffers from high reagent costs, long synthesis cycles (2-4 weeks), complex operation, long processing time, and the need for an additional high-power UV light source (50W). ② Mutagenizing the Cas12b protein to reduce its cleavage activity against the target sequence. However, this method only reduces the activity of the CRISPR-Cas system and cannot completely avoid cleavage of the target, resulting in relatively low sensitivity. Therefore, developing novel LAMP-CRISPR-Cas12b technologies that do not cleave target molecules while maintaining the high detection activity of CRISPR-Cas12b is key to developing new nucleic acid POCT. Summary of the Invention

[0006] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a one-step LAMP / CRISPR-Cas12b detection technology.

[0007] Another object of the present invention is to provide the application of the above-mentioned detection technology in nucleic acid point detection or in the preparation of nucleic acid point detection kits.

[0008] Another object of the present invention is to provide a kit for detecting the novel coronavirus.

[0009] Another object of the present invention is to provide a kit for detecting polyomavirus (BKV).

[0010] The objective of this invention is achieved through the following technical solution: a one-step LAMP / CRISPR-Cas12b detection technology, wherein the components for LAMP nucleic acid amplification and the components for CRISPR-Cas detection are completely mixed in a single tube system before the reaction begins; wherein the primers for LAMP nucleic acid amplification consist of normal primers and mutant primers; and the sgRNA used for CRISPR-Cas12b detection has the same or complementary sequence to the product obtained by amplification with the mutant primers.

[0011] The normal primers consist of a normal upstream outer primer, a normal downstream outer primer, a normal upstream inner primer, a normal downstream inner primer, a normal forward loop primer, and a normal reverse loop primer.

[0012] The mutant primer is at least one of an upstream inner primer and a downstream inner primer. The relative positions of the normal primer and the corresponding mutant primer in the target nucleic acid sequence generally need to be consistent or complementary. The mutation method of the mutant primer relative to the normal primer includes one or more of the following: insertion of at least one base, deletion of at least one base, and substitution of at least one base.

[0013] In the normal primers or the mutant primers, a CRISPR-Cas PAM sequence needs to be present at a position 1-18 bases from the 3' end. The PAM sequence includes TTTN of CRISPR-Cas12a or NGG of CRISPR-Cas9, or the PAM corresponding to other engineered CRISPR-Cas systems.

[0014] The normal primers and the mutant primers are mixed in a molar ratio of 1:99 to 99:1.

[0015] The sgRNA in the CRISPR-Cas12b has a sequence that is inconsistent or non-complementary to the amplification product of the normal primer, and has low activity for the amplification product of the normal primer, thus it will not cleave the amplification template; however, its amplification product sequence is consistent or complementary to that of the mutant primer, and it has high activity for the amplification product of the mutant primer.

[0016] The above-mentioned one-step LAMP / CRISPR-Cas detection technology is applied in point-of-care nucleic acid testing for non-diagnostic and therapeutic purposes.

[0017] The above-mentioned one-step LAMP / CRISPR-Cas detection technology has medical applications in the preparation of microbial nucleic acid point detection kits.

[0018] The microorganisms mentioned include bacteria, fungi, viruses, chlamydia, and mycoplasma.

[0019] A kit for detecting the novel coronavirus includes a LAMP component for nucleic acid amplification and a component for CRISPR-Cas12b detection; wherein the primers in the LAMP component for nucleic acid amplification are as follows:

[0020] N-F3: 5'-GGCTTCTACGCAGAAGGGA-3';

[0021] N-B3: 5'-CTTAGTGACAGTTTGGCC-3';

[0022] N-WT-FIP: 5'-CCTACTGCTGCCTGGAGTTGAAGCCTCTTCTCGTTCCTCAT-3';

[0023] N-MT-FIP: 5'-CCTACTGCTGCCTGGAGTTGAAGCCTCTTCTCGTTCTCCTCAT-3';

[0024] N-BIP: 5'-GGCAATGGCGGTGATGCTCCAGACATTTTGCTCTCAA-3';

[0025] N-LF: 5'-ATTTCTTGAACTGTTGCGACTAC-3';

[0026] N-LB: 5'-CTCTTGCTTTTGCTGCTG-3';

[0027] The sgRNA used for CRISPR-Cas12b detection is shown below:

[0028] GAAGGUGGUUAGCUACAGGCUGACCAGUGCAGUUGUGUCAUGCUACGGUGACCUAACACGUCACUCAGUCACAACGGCUAUCUAUAUUUCCACUAACCAAAGUUAGUGGAAAUGUAGAUGGUUAGCACUCGUUCUCCUCAUCACGUAG.

