Use of fam205a in the preparation of a male infertility detection kit
A male infertility detection kit was developed by detecting the expression levels of the FAM205A gene and protein, which solves the problem that existing technologies cannot effectively diagnose idiopathic infertility and provides a diagnostic tool for sperm morphology, motility, and fertilization capacity.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-26
- Publication Date
- 2026-06-02
AI Technical Summary
Existing semen analysis methods cannot effectively capture the key molecular and functional defects behind idiopathic infertility, resulting in patients whose semen parameters appear "normal" due to in-vitro fertilization failure, lacking biomarkers that directly reflect sperm fertilization potential.
Using FAM205A gene and protein expression level detection technology, a male infertility detection kit was prepared by whole-genome sequencing and an antibody that specifically binds to FAM205A protein to detect FAM205A gene abnormalities and protein expression level abnormalities.
FAM205A, as a reliable diagnostic biomarker for idiopathic male infertility, can be demonstrated through integrated proteomics analysis and gene knockout mouse models to maintain structural integrity and regulate the acrosome response during spermatogenesis, providing diagnostic value for sperm morphology, motility, and fertilization capacity.
Smart Images

Figure CN122128420A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical detection technology, specifically involving the application of FAM205A in the preparation of male infertility detection kits. Background Technology
[0002] Male infertility affects approximately 15% of the global male population and accounts for 40-50% of all infertile couples. Currently, clinical diagnosis and treatment of male infertility primarily rely on routine semen analysis, which assesses sperm concentration, motility, and morphology according to World Health Organization (WHO) standards. However, this assessment method has significant limitations: during in-vitro fertilization (IVF), approximately 40% of patients with failed fertilization have "normal" semen parameters, indicating that routine indicators cannot capture the key molecular and functional defects underlying idiopathic infertility. This diagnostic gap highlights the urgent need to find novel biomarkers that directly reflect sperm fertilization potential.
[0003] Sperm biomarkers represent a significant breakthrough in the diagnosis of male infertility, providing valuable information about sperm molecular function, genetic integrity, energy metabolism, and related pathogenic factors, effectively overcoming the limitations of traditional semen analysis methods. They show significant promise in predicting natural fertility potential, assisted reproductive technology outcomes, miscarriage risk assessment, and guiding individualized treatment plans. With ongoing research, standardization of testing technologies, and reductions in testing costs, sperm biomarker-based testing kits and related technologies are expected to play a more central role in the future clinical diagnosis and treatment of male infertility, driving the development of diagnosis and treatment towards precision and personalization.
[0004] Based on this, this application is hereby submitted. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of the prior art and to provide the application of FAM205A in the preparation of a male infertility detection kit.
[0006] This invention provides the following technical solution: This invention provides the application of FAM205A in the preparation of a male infertility detection kit, the application including the detection of FAM205A gene abnormalities and / or abnormal FAM205A protein expression levels.
[0007] Furthermore, the male infertility includes at least one of asthenospermia, oligospermia, and idiopathic male infertility.
[0008] Furthermore, the FAM205A gene abnormality includes at least one of the following abnormalities: mutations in the promoter or enhancer sequence of the gene, or single or multiple base deletions, insertions, or substitutions in the gene coding sequence.
[0009] Furthermore, abnormal FAM205A protein expression levels include at least one of the following abnormalities: decreased protein expression, premature termination or loss of expression, and deletion, insertion or substitution of amino acids in important functional domains of the protein.
[0010] Furthermore, the male infertility detection kit includes a FAM205A gene detection kit and / or a FAM205A protein expression level detection kit.
[0011] Furthermore, the FAM205A gene detection kit includes whole genome sequencing detection reagents.
[0012] The "whole genome sequencing detection reagent" for detecting the FAM205A gene described in this invention is a set of reagents known and commonly used by those skilled in the art for whole genome sequencing. It aims to encompass any commercially available or conventional reagent combination capable of high-throughput sequencing of genomic DNA extracted from human samples to obtain sequence data covering the entire genome.
[0013] Furthermore, the FAM205A protein expression level detection kit includes an antibody that specifically binds to the FAM205A protein.
[0014] This invention also provides the application of an antibody that specifically binds to the FAM205A protein in the preparation of a male infertility detection kit.
[0015] This invention also provides the application of FAM205A as a diagnostic biomarker for idiopathic male infertility.
[0016] The present invention has the following beneficial effects: 1. This invention, through the integration of proteomics analysis, functional verification, and gene knockout mouse models, demonstrates that FAM205A deficiency disrupts sperm morphology, spermatogenesis, motility, and fertilization capacity through a dual mechanism (maintaining structural integrity during spermatogenesis and regulating the acrosome response). FAM205A can serve as a reliable diagnostic biomarker for idiopathic male infertility.
[0017] 2. FAM205A gene abnormalities can be detected through whole-genome sequencing, and abnormal FAM205A protein expression levels can be detected through antibodies that specifically bind to the FAM205A protein. Therefore, a test kit for male infertility can be prepared. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 This is a schematic diagram of sperm sample grouping and experimental route in sperm proteomics of this invention; Figure 2 The iTRAQ proteomics experiment of four groups of sperm samples with different fertilization rates obtained in this invention yielded GO analysis (generated by FunRich software) of proteins with a difference of no less than 1.5-fold. Figure 3 The figure shows a GO analysis (generated by FunRich software) of at least 1.5-fold differential protein expression in the label-free proteomics experiments of the two groups with 100% fertilization failure and fertilization rate obtained in this invention. Figure 4 This is a Venn diagram showing the 157 differentially expressed proteins from the Label-free and i-TRAQ differential proteomics analyses obtained in this invention. Figure 5 This is a GO analysis diagram of 157 IVF fertilization differential proteins obtained in this invention; Figure 6 This is a Western blot verification image of the proteomics results of IVF fertilization failure sperm obtained in this invention. Figure 7 This is a physicochemical and biological information diagram and a genetic phylogenetic tree analysis diagram of the FAM205A protein obtained in this invention; Figure 8 This is an analysis chart of the FAM205A function prediction obtained from the Harmonizome cloud database in this invention; Figure 9 This is a prediction analysis diagram of the transmembrane structure of FAM205A obtained by the TMpred software in this invention. Figure 10 This is a localization map of the expression of FAM205A obtained in this invention in human testes and sperm; Figure 11 This is a graph showing the expression of FAM205A1 obtained in this invention in various mouse tissues; Figure 12 Spatiotemporal expression of FAM205A1 obtained in this invention in mouse testicular tissue after birth; Figure 13 This is a schematic diagram of the knockout mouse strategy of the present invention; Figure 14For the present invention Fam205a1 A schematic diagram of the sgRNA target sites for gene knockout and the locations of primers for genotype identification; Figure 15 This is a PCR electrophoresis image of mouse genotype identification according to the present invention; Figure 16 This is a graph showing the relationship between sperm FAM205A obtained in this invention and asthenospermia; Figure 17 This is a graph showing the effect of the anti-FAM205A antibody obtained in this invention on the acrosome response mediated by A23187. Figure 18 The figure shows the effect of the FAM205A1 antibody obtained in this invention on in vitro fertilization in mice. Figure 19 For the present invention Fam205a1 A diagram showing the experimental results of gene knockout causing male infertility; Figure 20 For the present invention Fam205a1 The image shows the experimental results of gene deletion leading to impaired spermatogenesis in mice, manifested as spermatogenic cell apoptosis, abnormal sperm morphology, and decreased sperm motility. Detailed Implementation
[0020] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0021] This invention provides the application of FAM205A in the preparation of a male infertility detection kit.
