A method for synergistic improvement of wheat quality and disease resistance based on the creation and utilization of the T1DL.1VS translocation line

By creating the wheat-fleshed wheat T1DL.1VS translocation line and integrating the Pm67 and Glu-V1 genes, the problems of disease resistance and quality in wheat breeding were solved, and the high-efficiency breeding of powdery mildew resistant, high-quality, strong gluten wheat varieties was achieved.

CN122128462APending Publication Date: 2026-06-02NANJING AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2026-04-17
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently breed wheat varieties that are resistant to powdery mildew and have high-quality, strong gluten, mainly because disease-resistant genes and quality genes are distributed on different chromosomes, resulting in high breeding difficulty and low efficiency.

Method used

By creating the wheat-fungi T1DL.1VS translocation line, the powdery mildew resistance gene Pm67 and the quality gene Glu-V1 were combined and co-segregated on the 1VS chromosome arm. Co-dominant molecular marker screening and morphological marker selection were used to achieve simultaneous improvement of wheat quality and powdery mildew resistance.

Benefits of technology

It significantly improved the powdery mildew resistance and gluten quality of wheat, increased breeding efficiency, and enabled the efficient breeding of disease-resistant, high-quality, and strong-gluten wheat varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128462A_ABST
    Figure CN122128462A_ABST
Patent Text Reader

Abstract

This invention discloses a method for synergistic improvement of wheat quality and disease resistance based on the creation and utilization of the T1DL.1VS translocation line. Addressing the problem of low breeding efficiency caused by the dispersion of disease resistance and quality genes, this invention creates a novel T1DL.1VS translocation line that aggregates Pm67 / Glu-V1 by crossing the T1DL.1V#4S translocation line NAU195 carrying Glu-V1 with the T1DL.1V#5S translocation line NAU196 carrying Pm67. Recombinant single plants are screened in the F2 generation. Furthermore, utilizing the co-segregation characteristic of this translocation line with the wax repressor gene IW-V1, a dual-marker selection system combining morphological markers and the NAU1VS-1 molecular marker is established and introduced into a high-yielding variety background. This translocation line has no significant negative effect on yield traits, and the newly bred lines exhibit high resistance to powdery mildew and significantly improved bread processing quality, achieving synergistic and efficient improvement of wheat disease resistance and processing quality.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of wheat genetic breeding, and discloses a wheat quality and resistance synchronous improvement breeding method based on a wheat-einkorn wheat T1DL.1VS translocation line. BACKGROUND

[0002] Common wheat is the main food crop in China, and its yield and quality are directly related to food security. Wheat powdery mildew caused by Blumeria graminis f. sp tritici (Bgt) is an important disease that seriously affects wheat yield and quality worldwide. Therefore, it is very important to cultivate wheat varieties resistant to powdery mildew to ensure food security in China.

[0003] The quality of wheat processing determines the commodity value and edible value of wheat. The glutenin in the endosperm storage protein of wheat grain, including high molecular weight glutenin subunit (HMW-GS) and low molecular weight glutenin subunit (LMW-GS), is an important component of gluten protein and is crucial to the processing quality of wheat. Therefore, it is very important to establish an efficient breeding technology system for improving the quality of gluten by improving the high molecular weight glutenin subunit (HMW-GS) and low molecular weight glutenin subunit (LMW-GS) of wheat, thereby improving the quality of strong gluten wheat varieties.

[0004] Although it is a major breeding goal to cultivate wheat varieties resistant to powdery mildew and high in quality and strong in gluten, such varieties are lacking in the market at present. The main reason is that disease resistance genes and quality genes are scattered on different chromosomes, and the excellent subunit types of high molecular weight glutenin subunit (HMW-GS) and low molecular weight glutenin subunit (LMW-GS) are limited, resulting in high difficulty and low efficiency in cultivating wheat varieties resistant to powdery mildew and high in quality and strong in gluten.