[0029] The above-mentioned kit for detecting the novel coronavirus preferably includes a mixture of reagents with the following composition when used: 0.2 μM forward outer primer N-F3, 0.2 μM reverse outer primer N-B3, 0.8 μM wild-type forward inner primer N-WT-FIP, 0.8 μM mutant forward inner primer N-MT-FIP, 1.6 μM reverse inner primer N-BIP, 0.8 μM forward loop primer N-LF, 0.8 μM reverse loop primer N-LB, 0.4 μM sgRNA, 0.4 μM probe ssDNA receptor, 0.2 μM Cas12b protein, 8 U / 25 μL Bst3.0 DNA polymerase, 1×LAMP buffer, and 8 mM Mg 2+ 1.4 mM dNTPs, with water as the solvent.

[0030] The kit for detecting the novel coronavirus also includes instructions for use.

[0031] The method of use includes the following steps: take 23 μL of mixed reagent, add 2 μL of nucleic acid to be tested, mix well, and then perform detection on the instrument.

[0032] A kit for detecting polyomavirus (BKV) includes a LAMP component for nucleic acid amplification and a component for CRISPR-Cas12b detection; wherein the primers in the LAMP component for nucleic acid amplification are as follows:

[0033] BKV-F3: 5'-TCCTTTTTGCTAAGTGACCT-3';

[0034] BKV-B3: 5'-AATAAAAGCACCTGTTTAAAGC-3';

[0035] BKV-WT-BIP: 5'-TTGATGGCACAGAAAGACTTCCTTGGTTTGCAATTGTCCTT-3';

[0036] BKV-MT-BIP: 5'-TTGATGGCACAGAAAGACTTCCTTGGTTTGGCAATGTGTCCTT-3';

[0037] BKV-FIP: 5'-AACCTCTTCTACCTGGGATTCCATATATAAACAGGAGAACCCAGAGA-3';

[0038] BKV-LF: 5'-ACATAGGCTGCCCATCCAC-3';

[0039] BKV-LB: 5'-AGGGGACCCAGATATGATAAGATAT-3';

[0040] The sgRNA in the components used for CRISPR-Cas12b detection is shown below:

[0041] GAAGGUGGUUAGCUACAGGCUGACCAGUGCAGUUGUGUCAUGUGCUACGGUGACCUAACACGUCACUCAGUCACAACGGCUAUCUAUAUUUCCACUAACCAAAGUUAGUGGAAAUGUAGAUGGUUAGCACGCAAUGUGUCCUUGUUUGUCAAU.

[0042] The above-mentioned kit for detecting polyomavirus preferably includes the following mixture of reagents used in this kit: 0.2 μM forward outer primer BKV-F3, 0.2 μM reverse outer primer BKV-B3, 1.6 μM wild-type forward inner primer BKV-WT-BIP, 1.6 μM reverse inner primer BKV-FIP, 0.8 μM forward loop primer BKV-LF, 0.8 μM reverse loop primer BKV-LB, 0.4 μM sgRNA, 0.4 μM probe ssDNA receptor, 0.2 μM Cas12b protein, 8 U / 25 μL Bst2.0 DNA polymerase, 1×LAMP buffer, and 8 mM MgSO4. 2+ 1.4 mM dNTPs, with water as the solvent.

[0043] The kit for detecting polyomavirus also includes instructions for use.

[0044] The method of use includes the following steps: take 23 μL of mixed reagent, add 2 μL of nucleic acid to be tested, mix well, and then perform detection on the instrument.