[0022] Sperm samples with normal routine parameters but complete IVF (in vitro fertilization) failure were collected, and proteomic analysis of the failed sperm was performed using both i-TRAQ and label-free assays.
[0023] (1) Subjects: Both spouses signed informed consent, and with the discussion and permission of the ethics committee, clinical data statistics and subsequent sperm proteomics studies were carried out.
[0024] ① The women enrolled should be no older than 30 years old, have an egg maturity rate of no less than 80%, have at least 4 MII eggs, have normal appearance, normal endocrine levels, and negative antisperm antibodies. Special cases such as ovulation disorders and ovarian dysfunction should be excluded, and factors related to egg quality should be avoided as much as possible in fertilization failure.
[0025] ② The male partner's semen analysis is normal (all parameters are not lower than the lower limit of the normal reference value set by the WHO guidelines), semen volume ≥1.5mL, liquefaction time ≤60min, and total sperm count ≥39x10⁻¹⁰. 6 Sperm concentration ≥15x10 6 / ml, total sperm motility (PR+NP) ≥40%, progressive motility PR ≥32%, viability ≥58%, normal sperm morphology ≥4%; (2) Sperm sample grouping and experimental route: i-TRAQ sperm proteomics grouping: Based on the fertilization status of IVF patients, cases were divided into four groups: ① High fertilization rate (HFR): fertilization rate > 60%; ② Normal fertilization rate (NFR): 30% ≤ fertilization rate ≤ 60%; ③ Fertilization failure rate (FFR): 0 < fertilization rate < 30%; ④ Total fertilization failure (TFF) (fertilization rate = 0). Label-free sperm proteomics grouping: Compared with iTRAQ analysis, this phase of the experiment only set up two groups for comparison. Group 1: 12 samples from the high fertilization rate group, with a conventional IVF fertilization rate of 100%; Group 2: 12 samples from conventional IVF complete failure (fertilization rate = 0), but with a normal fertilization rate after salvage ICSI. All samples met the prerequisite of "normal" sperm and egg (see Figure 1 ), Figure 1 Medium, IVF: in vitro In vitro fertilization; ICSI: intracytoplasmic sperm injection; FR: fertilization rate; RICSI: rescue intracytoplasmic sperm injection; DEPs: differentially expressed proteins; iTRAQ: isobaric tags for relative and absolute quantitation.
[0026] (3) Methods: The iTRAQ proteomics assay was performed at the Beijing Proteomics Center, with the following main instruments and equipment: Triple TOF 5600 mass spectrometer (AB Sciex), high performance liquid chromatography L-3000 (Rigol), and a 5μm, 4.6x250mm column (Agela); The label-free proteomics assay was performed at the Beijing Proteomics Center, with the following main instruments and equipment: column: ReproSil-Pur C18-AQ, 1.9μm, 120A°, Thermo EASY-nLC liquid chromatography, and Thermo Obitrap Fusion mass spectrometer.
[0027] (4) LC-MS identification of protein sequence; (5) Data search: Thermo Proteome Discoverer (version: 1.4) search engine, the database is the Mascot library, which contains the sequence information of this protein, with a first-order error of 20 ppm and a second-order error of 50 mmu. Variable modifications are as follows: Acetyl (Protein N-term), Oxidation (M); fixed modifications are as follows: Carbamidomethyl (C); Typsin whole digestion, the digested fragment is allowed to have a maximum of 2 missed cleavage sites; (6) Differential protein identification: ① i-TRAQ: After parameter optimization, iTRAQ relative quantification identified a total of 2605 human sperm proteins. The samples were divided into four groups based on fertilization rate: Group 1 was the complete fertilization failure group (fertilization rate = 0%), Group 2 was the fertilization failure group (0 < fertilization rate < 30%), Group 3 was the normal fertilization rate group (30% ≤ fertilization rate ≤ 60%), and Group 4 was the high fertilization rate group (fertilization rate > 60%). A total of 694 differentially expressed proteins were screened from the four groups (a detailed list of proteins and related information are not shown), and enrichment analysis was performed using FunRich software (see [link to relevant documentation]). Figure 2 ② Label-free: When searching the database without specifying unique peptides, a total of 3580 protein groups were identified; when unique peptides were greater than or equal to 1, a total of 3195 protein groups were identified. Among them, the two groups with different fertilization rates (i.e., the group with complete fertilization failure and the group with a fertilization rate of 100%) had a total of 1036 differentially expressed proteins with a fold difference of at least 1.5; the two groups had a total of 278 differentially expressed proteins with a fold difference of at least 5 (the complete list of identified proteins and the list of quantified differentially expressed proteins, as well as specific related information, are not listed), and enrichment analysis was performed using FunRich software (see [link to FunRich software]). Figure 3 ); (7) Bioinformatics analysis: 157 common differentially expressed proteins were identified using i-TRAQ and label-free proteomics technologies (see [link]). Figure 4 ), and performed GO analysis on 157 differentially expressed proteins (see Figure 5 ).
[0028] Experimental results revealed that most protein components were located primarily in the sperm tail and acrosome, suggesting that these two regions are key components involved in the fertilization process. We focused on analyzing differentially expressed acrosome-related proteins and found that the expression of the acrosome protein FAM205A was reduced in the fertilization failure group. Therefore, this invention analyzes the acrosome gene FAM205A to investigate the diagnostic value of the sperm-testis-specific protein FAM205A for male infertility.
[0029] The reagents used in the following examples: antibodies against FAM205A (#HPA071267, Bromma, Sweden), EFCAB1 (#HPA023527, Bromma, Sweden), C7orf61 (#HPA060395, Bromma, Sweden), IQCD (#HPA046810, Bromma, Sweden), LRC 37a (#HPA 042121, Bromma, Sweden), and TMCO5A (#HPA056530, Bromma, Sweden) were all purchased from Atlas Antibody. Anti-β-tubulin mouse monoclonal antibody (#ab6046, Cambridge, UK), hematoxylin-eosin staining kit (#ab245880, Cambridge, UK), and periodate Schiff (PAS) staining kit (#ab150680, Cambridge, UK) were all purchased from Abcam. The rabbit anti-FAM205A1 polyclonal antibody was custom-made by Youke Biotechnology (Shanghai) Co., Ltd., China. Anti-α-tubulin and anti-GAPDH mouse monoclonal antibodies (#T9026 and #G9545, St. Louis, USA) were from Sigma. Secondary antibodies Alexa Fluor 594 or horseradish peroxidase (HRP)-conjugated anti-mouse and anti-rabbit antibodies were purchased from Invitrogen. Normal rabbit IgG (#2729S, Danvers, USA) was purchased from CST. Reverse transcription polymerase chain reaction (RT-PCR) and real-time PCR reagents were purchased from Roche. (PSA-FITC) (#L077, St. Louis, USA) and A23187 (#C9275, St. Louis, USA) were both from Sigma. IVF assay medium was from Vitrolife (Gothenburg, Sweden). The one-step TUNEL in situ apoptosis kit (#E-CK-A321, Wuhan, China) was purchased from Elabscience.