[0005] Einkorn wheat (D. villosum, 2n = 14, VV) is a wild relative of wheat, and its 1VS chromosome arm carries the powdery mildew resistance gene Pm67 and the high molecular weight glutenin subunit site Glu-V1. Previous research results show that the introduction of Pm67 gene into wheat can provide high resistance to multiple powdery mildew physiological races, and the introduction of Glu-V1 into wheat can significantly improve the gluten quality and bread processing quality. However, Pm67 and Glu-V1 are scattered on different 1VS chromosome arms, and need to be aggregated on the same 1VS chromosome arm through genetic recombination. Because the T1DL.1VS translocation line carrying Pm67 / Glu-V1 does not undergo exchange recombination between 1VS and 1DS in wheat genetic improvement, Pm67 / Glu-V1 presents a co-segregation genetic module, which can significantly improve the efficiency of breeding new wheat varieties resistant to powdery mildew and high in quality and strong in gluten. SUMMARY

[0006] The purpose of this invention is to disclose a method for creating a translocation line based on wheat-flesh wheat T1DL.1VS.

[0007] Another object of the present invention is to provide the application of the wheat-fleshed wheat T1DL.1VS translocation line created using the method described above in the breeding of wheat for simultaneous improvement of quality and powdery mildew resistance.

[0008] Another object of the present invention is to provide a powdery mildew resistance gene Pm67, its recombinant vector, and its application.

[0009] The fourth objective of this invention is to provide primers for the co-dominant Indel marker NAU1VS-1 of Triticum aestivum 1VS and 1DS and their applications.

[0010] The objective of this invention can be achieved through the following technical solutions:

[0011] A method for creating a wheat-fungus tufted wheat T1DL.1VS translocation line that integrates the powdery mildew resistance gene Pm67 and the quality gene Glu-V1 includes the following steps:

[0012] (1) The wheat-flesh wheat T1DL.1V#4S translocation line NAU195 carrying the Glu-V1 gene was crossed with the wheat-flesh wheat T1DL.1V#5S translocation line NAU196 carrying the Pm67 gene but without Glu-V1 to obtain the F1 generation.

[0013] (2) F2 segregating populations were obtained by self-pollination of F1 generation. Genotyping of F2 individual plants was performed using 14 pairs of 1V#4S and 1V#5S codominant molecular markers to construct a 1VS genetic linkage map. The primer sequences for the 14 pairs of 1V#4S and 1V#5S codominant molecular markers are as follows:

[0014]

[0015] (3) Powdery mildew resistance was identified and glutenin subunits were analyzed on F2 single plants. Recombinant single plants carrying both Pm67 and Glu-V1 genes were screened to obtain a new wheat-fleshed wheat T1DL.1VS translocation line that aggregates the powdery mildew resistance gene Pm67 and the quality gene Glu-V1.

[0016] Preferably, among the 14 pairs of 1V#4S and 1V#5S codominant molecular markers, CINAU1VS-1 and CINAU1VS-2 are used to locate the Glu-V1 gene, and CINAU1VS-6 and CINAU1VS-7 are used to locate the Pm67 gene.

[0017] Preferably, the T1DL.1V#4S translocation line NAU195 is obtained by hybridization and backcrossing of durum wheat-trifoliate wheat double diploid NAU1801 with the high-yielding variety Nannong 0686, and by comprehensively utilizing GISH / FISH and the 1VS specific molecular marker 1V-207 to select and obtain the wheat-trifoliate wheat T1DL.1V#4S translocation line NAU195 carrying Glu-V1. The 1VS specific molecular marker primers are F: GTTTCAGGGAGGCTGCATTG (SEQ ID NO: 31) and R: CCCGAGCACTCATTAACAACC (SEQ ID NO: 32).

[0018] A wheat-fleshed wheat T1DL.1VS translocation line that aggregates Pm67 / Glu-V1, said translocation line is obtained by the method described in any one of claims 1-2, and carries the powdery mildew resistance gene Pm67, the quality gene Glu-V1 and the waxy inhibition gene IW-V1, and the three genes co-segregate on the 1VS chromosome arm, exhibiting a non-waxy ear phenotype, high resistance to powdery mildew and high-quality strong gluten characteristics.

[0019] Application of the wheat-fleshed wheat T1DL.1VS translocation line in the breeding of wheat for simultaneous improvement of quality and powdery mildew resistance.

[0020] A method for simultaneously improving wheat quality and powdery mildew resistance using the aforementioned wheat-flesh wheat T1DL.1VS translocation line includes the following steps:

[0021] (1) Using the wheat-fungi T1DL.1VS translocation line, which aggregates the powdery mildew resistance gene Pm67 and the quality gene Glu-V1, as the donor, it was crossed with a high-yielding wheat variety with a waxy phenotype in the ear glumes;

[0022] (2) Select superior single plants with no waxy phenotype in the ear glumes during the segregating generation. This no-waxy phenotype indicates that the single plant carries the waxy repression gene IW-V1, which co-segregates with Pm67 / Glu-V1.