[0045] The principle of this invention is as follows: A mutant LAMP system is established by mutating inner primers (FIP or BIP), and a corresponding mutant CRISPR-Cas12b system is constructed simultaneously. During detection, both normal and mutant inner primers are added, generating normal and mutant amplicones respectively. A mutant sgRNA is also introduced. This mutant CRISPR / Cas12b system only cleaves the mutant amplicon, without cleaving the test template or the normal (wild-type) amplicon. This allows the normal amplicon to accumulate smoothly, while the normal amplicon serves as the LAMP amplification template for the mutant inner primers, ensuring that the mutant amplicon accumulates to a sufficient concentration to activate the Cas12b paracleavage effect and generate a high fluorescence signal, thus guaranteeing sensitivity.

[0046] The present invention has the following advantages and effects compared with the prior art:

[0047] By studying the effects and response mechanisms of template molecule mutation types and sites on CRISPR-Cas12b activity, while also considering the interference of corresponding primer mutations on LAMP amplification, this invention has the advantages of simple and rapid operation, high sensitivity, and good specificity. It effectively solves the problem of low sensitivity in the same system for CRISPR cleavage and nucleic acid amplification reactions, and has the advantages of high sensitivity and specificity, simple and rapid operation, and low cost. Attached Figure Description

[0048] Figure 1 This is a fluorescence curve illustrating the sensitivity of the engineered one-step LAMP / CRISpr-cas12b method for detecting the N gene of the novel coronavirus.

[0049] Figure 2 This is a fluorescence curve showing the sensitivity of the traditional LAMP / CRISPR-Cas12b one-step method for detecting the N gene of the novel coronavirus.

[0050] Figure 3 The fluorescence curves of the CRISPR reaction between the mutant SgRNA and mutant double-stranded template MT-dsDNA, mutant single-stranded template MT-ssDNA, wild-type double-stranded template WT-dsDNA, and wild-type single-stranded template WT-ssDNA are shown.

[0051] Figure 4 This is a graph showing the specific detection results of the engineered one-step LAMP / Crispr-cas12b method targeting the N gene of COVID-19.

[0052] Figure 5 This is a fluorescence curve showing the sensitivity of BKV detection using the engineered one-step LAMP / CRISPR-Cas12b method.

[0053] Figure 6 This is a fluorescence curve showing the sensitivity of the traditional LAMP / CRISPR-Cas12b one-step method for detecting BKV.

[0054] Figure 7 The fluorescence curves of the CRISPR reaction between the mutant SgRNA and mutant double-stranded template MT-dsDNA, mutant single-stranded template MT-ssDNA, wild-type double-stranded template WT-dsDNA, and wild-type single-stranded template WT-ssDNA are shown.

[0055] Figure 8 This is a graph showing the specific detection results of the engineered one-step LAMP-CRISPR / cas12b method for BKV. Detailed Implementation

[0056] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0057] The primers used in this invention are shown in Table 1:

[0058] Table 1

[0059]

[0060]

[0061] Example 1: Detection of the SARS-CoV-2N gene

[0062] (1) A one-step LAMP / CRISPR-Cas12b detection system for the SARS-COV-2N gene based on mutant primers and sgRNA, comprising the following components in the reaction system according to their final concentrations: SARS-COV-2N gene-LAMP primers (0.2 μM forward outer primer N-F3, 0.2 μM reverse outer primer N-B3, 0.8 μM wild-type forward inner primer N-WT-FIP, 0.8 μM mutant forward inner primer N-MT-FIP, 1.6 μM reverse inner primer N-BIP, 0.8 μM forward loop primer N-LF, 0.8 μM reverse loop primer N-LB), 0.4 μM mutant SARS-COV-2N gene-CRISPR / Cas12b guide RNA (N-MT-sgRNA), 0.4 μM probe ssDNA receptor, 0.2 μM Cas12b protein, 8 U Bst3.0 DNA polymerase, 1×LAMP buffer, 8mM Mg 2+ 1.4 mM dNTPs, nuclease-free water, 2 μL of nucleic acid to be tested, total volume 25 μL.

[0063] To prepare the detection system, first add the detection components (excluding the nucleic acid to be tested) to the bottom of a 100μL eight-tube, then directly add 2μL of the nucleic acid to be tested, cap the tube, mix well, centrifuge briefly, and react at 60℃ for 40 min in a qPCR instrument. Select the FAM channel and read the fluorescence every 1 min.