[0030] Example 1: Validation of proteomics results: (1) According to the inclusion criteria of the study subjects, the above-mentioned IVF semen specimens frozen in liquid ammonia tank were placed in a 37°C constant temperature water bath for 30 minutes, and the medical record number and sample number of each thawed sample were recorded. (2) Add the thawed and revived semen sample from step 1 to 70% monolayer Spermgrad solution (Vitrolife) and centrifuge at 300g for 20 minutes in an Eppendorf centrifuge. (3) After step 2 is completed, discard the supernatant and wash the precipitate left in the 15 mL centrifuge tube three times with 1 x F10 medium. Perform routine semen analysis and counting on the pre-washed sperm specimens, following the standards of the 5th edition of the Semen Processing Manual. (4) After washing, the semen was diluted at a concentration of 1.25 x 10. 6 Sperm proteins were extracted by adding 20 μL of RIPA protein lysis buffer (containing 1 x Protease Inhibitor Cocktail and 1 mM PMSF) to sperm cells, and the protein concentration was measured. (5) Prepare SDS-PAGE gel, load the sperm protein sample mentioned in step 4, and after electrophoresis, transfer, washing, blocking, incubation with primary antibody (incubate anti-FAM205A antibody or anti-β-tubulin antibody on PVDF membrane and incubate overnight at 4°C) and secondary antibody, add ECL substrate, expose to the Bio-Rad gel imaging system for 30 seconds to 30 minutes and take pictures; (6) The expression level of FAM205A protein was analyzed by grayscale using the software provided with the Bio-Rad gel imaging system and standardized by the value of β-tubulin.
[0031] The experimental results showed that, see Figure 6 FAM205A protein was expressed at low levels in sperm from patients with failed fertilization. The expression rate of FAM205A protein was correlated with in vitro fertilization rate. (A) Western blot electrophoresis images of FAM205A protein in sperm with different IVF fertilization rates; (B) Gray-scale analysis (mean ± SE) (n=8, P <0.01 compared to the complete fertilization failure group); 1 represents: sperm specimens from IVF patients in the complete fertilization failure group, fertilization rate = 0; 2 represents: sperm specimens from IVF patients in the fertilization failure group, 0% < fertilization rate < 30%; 3 represents: sperm specimens from IVF patients in the normal fertilization group, 30% ≤ fertilization rate ≤ 60%, with a previous healthy child born; 4 represents: sperm specimens from IVF patients in the high fertilization group, fertilization rate > 60%, with a previous healthy child born.
[0032] Example 2: Bioinformatics Analysis: (1) Prediction of FAM205A protein domains, physicochemical properties and phylogenetic analysis: The domains of FAM205A protein were predicted using SMART software. The results showed that FAM205A protein contains one DUF4599 domain, two FAM75 domains and several predicted phosphorylation sites (see [link to SMART software]). Figure 7 A). Physicochemical properties were predicted using the ExPASy ProtParam tool. The results showed that the FAM205A protein consists of 1335 amino acids, has a molecular weight of 148095.98, and an isoelectric point of 8.62 (see [link to relevant documentation]). Figure 7 A). The function of FAM205A in vertebrates has not yet been reported. We performed a phylogenetic analysis to find useful functional information in other homologous species. Interestingly, except for spotted hyenas (Crocuta crocuta), the amino acid sequence of FAM205A is highly conserved among humans, mice, and rats, and human FAM205A and mouse FAM205A1 are highly homologous (see A). Figure 7 B); Figure 7 This section presents a phylogenetic conservation and bioinformatics analysis of the amino acids in FAM205A. Figure A represents a schematic diagram of the characteristic structural domains and physicochemical properties of human (Homo sapiens) FAM205A, where aa represents amino acid; MW represents molecular weight; and pI represents isoelectric point. Figure B represents a phylogenetic tree of the FAM205A protein constructed using the maximum likelihood method.
[0033] (2) Predicting the function of FAM205A protein based on cloud database: The Harmonizome cloud database was queried, and the "Predicted Functions" online tool under the database was used to predict the function of the FAM205A gene. The prediction results showed that the FAM205A protein is mainly involved in biological processes such as acrosome reaction, sperm motility, sperm-egg fusion, and sperm capacitation (see Figure 8 ); (3) FAM205A is a membrane protein: Before performing antibody blocking experiments, it is necessary to determine whether FAM205A is a membrane protein. Therefore, the TMpred software was used to predict the transmembrane structural regions of the protein online. The prediction results showed that the FAM205A protein has a possible transmembrane region from the inside to the outside within 13-31 aa. The transmembrane region from the outside to the inside is 782-806 aa, with a prediction score of 2085 (positive: score >500), suggesting that FAM205A may be a membrane protein (see [link to relevant documentation]). Figure 9 This prediction was confirmed on the Human Protein Atlas website, where the protein is located in the cell membrane and is a component of the membrane.
[0034] Example 3: Expression localization of FAM205A in human testes and sperm: (1) In this invention, the human testicular tissue we collected came from patients who underwent open testicular biopsy and prostate castration at our hospital, while the human semen samples came from the reproductive center outpatient clinic. (2) The collected testes and pre-washed sperm (sperm pre-washing refers to Example 1) specimens were divided into two parts. One part was added to RIPA protein lysis buffer for western blot study, and the other part was added to 4% polymethanol for immunolocalization study. (3) The obtained protein was loaded at a rate of 20 μl protein / well. After electrophoresis, semi-dry electrophoresis transfer was performed at 30 mA / 100 min. The transfer membrane was blocked with blocking buffer and incubated overnight at 4 °C. The next day, it was washed three times with 1×TBST for 15 min each time. The diluted primary antibody (1:500) was added and incubated at 37 °C for 2 h. The membrane was washed four times with 1×TBST for 10 min each time. The diluted secondary antibody (1:2000) was added and incubated at 37 °C for 2 h. The membrane was washed four times with 1×TBST for 10 min each time. Chemiluminescence detection was performed using super-strong glue and super-sensitive luminescent solution, and the X-ray film was exposed. After development and fixing, the dried film was photographed using a gel imaging analysis system and analyzed using ImageLab software. (4) Perform luminance analysis on the strip plots obtained from the above operations and standardize them using the value of β-tubulin; (5) Immunohistochemical staining was performed on the polymethyl alcohol-fixed testicular tissue (FAM205A primary antibody concentration was 1:100); cell immunofluorescence studies were performed on the polymethyl alcohol-fixed sperm specimens (FAM205A primary antibody concentration was 1:100). Experimental results showed that the FAM205A protein was expressed in human testes and human sperm, mainly in round and elongated sperm cells of the human testes, and located in the acrosome region of mature human sperm (see [link to study]). Figure 10 ), Figure 10 In the diagram, A: Western blot analysis of FAM205A protein expression in human testes and sperm; B: Immunohistochemistry analysis of FAM205A protein expression in human testicular seminiferous tubules; C: Immunofluorescence analysis of FAM205A protein expression localization in human sperm.
[0035] Example 4: Expression of mouse-derived FAM205A1 in different mouse tissues: The mouse-derived Fam205a1 gene and the human FAM205A gene are highly homologous (see [link]). Figure 7 B).