[0023] (3) Use 1VS / 1DS codominant molecular markers to identify single plants without waxy phenotype by PCR and screen single plants carrying homozygous T1DL.1VS translocation chromosome;

[0024] (4) Through powdery mildew resistance identification, quality analysis and regional variety trials, a new high-quality strong gluten wheat variety resistant to powdery mildew was bred;

[0025] Among them, the high-yield wheat varieties are Ningmaizi 119 or Nannong 0686;

[0026] The 1VS / 1DS codominant molecular marker is NAU1VS-1, and its primer sequences are: forward primer GGGTGTATGGATTTGTCTCA (SEQ ID NO: 33), and reverse primer ATACAAGAGATAACATCAGGTACT (SEQ ID NO: 34); NAU1VS-1 amplifies a 769 bp fragment in the 1VS genome and a 556 bp fragment in the 1DS genome.

[0027] A powdery mildew resistance gene Pm67, wherein the coding region nucleotide sequence of the gene is shown in SEQ ID NO:1, or the amino acid sequence encoded by the gene is shown in SEQ ID NO:2.

[0028] A recombinant expression vector containing the powdery mildew resistance gene Pm67, wherein the gene is operatively linked to a plant constitutive expression promoter.

[0029] The application of the powdery mildew resistance gene Pm67 or the recombinant expression vector in the breeding of powdery mildew resistant wheat includes introducing the gene or vector into powdery mildew-susceptible wheat recipient material to obtain powdery mildew resistant transgenic wheat plants.

[0030] The application of the T1DL.1VS translocation chromosome carrying the Pm67 / Glu-V1 gene pair in the breeding of powdery mildew resistant and strong gluten wheat varieties.

[0031] The gene Pm67 was introduced into wheat varieties susceptible to powdery mildew through genetic engineering to improve their resistance to powdery mildew.

[0032] Primers for codominant Indel marker NAU1VS-1 in Triticum aestivum 1VS and Triticum aestivum 1DS are characterized by having a forward primer of GGGTGTATGGATTTGTCTCA (SEQ ID NO: 33) and a reverse primer of ATACAAGAGATAACATCAGGTACT (SEQ ID NO: 34); these primers amplify fragments of 769 bp and 556 bp in the 1VS and 1DS genomes, respectively.

[0033] Any one or more of the following applications of the primers for NAU1VS-1:

[0034] (1) Identification of heterozygous T1DL.1VS translocation system;

[0035] (2) Identification of homozygous T1DL.1VS translocation line;

[0036] (3) Screening wheat materials carrying the Pm67 / Glu-V1 gene or breeding high-quality wheat resistant to powdery mildew.

[0037] Beneficial effects:

[0038] This invention establishes a strategy for aggregating superior exogenous genes in the wheat background by constructing genetic mapping populations of wheat-wheat T1DL.1VS translocation lines from different sources. This results in the creation of new germplasm of the Pm67 / Glu-V1 cosegregating genetic linkage module, providing a new method for achieving high-quality, disease-resistant, and efficient synergistic improvement of wheat using exogenous genes.

[0039] The wheat-fleshed wheat T1DL.1VS translocation line, which aggregates Pm67 / Glu-V1, was crossed with different high-yielding varieties, Nannong 0686 and Ningmaizi 119. The T1DL.1VS translocation chromosome had no significant negative effect on yield-related traits. Compared with the recurrent parents Nannong 0686 and Ningmaizi 119, the new line carrying Pm67 / Glu-V1 had an additional exogenous glutenin subunit (Experimental Result 3 in Example 1), which significantly improved powdery mildew resistance and gluten strength, thereby achieving synergistic improvement of wheat resistance and processing quality.