[0064] The nucleic acid to be tested in this experiment was the SARS-CoV-2 gene plasmid, which was synthesized by Sangon Biotech (Shanghai) Co., Ltd. with the sequence shown below. The SARS-CoV-2N gene sequence was then cloned into the pUC57 vector via TA.

[0065] CTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGC TAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACT.

[0066] Results interpretation: A fluorescence value <5000 at 40 minutes indicates a negative result, while a fluorescence value >5000 at 40 minutes indicates a positive result. Figure 1 It can be seen that the sensitivity of the one-step LAMP / CRISPR-Cas12b detection based on mutant primers and sgRNA is 10 copies / μL.

[0067] (2) The traditional one-step LAMP / CRISPR-Cas12b detection system for the SARS-COV-2N gene includes the following components in the reaction system according to the final concentration: SARS-COV-2N gene-LAMP primers (0.2 μM forward outer primer N-F3, 0.2 μM reverse outer primer N-B3, 1.6 μM wild-type forward inner primer N-WT-FIP, 1.6 μM reverse inner primer N-BIP, 0.8 μM forward loop primer N-LF, 0.8 μM reverse loop primer N-LB), 0.4 μM SARS-COV-2N gene-CRISPR / Cas12b guide RNA (N-WT-sgRNA), 0.4 μM probe ssDNA receptor, 0.2 μM Cas12b protein, 8 U Bst3.0 DNA polymerase, 1×LAMP buffer, 8 mM Mg 2+ 1.4 mM dNTPs, nuclease-free water, 2 μL template, total volume 25 μL.

[0068] To prepare the detection system, first add the detection components (excluding the nucleic acid to be tested) to the bottom of a 100μL eight-tube, then directly add 2μL of the nucleic acid to be tested, cap the tube, mix well, centrifuge briefly, and react at 60℃ for 40 min in a qPCR instrument. Select the FAM channel and read the fluorescence every 1 min.

[0069] The nucleic acid to be tested in this experiment is the SARS-CoV-2 plasmid in (1).

[0070] Results interpretation: A fluorescence value <5000 at 40 minutes indicates a negative result, while a fluorescence value >5000 at 40 minutes indicates a positive result. From Figure 2 It can be seen that the detection sensitivity of the traditional one-step method is 100 copies / μL.

[0071] (3) The 33-base-length double-stranded DNA that recognizes the mutant N-Crispr / Cas12b guide RNA (N-MT-sgRNA) is the mutant double-stranded template N-MT-dsDNA, and the 33-base-length single-stranded DNA that recognizes the N-MT-sgRNA is the mutant single-stranded template N-MT-ssDNA (see Table 1 for the template sequences). The 33-base-length double-stranded DNA that recognizes the normal N-Crispr / Cas12b guide RNA (N-WT-sgRNA) is the normal double-stranded template N-WT-dsDNA, and the 33-base-length single-stranded DNA that recognizes the N-WT-sgRNA is the normal single-stranded template N-WT-ssDNA. The CRISPR reaction system was prepared as follows: 1×Cas12b Buffer, 500nM probe ssDNA receptor, 500nM mutant N-CRISPR / Cas12b guide RNA (N-MT-sgRNA), 250nM BrCas12b, 2μL of test sample, and nuclease-free water to a total volume of 20μL. The template was prepared as follows: nuclease-free water, 10nM N-MT-dsDNA, 10nM N-MT-ssDNA, 10nM N-WT-dsDNA, and 10nM N-WT-ssDNA. Results were as follows: Figure 3 As shown, at a template concentration of 10 nM, the CRISPR / Cas 12b system mediated by the mutant N-CRISPR / Cas 12b guide RNA (N-MT-sgRNA) has virtually no activity against normal templates or against double-stranded and single-stranded products generated during amplification.

[0072] (4) Specificity verification was performed on throat swab samples from eight common respiratory pathogens. These eight common respiratory pathogens were collected from the Department of Laboratory Medicine at Nanfang Hospital and identified by the hospital as SARS-CoV-2, human metapneumovirus (hMPV), parainfluenza virus type 3 (PIV3), Mycoplasma pneumoniae (MP), influenza A virus (IVA), respiratory syncytial virus type A (RSVA), adenovirus (ADV), and rhinovirus (RhV). Two μL of each sample was taken and tested using a one-step reagent based on mutation primers and sgRNA. Fluorescence values ​​were detected using a PCR instrument. The results are shown below. Figure 4As shown, the one-step method based on mutant primers and sgRNA produces a highly sensitive fluorescent signal for novel coronavirus samples, but does not produce a signal for other respiratory pathogens.