[0036] (1) Heart, liver, spleen, lung, kidney, muscle, thymus, and testis tissues were obtained from 8-week-old male mice, while ovary and uterus tissues were obtained from 8-week-old female mice. A cryptorchidism model was also created to obtain cryptorchidism tissue from 8-week-old male mice. Tissues used for RNA extraction were dissolved in RNAiso PLUS (TaKaRa, 9108); tissues used for protein extraction were dissolved in T-PER tissue protein extraction solution (Thermo, 78510); and tissues used for paraffin section preparation were fixed in Bouin's (for HE staining) or 4% PFA (for immunohistochemistry and immunofluorescence) fixative. (2) The obtained testicular tissue protein was detected by Western blot, and the obtained testicular paraffin sections were detected by immunohistochemistry. Both detections were performed according to Example 3 to detect the spatiotemporal expression of FAM205A1 protein in different mouse tissues. (3) RT-PCR detection of the obtained testicular mRNA was performed. The simplified procedure was as follows: Total RNA was extracted using Trizol, and the RNA was reverse transcribed into cDNA using a Roche kit. Then, using the cDNA as a template, specific primers and PCR premix were added for amplification. Finally, the results were... Gapdh As an internal control, the expression of the target gene was analyzed by gel electrophoresis. Fam205a1 The primers are: forward primer 5'->3' ACCATGTTTAGGGTGGTTCCT, reverse primer 5'->3' AGGACCTGCTCTCCATTTTCC; Gapdh The primers are: forward primer 5'->3'GGTTGTCTCCTGCGACTTCA, reverse primer 5'->3'TGGTCCAGGGTTTCTTACTCC.
[0037] The experimental results showed that, Fam205a1 The specific expression of mRNA and protein in the testes is consistent with our previous mouse gene expression profiling chip analysis data (see [link]). Figure 11 ), Figure 11 In the table, A: RT-PCR, B: Western blot, and C: Immunohistochemistry were used to detect the expression of FAM205A1 protein in different tissues (heart, liver, spleen, lung, kidney, muscle, thymus, testis, and ovary).
[0038] Example 5: Spatiotemporal expression of FAM205A1 in postnatal mouse testicular tissue: (1) Testicular tissues were collected from mice at 1, 7, 14, 18, 21, 28, 35, 42, 49, and 60 days after birth. Tissues used for RNA extraction were dissolved in RNAiso PLUS (TaKaRa, 9108); tissues used for paraffin section preparation were fixed in Bouin's (for HE staining) or 4% PFA fixative (for immunohistochemistry and immunofluorescence). (2) Real-time PCR was performed on the obtained testicular tissue RNA. The simplified procedure was as follows: Total RNA was extracted using Trizol, and the RNA was reverse transcribed into cDNA using a Roche kit. Real-time PCR was performed using the SYBR Green dye method. Gapdh As an internal reference, it can be used for relative quantification by comparing Ct values. Fam205a1 The primers are: forward primer 5'->3' CAGTCTAGGACTCTGCTTGGC, reverse primer 5'->3' GGCTGTGTGCATAGCTCAATA; Gapdh The primers are: forward primer 5'->3'GGTTGTCTCCTGCGACTTCA, reverse primer 5'->3' TGGTCCAGGGTTTCTTACTCC.
[0039] (3) Immunohistochemical detection was performed on the paraffin sections of the testes to detect the spatiotemporal expression of FAM205A1 protein in the testes of mice at different days after birth.
[0040] The experimental results showed that mice Fam205a1 The mRNA was expressed in the testicular tissue of mice from day 1 to day 60 postnatal days, with high expression starting from day 18 (see Figure 12A). However, the FAM205A1 protein first appeared in the mouse testes at day 18 postnatal days, localizing in round spermatids. From day 21 postnatal days, it was expressed in both round and elongated spermatids (see Figure 12A). Figure 12 B) It is speculated that FAM205A1 may be related to sperm deformity.
[0041] Figure 12 In the middle, A: Real-time PCR detection Fam205a1 A: Expression of mRNA in testicular tissues of mice at different ages after birth; B: Immunohistochemical detection of FAM205A1 protein expression and localization in testicular tissues of adult mice at different ages.
[0042] Example 6: FAM205A is associated with asthenospermia By searching the GEO (Gene Expression Omnibus) database of NCBI (National Center for Biotechnology Information), we obtained a microarray (GSE22331) related to sperm function (http: / / www.ncbi.nlm.nih.gov / gds / ). Using the R language platform, we performed bioinformatics analysis on the microarray data. The results showed that FAM205A is associated with asthenospermia and is expressed at low levels in asthenospermia sperm. Figure 16 A; B).
[0043] To validate the results of the microarray, we collected sperm samples from patients at the Reproductive Medicine Center of Tongji Medical College, Huazhong University of Science and Technology, as well as sperm samples from donors who had successfully conceived through AID sperm bank. Based on differences in forward sperm motility, these samples were divided into four groups: normal, mild, moderate, and severe asthenospermia. Eight donor sperm samples from each group were pooled together, and proteins were extracted and subjected to Western blotting. The results showed that the expression level of FAM205A protein gradually decreased in sperm samples from patients with mild, moderate, and severe asthenospermia. Figure 16 C), showing a statistically significant difference compared to the normal group. Gray-scale analysis of the protein blot confirmed this statistical difference. Figure 16 D), Figure 16 In the image, A: The heatmap shows that FAM205A and SPATA31 are downregulated in the RNA of sperm in patients with asthenospermia; B: Bioinformatics analysis of the microarray data using the R language platform reveals that FAM205A is associated with asthenospermia. P <0.01; C: Shows representative results of Western blot analysis of FAM205A protein from sperm of patients with different progressive motility rates; D: Shows the mean ± standard error density measurements of Western blot analysis of FAM205A protein from sperm of patients with different progressive motility rates (n = 8). , P <0.05; , P <0.01 (compared to lane 1). Lane 1: Fertility men with normal forward motility (forward motility ≥32%); Lane 2: Patients with mild asthenospermia (20%≤forward motility <32%); Lane 3: Patients with moderate asthenospermia (10%≤forward motility <20%); Lane 4: Patients with severe asthenospermia (forward motility <10%).
[0044] Example 7: Effect of FAM205A antibody on inducing acrosome response: (1) In this invention, the human semen samples we collect are from the sperm samples of patients who visit the outpatient clinic of our hospital. The collection of semen samples is strictly carried out in accordance with the standards and procedures of the World Health Organization's fifth edition of the Semen Processing Manual.
[0045] (2) Evaluation of the acrosome reaction induced by A23187 mediated by anti-FAM205A antibody: The simplified procedure was as follows: Human sperm were separated using a double-layer Spermgrad gradient solution and washed with G-IVF medium. Uncapacitated sperm were resuspended in G-IVF medium, while capacitated sperm were resuspended in G-IVF PLUS medium. Both media contained anti-FAM205A antibody (25–100 μg / ml) or control antibody (25–100 μg / ml of normal rabbit serum) or antibody solvent alone. The samples were divided into two equal parts. One part was treated with calcium ion carrier A23187 as the acrosome reaction induced group, while the other part was treated without any treatment as the spontaneous acrosome reaction group. The sperm samples were then incubated at 37°C, 5% CO2, and 95% air for 30 min.
[0046] (3) Finally, the sperm were smeared, air-dried, fixed with 4% paraformaldehyde for 30 min, and washed 2-3 times with PBS. They were then stored at 4 degrees Celsius for subsequent acrosome reaction evaluation. Sperm viability and acrosome status were evaluated using the liveness staining Hoechst 33342 (Sigma) and PSA-FITC (Sigma), respectively. At least 200 sperm were counted on each sperm smear.