[0040] The efficiency of selecting superior traits is key to efficient breeding. The *Triticum aestivum* 1VS carries the IW-V1 gene, a gene that suppresses waxy glume in the ear, on its chromosome arm. This gene co-segregates with Pm67 / Glu-V1. The wheat-*Triticum aestivum* T1DL.1VS translocation line, which aggregates Pm67 / Glu-V1, is crossed with a high-yielding variety exhibiting a waxy ear phenotype. Individual plants with a non-waxy ear glume phenotype are selected from the segregating generations; these are plants carrying the Pm67 / Glu-V1 gene. This establishes a new, efficient breeding method for selecting superior, disease-resistant plants through morphological markers (presence or absence of a waxy ear phenotype). Figure 5 (As shown). The 1VS / 1DS co-dominant molecular marker CINAU1VS-1 described in this invention provides a technical means for identifying high-generation new homozygous T1DL.1VS translocation lines.

[0041] This invention used map-based cloning and functional analysis to identify the broad-spectrum powdery mildew resistance gene Pm67 in wheat. Genetic transformation of the Pm67 gene significantly improved powdery mildew resistance in wheat varieties, but had no negative effect on yield traits. Attached Figure Description

[0042] Figure 1 Flowchart of the breeding process for the wheat-Triticum aestivum T1DL.1VS translocation line carrying Glu-V1. All materials NAU1801, NAU195, NAU196, and Nanjing Agricultural University 0686 are publicly known and widely used materials.

[0043] Figure 2SDS-PAGE analysis of glutenin in wheat grains from different sources—the T1DL.1V#4S translocation line NAU195 and the T1DL.1V#5S translocation line NAU196—showed that NAU195 carries Glu-V1, while NAU196 does not.

[0044] Figure 3 Genetic mapping analysis of the Pm67 / Glu-V1 gene on 1VS wheat. (A) Flowchart of genetic mapping of the Pm67 / Glu-V1 gene on 1VS wheat. (B) Genetic linkage map constructed using 14 1VS polymorphic molecular markers and the genetic mapping regions of the Glu-V1 and Pm67 genes.

[0045] Figure 4 Analysis of powdery mildew resistance and bread quality of the novel T1DL.1VS translocation line C1VS-1, which integrates the Pm67 / Glu-V1 gene. (A) Compared with NAU195, the developed T1DL.1VS translocation line C1VS-1 is highly resistant to powdery mildew, indicating that it carries the powdery mildew resistance gene Pm67 from NAU196. (B) Compared with NAU196, the bread quality of NAU195 is significantly better than that of NAU196. (C) The bread processing quality of the developed T1DL.1VS translocation line C1VS-1 is the same as that of NAU195, indicating that it carries the Glu-V1 subunit from NAU195.

[0046] Figure 5 The T1DL.1VS translocation line carrying Pm67 / Glu-V1 was crossed with a superior variety with waxy ears. After segregating generations, superior single plants without waxy ears were selected. These single plants are those carrying the T1DL.1VS translocation chromosome and have excellent disease resistance potential, which significantly improves the breeding efficiency of improving high-quality disease-resistant wheat varieties.

[0047] Figure 6 Transplantation and utilization of the T1DL.1VS translocation line carrying Pm67 / Glu-V1. (A) Identification results of the T1DL.1VS translocation chromosome by the specific codominant molecular marker CINAU1VS-1. Transplantation of the T1DL.1VS translocation chromosome carrying Pm67 / Glu-V1 into the high-yielding wheat Ningmaizi 119 had no significant effect on maturity date (B), plant height (C), spike length (D), number of grains per spike (E), number of spikes per square meter (F), and thousand-grain weight (G), indicating that the translocation chromosome improves wheat powdery mildew resistance and bread processing quality while having no negative effect on yield-related traits.

[0048] Figure 7Pm67 transgenic analysis: (a) The Pm67 gene was transformed into the powdery mildew-susceptible cultivar Fielder, resulting in PCR identification of 7 positive plants. (b) Powdery mildew resistance identification of the 7 positive plants in the T0 generation at the seedling stage showed a significant increase in resistance compared to Fielder. (c) Powdery mildew resistance identification of the T1 generation of Pm67-transgenic positive plants at the adult stage showed that the Pm67 gene transfusion significantly improved powdery mildew resistance. (d) Powdery mildew resistance identification of the T2 generation of Pm67-transgenic positive plants at the adult stage showed that the Pm67 gene transfusion significantly improved powdery mildew resistance. Detailed Implementation

[0049] The source of the biomaterials involved in this invention:

[0050] Durum wheat-Villosum amphidiploid NAU1801 carrying Glu-V1: Zhang Ruiqi, Zhang Mingyi, Wang Xiue, Chen Peidu. Introduction of chromosome segment carrying the seedstorage protein genes from chromosome 1V of Dasypyrum villosum showed positive effect on bread-making quality of common wheat. Theor Appl Genet, 2014, 127:523-533.