[0073] Example 2: Detection of polyomavirus BKV

[0074] A one-step LAMP / CRISPR-Cas12b detection system for BKV based on mutant primers and sgRNA includes the following components in the reaction system, expressed as final concentrations: BKV-LAMP primers (0.2 μM forward outer primer BKV-F3, 0.2 μM reverse outer primer BKV-B3, 0.8 μM wild-type forward inner primer BKV-WT-BIP, 0.8 μM mutant forward inner primer BKV-MT-BIP, 1.6 μM reverse inner primer BKV-FIP, 0.8 μM forward loop primer BKV-LF, 0.8 μM reverse loop primer BKV-LB), 0.4 μM mutant BKV-CRISPR / Cas12b guide RNA (BKV-MT-sgRNA), 0.4 μM probe ssDNA receptor, 0.2 μM Cas12b protein, 8 Ubst2.0 DNA polymerase, and 1×LAMP. buffer, 8mM Mg 2+ 1.4 mM dNTPs, nuclease-free water, 2 μL of the nucleic acid to be tested, total volume 25 μL. To prepare the detection system, first add the detection components (excluding the nucleic acid to be tested) to the bottom of a 100 μL eight-tube strip, then directly add 2 μL of the nucleic acid to be tested, cap the tube, mix well, briefly centrifuge, and incubate at 60℃ for 40 min in a qPCR instrument. Select the FAM channel and read the fluorescence every 1 min.

[0075] The nucleic acid to be tested in this experiment was the BKV viral plasmid, which was synthesized by Sangon Biotech (Shanghai) Co., Ltd. with the sequence shown below. The BKV gene sequence was then cloned into the pUC57 vector via TA.

[0076] TCCTTTTTGCTAAGTGACCTTATAAACAGGAAACCCAGAGAGTGGATGGGCAGCCTATGTATGGTATGGAATCCCAGGTAGAAGAG GTTAGGGTGTTTGATGGCACAGAAAGACTTCCAGGGGACCCAGATATGATAAGATATATTGACAAACAGGGACAATTGCAAACCAAAATGC TTTAAACAGGTGCTTTTTATT.

[0077] Results interpretation: A fluorescence value <5000 at 40 minutes indicates a negative result, while a fluorescence value >5000 at 40 minutes indicates a positive result. From Figure 5 It can be seen that the detection sensitivity of the one-step LAMP / CRISPR-Cas12b method is 10 copies / μL.

[0078] (2) The traditional one-step LAMP / CRISPR-Cas12b detection system for BKV includes the following components in the reaction system according to the final concentration: BKV-LAMP primers (0.2 μM forward outer primer BKV-F3, 0.2 μM reverse outer primer BKV-B3, 1.6 μM wild-type forward inner primer BKV-WT-BIP, 1.6 μM reverse inner primer BKV-FIP, 0.8 μM forward loop primer BKV-LF, 0.8 μM reverse loop primer BKV-LB), 0.4 μM BKV-CRISPR / Cas12b guide RNA (BKV-WT-sgRNA), 0.4 μM probe ssDNArepoter, 0.2 μM Cas12b protein, 8 μB UBst2.0 DNA polymerase, 1×LAMP buffer, 8 mM Mg 2+ 1.4 mM dNTPs, nuclease-free water, 2 μL of nucleic acid to be tested, total volume 25 μL.

[0079] To prepare the detection system, first add the detection components (excluding the nucleic acid to be tested) to the bottom of a 100μL eight-tube, then directly add 2μL of the nucleic acid to be tested, cap the tube, mix well, centrifuge briefly, and react at 60℃ for 40 min in a qPCR instrument. Select the FAM channel and read the fluorescence every 1 min.

[0080] The nucleic acid to be tested in this experiment is the BKV virus plasmid in (1).

[0081] Results interpretation: A fluorescence value <5000 at 40 minutes indicates a negative result, while a fluorescence value >5000 at 40 minutes indicates a positive result. From Figure 6 It can be seen that the detection sensitivity of the traditional one-step LAMP / CRISPR-Cas12b method is 100 copies / μL.