[0047] The experimental results showed that anti-FAM205A antibody (25-100 μg / mL) significantly affected the A23187-induced acrosome response in a dose-dependent manner. The inhibitory effect on the A23187-induced acrosome response was greatest at an anti-FAM205A antibody concentration of 50 μg / mL, reducing the A23187-induced acrosome response rate to 13.0 ± 0.9%. However, it had no effect on the normal spontaneous acrosome response of human sperm compared to the normal rabbit IgG group, the vector control group (G-IVF PLUS medium), and the non-capacitation group (see [link to relevant documentation]). Figure 17 ), Figure 17In the figures, A: Representative images of the cohort treated with DAPI or PSA-FITC (n=6), white arrows: sperm that underwent an acrosome reaction; pink arrows: sperm with intact acrosomes (not reacting), scale bar = 10 μm; B: Capacitated human sperm stimulated with or without 10 μM A23187 for 30 min, and tested with or without anti-FAM205A antibody (25–100 μg / mL) or normal rabbit IgG (50 μg / mL). Non-capacitating medium (without bovine serum albumin and NaHCO3); spontaneous acrosome reaction, referring to acrosome reactions occurring spontaneously in the absence of A23187, data are the mean ± standard error of six experiments. P <0.05, P<0.01 (compared to the antibody-free treatment group).
[0048] Example 8: Effect of FAM205A1 antibody on mouse in vitro fertilization: (1) To gain a deeper understanding of the function of FAM205A1, female adult mice (8 weeks old) were first injected with one unit of PMSG (pregnant mare serum gonadotropin, PMSG; pregnant mare serum gonadotropin) and 5 units of hCG (human chorionic gonadotropin, hCG; human chorionic gonadotropin), with an interval of 48 hours between the two hormone injections (both hormones were purchased from Ningbo Second Hormone Factory). 14 hours after hCG injection, MII oocytes were collected from the ampulla of the oviduct of the mice and quickly placed in 90 μL G-IVF PLUS culture drops, then placed in a 37°C, 5% CO2, 95% air carbon dioxide incubator for equilibration.
[0049] (2) Sperm were collected from the shredded epididymal tail and vas deferens tissue of 8-week-old C57BL / 6J mice using the upstream method. The collected sperm were resuspended in G-IVF PLUS medium to achieve a final sperm concentration of 2 x 10⁻⁶. 6 The cells were cultured in mL⁻¹ and capacitated for 2 h in a carbon dioxide incubator at 37°C, 5% CO₂, and 95% air. Then, they were incubated for another 30 min in G-IVF PLUS medium containing placebo (PBS), anti-FAM205A1 antibody, or normal rabbit IgG. Next, 10 μL of the treated sperm (sperm concentration of 2 x 10⁻¹) was added to a 90 μL G-IVF PLUS oocyte culture drop. 4 mL -1 At this point, the sperm concentration is 2 x 10⁻⁶. 3 mL -1The eggs were incubated at 37°C, 5% CO2, and 95% atmospheric humidity for 6 hours. The standard for successful fertilization is the appearance of the two-cell stage 24 hours after fertilization.
[0050] (3) The experimental results showed that the anti-FAM205A1 antibody significantly improved in vitro fertilization compared to the placebo group (PBS) and the normal rabbit IgG group. The fertilization rates in the placebo group and the normal rabbit IgG group were 81.8% and 82.0%, respectively, while the fertilization rate in the anti-FAM205A1 antibody group was 30.0% ( Figure 18 This result suggests that FAM205A1 may play an important role in mouse sperm fertilization.
[0051] Figure 18 A: Representative images (n=6) showing the inhibitory effect of anti-FAM205A1 IgG on in vitro fertilization (IVF) rates. Scale bar = 10 micrometers. (a) Ampulla of fallopian tube; (b) Oocyte-cumulus complex; (c) Epididymal tail sperm; (df) Representative images of cohorts treated with phosphate-buffered saline (PBS), anti-FAM205A antibody, or normal control IgG antibody (n=6); B: Mean and standard deviation of six independent experiments were used to plot IVF rates. At least 100 to 150 oocytes were used in each experiment, and results were analyzed independently by two researchers, indicating a significant difference compared to the 24-hour PBS control group. P <0.01).
[0052] Example 9: Fam205a1 Construction and Phenotypic Analysis of Gene Knockout Mouse Models – Confirmation Fam205a1 The absence of this substance leads to male infertility. (1) Fam205a1 Construction of gene knockout mouse model based on Fam205a1 This invention utilizes CRISPR / Cas9 technology to construct a systematic gene knockout mouse model based on the specific expression of genes in mouse testicular tissue. The gene knockout strategy provided by Cyagen Biosciences (…) Figure 13 , Figure 19 a) A specific guide RNA targeting exons 1-4 of the Fam205a1 gene was designed using the CRISPR design tool CRISPOR. After obtaining F2 generation mice through breeding, phenotypic analysis was performed on 8-week-old wild-type, heterozygous, and homozygous knockout male mice.
[0053] See Figure 13A strategy was employed to construct Fam205a1 KO mice using CRISPR / Cas9 technology. Deletion of the KO region resulted in a frameshift mutation in the Fam205a1 gene. The KO region represents the knockout area, and the arrows indicate sgRNA cleavage sites. E1–4 represent exons 1–4 of the mouse Fam205a1 gene, respectively. Solid black boxes represent coding regions, and hollow boxes represent non-coding regions. DUF4599 and FAM75 are the structural domains of the mouse Fam205a1 protein.
[0054] 1. Target design: Based on mice Fam205a1 Gene sequence (Gene ID: 433698; from the gene module of the NCBI database) was used to design sgRNAs targeting exons 1-4 using the CRISPR design tool CRISPOR.
[0055] sgRNA target sequence: sgRNA-A1: GATTAACTGCCCTCCAAGGGTGG (located before exon 1 of the target gene); sgRNA-A2: TCTTCTGAGAAGTCAGTAGTTGG (located after exon 4 of the target gene); sgRNA-B1: TGTTTCATAAAAGTACAGTTGGG (located before exon 1 of the target gene); sgRNA-B2: TCTTCTGAGAAGTCAGTAGTTGG (located after exon 4 of the target gene); See the diagram showing the knockout sites for sgRNA knockout. Figure 14 .
[0056] Note that sgRNA-A2 and sgRNA-B2 have the same sequence, while sgRNA-A1 and sgRNA-B1 have different sequences.
[0057] 2. Microinjection: Cas9 mRNA is mixed with four sgRNAs, where sgRNA-A1 and sgRNA-A2 are paired to knock out the target gene. Fam205a1 Exons 1-4 were targeted, and sgRNA-B1 and sgRNA-B2 were paired to knock out this region. The mixture was then microinjected into the cytoplasm of C57BL / 6N mouse zygotes to obtain... Fam205a1 A mouse model with systemic gene knockout.
[0058] 3. Mouse breeding: The injected fertilized eggs were transferred into pseudopregnant female mice. The offspring were F0 generation. DNA was extracted from the mouse tails for PCR identification.
[0059] See the schematic diagram of the primer design sites for identification. Figure 14 The identification primers are as follows: First pair of primers for genotyping: Forward primer (F1): 5'-GATCAACCGATTGAAGAGCAGTCA-3' Reverse primer (R1): 5'-GAGGTCGAGGCCAGAACTTACTGTC-3' Genotype identification second pair of primers Forward primer (F1): 5'-GATCAACCGATTGAAGAGCAGTCA-3' Reverse primer (R2): 5'-CTCACTTACTCCTTCCTCTTGGTC-3' PCR program: 94℃ for 3 min; (94℃ for 30 s, 60℃ for 35 s, 72℃ for 35 s) × 35 cycles; 72℃ for 5 min.