[0051] Nanjing Agricultural University 0686: National Approval Wheat 2010003;

[0052] Wheat-Triticum aestivum T1DL.1V#4S translocation line NAU195: Yang Guang, Creation of high-quality disease-resistant new germplasm based on wheat-Triticum aestivum T1DL.1VS translocation line. Nanjing Agricultural University, Master's Thesis, 2023.

[0053] Wheat - Triticum villosum T1DL.1V#5S translocation line NAU196: Zhang Ruiqi, Xiong Chuanxi, MuHuanqing, Yao Ruonan, Meng Xiangru, Kong Lingna, Xing Liping, Wu Jizhong, Feng Yigao, Cao Aizhong. Pm67, a new powdery mildew resistance genetransferred from Dasypyrum villosum chromosome 1V to common wheat (Triticumaestivum L.). Crop Journal, 2021, 9:882-888.

[0054] Ningmaizi119: Jiangsu Approval Number 20180002

[0055] Example 1

[0056] (1) Creation process of wheat-Triticum aestivum T1DL.1VS translocation line with Glu-V1 / Pm67 gene aggregation

[0057] The durum wheat-Triticumaestivum didiploid NAU1801 carrying Glu-V1 was crossed with the high-yielding variety Nannong 0686, and then backcrossed with Nannong 0686. In the BC2F2 generation, the wheat-Triticumaestivum T1DL.1V#4S translocation line NAU195 was bred by combining GISH / FISH and the 1VS-specific molecular marker 1V-207 (F: GTTTCAGGGAGGCTGCATTG, R: CCCGAGCACTCATTAACAACC) (see reference: Zhang Ruiqi, Xiong Chuanxi, Mu Huanqing, Yao Ruonan, Meng Xiangru, Kong Lingna, Xing Liping, Wu Jizhong, Feng Yigao, Cao Aizhong. Pm67, a new powdery mildew resistance gene transferred from Dasypyrum villosum chromosome 1V to common wheat (Triticumaestivum L.). Crop Journal, 2021, 9:882-888.). Figure 1SDS-PAGE gel electrophoresis revealed that NAU195 carries an additional novel high-molecular-weight glutenin subunit V71 at the Glu-V1 site, which is not found in common wheat, while the wheat-tufted wheat T1DL.1V#5S translocation line NAU196 lacks this subunit. Figure 2 NAU195 was crossed with NAU196, which carries Pm67 but lacks the V71 subunit. The F1 plants were self-crossed to obtain 285 F2 plants. Using the 1VS genome sequence (see reference: Zhang X, Wang HY, Sun HJ, Li YB, Feng YL, Jiao CZ, Li ML, Song XY, Wang T, Wang ZK, Yuan CX, Sun L, Lu RJ, Zhang WL, Xiao J, Wang XE (2023) A chromosome-scale genome assembly of Dasypyrum villosum provides insights into its application as a broad-spectrum disease resistance resource for wheat improvement. Mol Plant 16:432–451.), 14 pairs of 1V#4S and 1V#5S co-dominant molecular markers were developed (primer sequences are shown in Table 1). The genotypes of the 285 F2 plants were analyzed using these co-dominant molecular markers, and a 1VS linked genetic population was constructed. Based on this, 285 F2 individual plants were inoculated and identified using mixed physiological races of powdery mildew, and phenotypes were investigated three times. Combining population genotype and phenotype, Pm67 was finally located between markers CINAU1VS-6 and CINAUVS-7. SDS-PAGE was used to further analyze the high molecular weight glutenin subunits of the F2 individual plants, locating the Glu-V1 site encoding the V71 subunit between markers CINAU1VS-1 and CINAUVS-2. Based on the location intervals of these two genes, the T1DL.1VS translocation line C1VS-1, which aggregates Pm67 / Glu-V1, was selected. Powdery mildew resistance identification and bread processing quality analysis showed that, compared with NAU195, adult C1VS-1 plants were highly resistant to powdery mildew, and the bread quality was comparable to NAU195 but significantly better than NAU196, indicating that the T1DL.1VS translocation line, which aggregates Pm67 / Glu-V1, possesses both excellent quality and disease resistance. (The specific process is as follows) Figure 1 As shown, the results are as follows Figure 3 , Figure 4 (As shown).