[0082] (3) The 33-base-length double-stranded DNA that recognizes the mutant BKV-Crispr / Cas12b guide RNA (BKV-MT-sgRNA) is the mutant double-stranded template BKV-MT-dsDNA, and the 33-base-length single-stranded DNA that recognizes the BKV-MT-sgRNA is the mutant single-stranded template BKV-MT-ssDNA. The 33-base-length double-stranded DNA that recognizes the normal BKV-Crispr / Cas12b guide RNA (BKV-WT-sgRNA) is the normal double-stranded template BKV-WT-dsDNA, and the 33-base-length single-stranded DNA that recognizes the BKV-WT-sgRNA is the normal single-stranded template BKV-WT-ssDNA (see Table 1 for the template sequences). The CRISPR reaction system was prepared as follows: 1×Cas12b Buffer, 500nM probe ssDNA receptor, 500nM mutant N-CRISPR / Cas12b guide RNA (N-MT-sgRNA), 250nM BrCas12b, 2μL of test sample, and nuclease-free water to a total volume of 20μL. The template was prepared as follows: nuclease-free water, 10nM BKV-MT-dsDNA, 10nM BKV-MT-ssDNA, 10nM N-BKV-dsDNA, and 10nM BKV-WT-ssDNA. Results were as follows: Figure 7 As shown, at a template concentration of 10 nM, the CRISPR / Cas 12b system mediated by the mutant BKV-CRISPR / Cas 12b guide RNA (N-MT-sgRNA) has virtually no activity against normal templates or against double-stranded and single-stranded products generated during amplification.

[0083] (4) Specificity verification was performed on samples of BKV (BKV), HCMV (human cytomegalovirus), JCV (JC) (JCV), HPV (human papillomavirus), hMPV (human metapneumovirus), MP (Mycoplasma pneumoniae), HBV (hepatitis B virus), and SARS-CoV-2. All nucleic acid samples were obtained from the Department of Laboratory Medicine at Nanfang Hospital and were confirmed by hospital testing to be BKV, HCMV, JCV, HPV, hMPV, MP, HBV, and SARS-CoV-2, respectively. 2 μL of each sample was tested using a one-step reagent based on mutation primers and sgRNA. Fluorescence values ​​were detected using a PCR instrument. The results are shown below. Figure 8 As shown, the one-step method based on mutant primers and sgRNA produces a highly sensitive fluorescent signal for BKV samples, but does not produce a signal for other pathogens.

[0084] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A one-step LAMP / CRISPR-Cas12b detection technique, characterized in that: The components for LAMP nucleic acid amplification and the components for CRISPR-Cas detection are completely mixed in a single tube before the reaction begins; the primers for LAMP nucleic acid amplification consist of normal primers and mutant primers; the sgRNA used for CRISPR-Cas12b detection has the same or complementary sequence as the product amplified by the mutant primers.

2. The one-step LAMP / CRISPR-Cas12b detection technology according to claim 1, characterized in that: The normal primers consist of a normal upstream outer primer, a normal downstream outer primer, a normal upstream inner primer, a normal downstream inner primer, a normal forward loop primer, and a normal reverse loop primer. The mutation primer is at least one of the upstream inner primer and the downstream inner primer. The normal primers and their corresponding mutant primers are in the same relative position in the target nucleic acid sequence; The mutation methods of the aforementioned mutation primers include one or more of the following: inserting at least one base, deleting at least one base, and replacing at least one base; In the normal primers or the mutant primers described herein, a CRISPR-Cas PAM sequence is required at a position 1-18 bases from the 3' end.

3. The application of the one-step LAMP / CRISPR-Cas detection technology as described in claim 1 or 2 in the point-of-care nucleic acid detection for non-diagnostic and therapeutic purposes.

4. The medical application of the one-step LAMP / CRISPR-Cas detection technology as described in claim 1 or 2 in the preparation of microbial nucleic acid point detection kits.

5. The application according to claim 4, characterized in that: The microorganisms include bacteria, fungi, viruses, chlamydia, and mycoplasma.