[0060] See Figure 15 This is a PCR electrophoresis image of mice for genotyping, showing homozygous Fam205a1 mice (Fam205a1). - / - ): Band size is 367bp; Fam205a1 heterozygous mouse (Fam205a1 + / - There are two bands, with sizes of 367bp and 690bp respectively; wild-type mouse: band size is 690bp; wild-type mouse (Fam205a1) + / + The band size was 690 bp; blank control: water; marker: molecular weight standard for protein blot.
[0061] Results: The wild-type (WT) amplification product was 690 bp, while the knockout (KO) amplification product was approximately 367 bp due to fragment deletion.
[0062] 4. Model establishment: Positive F0 generation mice were mated with wild-type mice to obtain F1 generation heterozygotes (Fam205a1). + / - Heterozygous male mice from the F1 generation were interbred with female mice to obtain homozygous F2 generation mice (Fam205a1). - / - (mice). Western blot validation confirmed Fam205a1 - / - The FAM205A1 protein was completely absent in mouse testicular tissue.
[0063] (2) Gene knockout verification and basic phenotype analysis Gross anatomical observation showed no significant differences in the morphology and weight of the reproductive organs (testes and epididymis) among wild-type, heterozygous, and homozygous knockout mice. Figure 19 b, 17c). Genotyping revealed a clear distinguishing pattern: wild-type mice showed only a 690 bp band, heterozygous mice showed both 690 bp and 367 bp bands, and homozygous knockout mice showed only a 367 bp band. Figure 19 d). Further immunoblotting analysis of testicular tissue detected a specific band of approximately 35 kDa corresponding to the Fam205a1 protein, which was present in wild-type mice but completely absent in knockout mice, confirming the success of the gene knockout at the protein level. Figure 19 e).
[0064] (3) Reproductive function assessment Fertility tests showed that the average litter size of homozygous knockout male mice (2.60 ± 0.40 pups, n=8) was significantly smaller than that of the wild-type control group (7.90 ± 0.80 pups, n=8). Figure 19 f). In vitro fertilization experiments further confirmed the reproductive dysfunction in knockout mice: compared with the wild-type control group, the rate of double pronucleus formation in fertilized eggs and the rate of 2-cell embryo development in knockout mice were significantly reduced (34.2% vs. 67.3%). Figure 19 g, 17h).
[0065] (4) Histological and sperm morphology analysis Histopathological H&E staining showed that the epididymal duct of wild-type and heterozygous mice was filled with morphologically normal sperm, while knockout mice exhibited a phenotype of oligospermia or even azoospermia. Figure 19 i). Sperm morphological analysis using Diff-Quik staining revealed a significant increase in the proportion of abnormal sperm heads in the knockout group, in stark contrast to the normal morphology observed in wild-type sperm. Figure 19 j).
[0066] Figure 19 In the image, (a) is a schematic diagram of the Fam205a1 gene knockout strategy in mice; (b) is an adult Fam205a1 gene. + / + Fam205a1 + / − and Fam205a1 − / − Comparison of the size and morphology of mouse testes and epididymis; (c) Adult Fam205a1 + / + Fam205a1 + / − and Fam205a1 − / − Mouse body weight, testicular and epididymal weight parameters; (d) PCR analysis of Fam205a1 + / +Fam205a1 + / − and Fam205a1 − / − Genotyping of mice was performed, with lane 4 (water) serving as a negative control. Lanes 1-3: mouse samples; water: blank control; M: marker (DNA molecular weight standard); (e) for Fam205a1 − / − With Fam205a1 + / + Western blot analysis of FAM205A1 expression in mouse testicular samples; (f) Wild-type females and wild-type males or knockout males (Fam205a1) − / − (g) Average litter size after mating; (g) Wild-type female mice and Fam205a1 + / + Or Fam205a1 − / − Analysis of second polar body and 2-cell rates in male rats undergoing in vitro fertilization (IVF). 2PB: second polar body; (h) wild-type female rats and Fam205a1 − / − Or Fam205a1 + / + Representative images of 2-cell stage embryos obtained from in vitro fertilization of male rats; (i) Comparison of hematoxylin-eosin (H&E) staining of Fam205a1 + / + Fam205a1 + / − and Fam205a1 − / − Morphology of the epididymal tail in male mice. Black arrows indicate the presence of azoospermia or oligospermia in the epididymal lumen. Oligo: oligospermia; Null: azoospermia. Scale bar = 50 μm; (j) Fam205a1 + / + With Fam205a1 − / − Diff-Quik staining analysis of sperm morphology in the epididymal tail of male mice. Black arrows: abnormal sperm; scale bar = 25 μm.
[0067] (5) Conclusion The above results demonstrate that systematic knockout Fam205a1 The gene causes severe male infertility in mice, with phenotypic features including impaired spermatogenesis and abnormal sperm morphology. This reveals... Fam205a1 The gene plays a crucial role in regulating male reproductive function. The phenotype exhibited by this gene knockout model provides direct animal experimental evidence for the causal relationship between FAM205A gene loss of function and male infertility.
[0068] Example 10: Fam205a1 Phenotypic analysis of testicular spermatogenic cell apoptosis, abnormal sperm morphology, and decreased sperm motility in defective male mice Established in Example 9 Fam205a1Based on the gene knockout mouse model, we further analyzed its testicular histopathology, sperm ultrastructure and functional defects to elucidate the cellular and molecular mechanisms by which FAM205A1 deficiency leads to male infertility.
[0069] (1) Analysis of testicular spermatogenic epithelial cycle and late-stage spermatogenesis defects Analysis of the spermatogenic epithelial cycle by PAS staining of testicular tissue revealed that knockout mice exhibited unique morphological abnormalities at specific stages: (1) In seminiferous tubules of stages II-III, V, and VI, disordered arrangement and tissue abnormalities of round sperm cells were observed in knockout mice; (2) In seminiferous tubules of stages IX-XII, the elongated sperm cells of knockout mice showed abnormal morphology and elongation. Figure 20 a). These results indicate that FAM205A1 plays a key regulatory role in the late stage of spermatogenesis, i.e., during sperm formation.
[0070] (2) Detection of apoptosis in testicular spermatogenic cells Testicular tissue was analyzed using TUNEL assay. Results showed that in the wild-type control group, spermatogenic cells had normal morphology and no significant apoptotic signals were detected; however, in the testes of knockout mice, significant apoptotic signals were specifically observed at the elongated spermatocyte stage. Figure 20 b). This confirms that the absence of FAM205A1 leads to programmed cell death of spermatogenic cells at a specific stage of spermatogenesis (spermatogenesis).
[0071] (3) Sperm ultrastructure analysis Epididymal sperm were observed using transmission electron microscopy (TEM) and scanning electron microscopy (SEM). Compared with the regular head and tail structure of wild-type sperm, the sperm head morphology of knockout mice showed obvious abnormalities, including ultrastructural defects such as head malformation and irregular outline. Figure 20 c).
[0072] (4) Sperm structure immunofluorescence colocalization and functional analysis To further clarify the localization of structural defects, immunofluorescence co-staining was employed, using an acrosome marker PSA-FITC and a flagellar marker α-tubulin antibody to stain sperm. The results confirmed that the sperm of knockout mice exhibited structural defects in both the acrosome region and the flagellar (tail), manifested as abnormal fluorescence signals or disordered localization. Figure 20 d).
[0073] Computer-aided semen analysis of epididymal tail sperm showed that the forward motility of the knockout mouse sperm (20.7%) was sharply and significantly lower than that of the wild-type control group (90.1%). Figure 20e). To verify the reliability of this phenotype, we expanded the breeding population of knockout mice and performed genotyping on the offspring, with stable and reproducible results. Figure 20 f).