[0058] Table 1. Primer sequences of 14 codominant molecular markers used to construct 1VS genetic linkage maps.

[0059]

[0060] (2) Development of InDel molecular markers specific to codominant translocation lines of wheat-Triticum aestivum T1DL.1VS that aggregate Glu-V1 / Pm67 genes

[0061] According to tufted wheat 91C43 DH Based on the 1VS sequence (Dv01G152900) of the reference genome and its homologous gene sequence with common wheat 1DS (TraesCS1D02G121000), a co-dominant indel marker NAU1VS-1 for 1VS and 1DS was developed using Primer 3 software (F: GGGTGTATGGATTTGTCTCA (SEQ ID NO: 33); R: ATACAAGAGATAACATCAGGTACT (SEQ ID NO: 34)). The annealing temperature of this marker was 60 ℃. The wheat-Triticum aestivum T1DL.1VS translocation line C1VS-1 carrying the Glu-V1 / Pm67 gene was crossed with any high-yielding common wheat variety. DNA was extracted from leaves of different individual plants in the segregating generations, and PCR amplification was performed using the NAU1VS-1 marker. Then, electrophoresis was performed using 1% agarose gel. The electrophoresis results showed two bands with different molecular weights, with the 769 bp band representing the 1VS genome and the 556 bp band representing the 1DS genome. If only a 769 bp band is amplified from a single DNA strain, it indicates that the strain is homozygous for the T1DL.1VS translocation line; if two bands are amplified simultaneously, it indicates that the strain is heterozygous for the T1DL.1VS translocation line; and if only a 556 bp band is amplified, it indicates that the T1DL.1VS translocation chromosome is absent. (Results are as follows) Figure 6 (As shown in A).

[0062] (3) Transplantation and utilization of wheat-Triticum aestivum T1DL.1VS translocation line with Glu-V1 / Pm67 gene aggregation

[0063] Using the wheat-Triticum aestivum T1DL.1VS translocation line carrying the Glu-V1 / Pm67 gene selected in Example 1 as a superior parent, it was crossed with Ningmaizi 119, a high-yielding and powdery mildew-susceptible variety with waxy ears. Since Triticum aestivum 1VS carries the ear waxy glume suppressor gene IW-V1 on its chromosome arm, this gene co-segregates with Pm67 / Glu-V1. The wheat-Triticum aestivum T1DL.1VS translocation line, which aggregates Pm67 / Glu-V1, was crossed with a high-yielding variety exhibiting a waxy ear phenotype. Individual plants with a superior ear glume phenotype (such as...) were selected from the segregating generations. Figure 5As shown in the figure, these are single plants carrying the Pm67 / Glu-V1 gene. Superior single plants were identified using the co-dominant Indel marker NAU1VS-1 for 1VS and 1DS, and homozygous T1DL.1VS translocation lines were selected. These homozygous T1DL.1VS translocation lines were planted into lines (5 rows, 1.5 meters long). Sampling was conducted on yield-related traits such as plant height, number of tillers, number of effective panicles, number of grains per panicle, and 1000-grain weight for each line. Significance analysis of trait differences was performed using GraphPad Prism 8.0 software compared to the control (P < 0.05). Figure 6 (As shown in B, C, D, E, F, and G). Lines with the best agronomic traits were selected for quality-related trait analysis, mainly including gluten quality, farinometry, and extensometry characteristics. Finally, the T1DL.1VS translocation line, with outstanding yield and quality, was selected to participate in regional variety trials. Through regional trials, new disease-resistant wheat lines (species) carrying the Pm67 / Glu-V1 gene were selected. Compared with the susceptible recurrent parent Ningmaizi 119, the new lines carrying the Pm67 / Glu-V1 gene showed higher resistance to powdery mildew and significantly improved bread processing quality (Table 2).

[0064] Table 2. Quality effect analysis of Ningmai Zi 119 with T1DL.1 vs. translocation chromosomes.

[0065]

[0066] Different letters indicate significant differences (P<0.05).

[0067] PC: Crude protein content; WGC: Wet gluten content; DGC: Dry gluten content; GI: Gluten index; WA: Water absorption rate; DT: Dough formation time; ST: Dough stability time; SA: Dough area; PPF: Maximum resistance to stretching; BV: Bread volume; BC: Bread score.