6. A kit for detecting the novel coronavirus, characterized in that: This includes LAMP components for nucleic acid amplification and components for CRISPR-Cas12b detection; the primers in the LAMP components for nucleic acid amplification are shown below: N-F3: 5'-GGCTTCTACGCAGAAGGGA-3'; N-B3: 5'-CTTAGTGACAGTTTGGCC-3'; N-WT-FIP: 5'-CCTACTGCTGCCTGGAGTTGAAGCCTCTTCTCGTTCCTCAT-3'; N-MT-FIP: 5'-CCTACTGCTGCCTGGAGTTGAAGCCTCTTCTCGTTCTCCTCAT-3'; N-BIP: 5'-GGCAATGGCGGTGATGCTCCAGACATTTTGCTCTCAA-3'; N-LF: 5'-ATTTCTTGAACTGTTGCGACTAC-3'; N-LB: 5'-CTCTTGCTTTTGCTGCTG-3'; The sgRNA used for CRISPR-Cas12b detection is shown below: GAAGGUGGUUAGCUACAGGCUGACCAGUGCAGUUGUGUCAUGCUACGGUGACCUAACACGUCACUCAGUCACAACGGCUAUCUAUAUUU CCACUAACCAAAGUUAGUGGAAAUGUAGAUGGUUAGCACUCGUUCUCCUCAUCACGUAG.

7. The kit for detecting the novel coronavirus according to claim 6, characterized in that... The reagent mixture used in this setting consists of the following components: 0.2 μM forward outer primer N-F3, 0.2 μM reverse outer primer N-B3, 0.8 μM wild-type forward inner primer N-WT-FIP, 0.8 μM mutant forward inner primer N-MT-FIP, 1.6 μM reverse inner primer N-BIP, 0.8 μM forward loop primer N-LF, 0.8 μM reverse loop primer N-LB, 0.4 μM sgRNA, 0.4 μM probe ssDNA receptor, 0.2 μM Cas12b protein, 8 U / 25 μL Bst3.0 DNA polymerase, 1×LAMP buffer, and 8 mM Mg2+. 2+ 1.4 mM dNTPs, with water as the solvent.

8. A kit for detecting polyomavirus, characterized in that... This includes LAMP components for nucleic acid amplification and components for CRISPR-Cas12b detection; the primers in the LAMP components for nucleic acid amplification are shown below: BKV-F3: 5'-TCCTTTTTGCTAAGTGACCT-3'; BKV-B3: 5'-AATAAAAGCACCTGTTTAAAGC-3'; BKV-WT-BIP: 5'-TTGATGGCACAGAAAGACTTCCTTGGTTTGCAATTGTCCTT-3'; BKV-MT-BIP: 5'-TTGATGGCACAGAAAGACTTCCTTGGTTTGGCAATGTGTCCTT-3'; BKV-FIP: 5'-AACCTCTTCTACCTGGGATTCCATATATAAACAGGAGAACCCAGAGA-3'; BKV-LF: 5'-ACATAGGCTGCCCATCCAC-3'; BKV-LB: 5'-AGGGGACCCAGATATGATAAGATAT-3'; The sgRNA in the components used for CRISPR-Cas12b detection is shown below: GAAGGUGGUUAGCUACAGGCUGACCAGUGCAGUUGUGUCAUGUGCUACGGUGACCUAACACGUCACUCAGUCACAACGGCUAUCUAUAUUU CCACUAACCAAAGUUAGUGGAAAUGUAGAUGGUUAGCACCGCAAUGUGUCCUUGUUUGUCAAU.

9. The kit for detecting polyomavirus according to claim 8, characterized in that... The reagent mixture used in this setting consists of the following components: 0.2 μM forward outer primer BKV-F3, 0.2 μM reverse outer primer BKV-B3, 1.6 μM wild-type forward inner primer BKV-WT-BIP, 1.6 μM reverse inner primer BKV-FIP, 0.8 μM forward loop primer BKV-LF, 0.8 μM reverse loop primer BKV-LB, 0.4 μM BKV-WT-sgRNA, 0.4 μM probe ssDNA receptor, 0.2 μM Cas12b protein, 8 U / 25 μL Bst2.0 DNA polymerase, 1×LAMP buffer, and 8 mM Mg2+. 2+ 1.4 mM dNTPs, with water as the solvent.

Images