[0074] (5) Comprehensive assessment of testicular histopathology Comprehensive histopathological analysis further revealed that the abnormalities in spermatogenic cells in the testes of knockout mice were mainly manifested as apoptosis of round and elongated sperm cells. Figure 20 g), which corroborates the TUNEL test results above, both pointing to the important role of FAM205A1 in maintaining the survival of spermatogenic cells.
[0075] (6) Conclusion The systematic analysis in this embodiment shows that the deletion of the Fam205a1 gene leads to multi-level reproductive defects in male mice: at the testicular level, it induces apoptosis at specific spermatogenesis stages; at the sperm level, it causes multiple structural abnormalities, including the acrosome, flagella, and head, ultimately resulting in severely impaired sperm motility. Figure 20 d, 18e).
[0076] Figure 20 In the middle, (a) adult Fam205a1 + / + and Fam205a1 − / − Mouse testicular sections stained with periodic acid Schiff (PAS). In Fam205a1 − / − In male mice, T (teratospermia) indicates abnormal sperm morphology in seminiferous tubules at stages II–III, V, and VI; red lines indicate abnormal nuclei of elongated spermatocytes in seminiferous tubules at stages IX, X, XI, and XII. Scale bar = 25 μm. P: Paletene spermatocytes; RS: Round spermatocytes; ES: Elongated spermatocytes; T: Teratospermia; A: Type A spermatogonia; L: Leptotene stage; Z: Paleottene stage; 2-spc: Secondary spermatocytes; (b) TUNEL staining of seminiferous tubules shows that, compared with Fam205a1 + / + Compared to mice, Fam205a1 − / − More apoptotic cells were present in mice, and most of these cells were elongated sperm. White arrows indicate apoptotic elongated sperm. The experiment was repeated three times using different biological samples. Scale bar = 50 μm; (c) Left side: Transmission electron microscopy (TEM) showing Fam205a1 + / + Normal sperm morphology in the epididymis of a male mouse; right side: TEM shows Fam205a1. − / − Sperm with abnormal head morphology in the epididymis of male mice. Red arrows indicate abnormal sperm head morphology. The experiment was repeated three times using different biological samples. Scale bar = 1 μm; (d) Left side: Scanning electron microscopy (SEM) showing Fam205a1 + / +Normally morphological sperm in the epididymis of a male mouse; right side: SEM showing Fam205a1 − / − Sperm with abnormal head morphology in the epididymis of male mice. Blue arrows indicate abnormal sperm head morphology. The experiment was repeated three times using different biological samples. Scale bar = 1 μm; (e) Immunofluorescence assay to detect the effect of Fam205a1 gene knockout on sperm acrosome and flagella. Scale bar = 10 μm; (f) Computer-aided semen analysis (CASA) based on Fam205a1... − / − and Fam205a1 + / + Assessment of forward motility of sperm in the epididymal tail of mice; (g) Genotyping of offspring from Fam205a1 knockout mice by RT-PCR. Lanes 1-8: Mouse samples; Water: Blank control; M: Marker (DNA molecular weight standard); bp: Base pair; (h) Fam205a1 + / + and Fam205a1 − / − Hematoxylin-eosin (H&E) staining of mouse testes. The areas indicated by double arrows (dashed boxes) are magnified 4 times in the inset (corresponding to parallel reference lines), showing apoptosis and morphological abnormalities in both round sperm cells (RS) and elongated sperm cells (ES). RS: round sperm cells; ES: elongated sperm cells; Apo: apoptosis; T: teratospermia. Scale bar = 50 μm.
[0077] These findings elucidate the key mechanisms by which FAM205A1 maintains normal spermatogenesis, sperm structural integrity, and motility from the perspectives of cell biology and functional biology. They provide solid mechanistic evidence and cross-species functional conservation support for using abnormal expression of human FAM205A protein as a biomarker for diagnosing male asthenospermia, oligospermia, and idiopathic infertility.
[0078] Example 12: Correlation study between FAM205A protein expression level and IVF fertilization rate: To clarify whether FAM205A protein expression level is related to IVF fertilization rate, we collected semen samples from 223 patients undergoing IVF treatment. Before treatment, a small amount (100 μL) of semen was collected, washed, and the protein was extracted and frozen. Western blotting was used to detect FAM205A expression level. Cluster analysis was performed on FAM205A protein expression levels (β-tubulin standardized), grouping patients according to their FAM205A protein expression levels, and the difference in fertilization rate between the two groups was statistically analyzed.
[0079] The experimental results showed no differences in female age, endometrial thickness, and BMI between the high and low expression groups of FAM205A protein. Similarly, there were no differences in semen concentration, sperm motility, and semen pH between the high and low expression groups used for IVF treatment. The fertilization rate was higher in the high expression group than in the low expression group (Table 1), indicating a correlation between FAM205A protein expression level and IVF fertilization rate.
[0080] Table 1. Comparative analysis of female parameters and male semen parameters between the high and low expression groups of FAM205A protein. Example 13: Detection of the FAM205A gene sequence in the genome 1. Materials Peripheral blood samples of 200 μL were collected from patients clinically diagnosed with asthenospermia, oligospermia, or idiopathic male infertility.
[0081] 2. Extracting genome from blood tissue A blood genomic DNA extraction kit (e.g., brand: TIANGEN, catalog number: YDP304) was used. The specific procedures were performed according to the instructions. A brief description of the main procedures is as follows: (1) Take 200 μl of blood sample, add Proteinase K solution and buffer GB, mix well and lyse at 70 °C.
[0082] (2) Add anhydrous ethanol, mix well and transfer to the adsorption column.
[0083] (3) Wash the adsorption column sequentially with buffer GD and wash solution PW.
[0084] (4) After centrifugation and drying, the DNA was eluted with Tris-EDTA buffer and stored at -20℃.
[0085] 3. Whole genome sequencing detection The obtained patient genomic DNA is sent to a professional sequencing service provider for whole genome sequencing (WGS). Whole genome sequencing reagents refer to a set of commercially available reagents known and commonly used by those skilled in the art for WGS, such as Illumina's NovaSeq series sequencing kits or MGI's DNBSEQ series sequencing kits, which cover the complete set of enzymes, primers, dNTPs, and buffers required for library preparation, amplification, and sequencing reactions.
[0086] 4. Analyze the FAM205A gene sequence in the genome. Bioinformatics analysis was performed on the sequencing data, and the data were compared with the human reference genome (such as GRCh38 / hg38). The focus of the analysis was on the FAM205A gene region (e.g., corresponding to gene ID: 259308, from the gene module of the NCBI database).
[0087] (1) If no pathogenic mutations are found in the coding region and splice site of the FAM205A gene, it suggests that the current infertility may not be related to the FAM205A gene and other causes need to be investigated.
[0088] (2) If sequence variations are found in the promoter or enhancer region of the FAM205A gene, expression analysis should be conducted to determine whether they lead to significant changes in protein expression levels.
[0089] (3) If a nonsense mutation, frameshift mutation (non-fold deletion / insertion) or missense mutation located in an important functional domain (such as DUF4599 or FAM75 domain) is found in the coding sequence of the FAM205A gene, it suggests that the variant may affect protein function and is associated with male infertility.
[0090] (4) If a synonymous mutation or a deletion / insertion of 3 times that does not change the protein sequence is found, its pathogenicity should be carefully assessed, and it is generally considered to be unrelated to the disease.
[0091] (5) The analysis should also consider variations in other known male infertility-related genes to assess the likelihood of polygenic pathogenicity.
[0092] Example 14: Detection of FAM205A encoded protein expression level 1. Obtaining Samples Sperm or testicular tissue samples are obtained from male infertility patients through semen collection or testicular tissue aspiration (which must be performed by professional medical personnel).
[0093] 2. Preparation of protein samples (1) Use RIPA lysis buffer (containing protease inhibitor) to lyse tissues or washed sperm on ice, and centrifuge to collect the supernatant.
[0094] (2) Protein concentration was determined using the BCA method.
[0095] (3) Add SDS-PAGE protein loading buffer and denature in boiling water bath.
[0096] 3. Western blot reaction (1) Prepare an SDS-PAGE gel and load an appropriate amount of protein onto it.
[0097] (2) Electrophoresis and transfer to PVDF membrane.
[0098] (3) Block with 5% skim milk / TBST.
[0099] (4) Incubation of primary antibody: Use anti-human FAM205A polyclonal antibody (laboratory-made or commercial antibody, dilution ratio 1:100-1:200) and internal control antibody (such as GAPDH, dilution ratio 1:1000-1:5000) and incubate overnight at 4°C.
[0100] (5) After washing with TBST, incubate with the corresponding HRP-labeled secondary antibody (such as HRP Goat Anti-Rabbit IgG, diluted 1:5000) at room temperature for 1 hour.
[0101] (6) After washing, use ECL chemiluminescent developing solution for color development, and the imaging system acquires images.
[0102] 4. Results Analysis and Interpretation The relative expression level of FAM205A protein was calculated using GAPDH as an internal reference.
[0103] (1) If the expression level and band position of FAM205A protein in the test group are not significantly different from those in the normal control group, and the gene sequencing is normal, then it is likely that FAM205A abnormality will be excluded as the cause of current infertility.
[0104] (2) If the expression level of FAM205A protein in the detection group is significantly lower than that in the normal control group, it indicates that the protein expression is reduced, and gene sequence analysis can support its pathogenicity.
[0105] (3) If the test group shows bands of abnormal size (such as bands in advance), it may indicate that there is protein truncation or abnormal modification. It is necessary to analyze it in conjunction with the premature stop codon or frameshift mutation found in gene sequencing.
[0106] (4) If a positive correlation is observed between the expression level of FAM205A protein and the forward motility of sperm in sperm samples from patients with asthenospermia (as shown in Example 6), the evidence for FAM205A as a relevant phenotypic biomarker can be further strengthened.
[0107] 5. (Optional) Immunofluorescence verification of tissue For testicular tissue, fixation, dehydration, embedding, and frozen sectioning can be performed, followed by immunofluorescence staining. Using anti-FAM205A primary antibody and fluorescently labeled secondary antibody, the localization and signal intensity of FAM205A protein in spermatogenic cells (especially round and elongated sperm cells) and sperm acrosome region can be observed, providing morphological evidence for abnormal protein expression.
[0108] This invention, through integrated proteomics analysis, functional validation, and a gene knockout mouse model, demonstrates that FAM205A deficiency disrupts sperm morphology, motility, and fertilization capacity through a dual mechanism: reduced sperm count and quality (structural abnormalities). FAM205A regulates fertility through a dual mechanism: maintaining structural integrity during spermatogenesis and regulating the acrosome response. Therefore, FAM205A can serve as a reliable diagnostic biomarker for idiopathic male infertility and is also a potential therapeutic target in reproductive medicine.
[0109] Furthermore, FAM205A gene abnormalities can be detected through whole-genome sequencing, and abnormal FAM205A protein expression levels can be detected through antibodies that specifically bind to the FAM205A protein, which can be used to develop a test kit for male infertility.
[0110] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
[0111] sequence list <110> Wuhan Central Hospital (Wuhan No. 2 Hospital, Wuhan Cancer Institute) <120> Fam205a1 Construction of gene knockout mouse animal model <130> HJC20260125073 <160> 12 <210> 1 <211> twenty three <212> DNA / RNA <213> Artificial sequence <220> <223> Targeted mice Fam205a1 sgRNA-A1 sequence of the gene <400> 1 GATTAACTGC CCTCCAAGGG TGG 23 <210> 2 <211> twenty three <212> DNA / RNA <213> Artificial sequence <220> <223> Targeted mice Fam205a1 sgRNA-A2 sequence of the gene <400> 2 TCTTCTGAGA AGTCAGTAGT TGG 23 <210> 3 <211> twenty three <212> DNA / RNA <213> Artificial sequence <220> <223> Targeted mice Fam205a1 sgRNA-B1 sequence of the gene <400> 3 TGTTTCATAA AAGTACAGTT GGG 23 <210> 4 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> mice Fam205a1 Genotyping forward primer F1 <400> 4 GATCAACCGA TTGAAGAGCA GTCA 24 <210> 5 <211> 25 <212> DNA <213> Artificial sequence <220> <223> mice Fam205a1 Genotype identification reverse primer R1 <400> 5 GAGGTCGAGG CCAGAACTTA CTGTC 25 <210> 6 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> mice Fam205a1 Genotype identification reverse primer R2 <400> 6 CTCACTTACT CCTTCCTCTT GGTC 24 <210> 7 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> mice Fam205a1 Gene RT-PCR detection forward primers <400> 7 ACCATGTTTA GGGTGGTTCC T 21 <210> 8 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> mice Fam205a1 reverse primers for gene RT-PCR detection <400> 8 AGGACCTGCT CTCCATTTTC C 21 <210> 9 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> mice Fam205a1 Gene Real-Time PCR Detection Forward Primers <400> 9 CAGTCTAGGA CTCTGCTTGG C 21 <210> 10 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> mice Fam205a1 Reverse primers for gene real-time PCR detection <400> 10 GGCTGTGTGC ATAGCTCAAT A 21 <210> 11 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Mouse internal reference gene Gapdh PCR detection forward primers <400> 11 GGTTGTCTCC TGCGACTTCA 20 <210> 12 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Mouse internal reference gene GapdhPCR detection reverse primers <400> 12 TGGTCCAGGG TTTCTTACTC C 21.
Claims
1. The application of FAM205A in the preparation of a male infertility detection kit, characterized in that, The application is to detect abnormalities in the FAM205A gene and / or abnormalities in the expression level of the FAM205A protein; the male infertility includes at least one of asthenospermia, oligospermia and idiopathic male infertility.
2. The application according to claim 1, characterized in that, The FAM205A gene abnormality is at least one of the following: mutation in the promoter or enhancer sequence of the gene, or single or multiple base deletions, insertions, or substitutions in the gene coding sequence.
3. The application according to claim 1, characterized in that, The abnormal expression level of FAM205A protein is at least one of the following: reduced expression of FAM205A protein, premature termination or absence of expression of FAM205A protein, or deletion, insertion or substitution of amino acids in important functional domains of FAM205A protein.
4. The application according to claim 1, characterized in that, The male infertility detection kit is a FAM205A gene detection kit and / or a FAM205A protein expression level detection kit.
5. The application according to claim 4, characterized in that, The FAM205A gene detection kit includes whole genome sequencing detection reagents.
6. The application according to claim 4, characterized in that, The FAM205A protein expression level detection kit includes an antibody that specifically binds to the FAM205A protein.
7. The application of an antibody that specifically binds to the FAM205A protein in the preparation of a male infertility detection kit, characterized in that, The male infertility includes at least one of asthenospermia, oligospermia, and idiopathic male infertility.
8. Application of FAM205A as a diagnostic biomarker for idiopathic male infertility.