[0068] (4) Map-based cloning of the powdery mildew resistance gene Pm67

[0069] The wheat-fungus tufted wheat T1DL.1V#4S translocation line NAU195, which is highly susceptible to powdery mildew, was crossed with the wheat-fungus tufted wheat T1DL.1V#5S locus line NAU196 carrying Pm67. Powdery mildew resistance was first identified in 285 F2 individual plants, and 1VS linkage populations were constructed to preliminarily locate the Pm67 gene. Figure 3Then, using the molecular markers CINAU1VS-6 and CINAUVS-7 flanking the Pm67 gene, 3500 F2 single plants were identified, exchanged single plants were screened, and powdery mildew resistance was identified in homozygous exchanged single plants, obtaining the fine mapping region of the Pm67 gene. Simultaneously, 10-fold genome sequencing was performed on the wheat-Triticum aestivum T1DL.1V#5S locus NAU196 carrying Pm67 using PacBio SMRT sequencing technology. The genomes were screened using molecular markers flanking the fine mapping of the Pm67 gene to obtain contigs carrying the Pm67 gene, and gene annotation was performed on the genome sequences of the mapping region to obtain candidate genes. Furthermore, the full-length cDNA of NAU196 seedlings induced by powdery mildew race E09 was sequenced to confirm the Pm67 candidate gene.

[0070] (5) Genetic transformation of the Pm67 gene

[0071] The full-length sequence was amplified from the wheat-Triticum aestivum T1DL.1V#5S translocation line NAU196 using specific primers (F: CCAGACGATTGATCCAGAG; R: GGAGTACTTGTCACTTGTC). A homologous arm with a corresponding restriction enzyme site was added to the 5' end of the cloning primers to facilitate recombination ligation. The PCR product required further purification before ligation. The plGy-OE3 vector was digested and purified using restriction endonucleases StuⅠ and BamHI. Following the instructions of the ClonExpress II One Step Cloning Kit, the target fragment of the Pm67 gene was ligated into the plGy-OE3 vector (Nanjing Novizan Biotechnology Co., Ltd.) using homologous recombination. The recombinant vector was transformed into E. coli, and single clones were selected for sequencing verification. The transgenic overexpression vector pUbi:Pm67 was finally constructed. pUbi: The Pm67 plasmid was transformed into the powdery mildew-susceptible wheat variety Fielder via Agrobacterium infection. In the T0 generation, PCR amplification of the Pm67 gene was performed using primers (F: CCAGACGATTGATCCAGAG; R: GGAGTACTTGTCACTTGTC). Leaves from positive plants were collected for in vitro identification of powdery mildew. T0 generation self-pollination extended to T1 generation positive plants, which were then inoculated with powdery mildew at both the seedling and adult stages to verify the function of the Pm67 gene. Powdery mildew resistance identification results showed that, compared with the transgenic recipient material Fielder, the leaves of seven wheat plants overexpressing the Pm67 gene exhibited significantly increased resistance to powdery mildew at both the seedling and adult stages (e.g., ...). Figure 7 As shown in the figure, this further illustrates the positive regulatory role of the Pm67 gene in wheat powdery mildew.

Claims

1. A method for creating a wheat-fungus tufted wheat T1DL.1VS translocation line that integrates the powdery mildew resistance gene Pm67 and the quality gene Glu-V1, characterized in that, Includes the following steps: (1) The wheat-flesh wheat T1DL.1V#4S translocation line NAU195 carrying the Glu-V1 gene was crossed with the wheat-flesh wheat T1DL.1V#5S translocation line NAU196 carrying the Pm67 gene but without Glu-V1 to obtain the F1 generation. (2) F2 segregating populations were obtained by self-pollination of F1 generation. Genotyping of F2 individual plants was performed using 14 pairs of 1V#4S and 1V#5S codominant molecular markers to construct a 1VS genetic linkage map. The primer sequences for the 14 pairs of 1V#4S and 1V#5S codominant molecular markers are as follows: (3) Powdery mildew resistance identification and glutenin subunit analysis were performed on F2 single plants. Recombinant single plants carrying both Pm67 and Glu-V1 genes were screened to obtain wheat-fleshed wheat T1DL.1VS translocation lines that aggregate the powdery mildew resistance gene Pm67 and the quality gene Glu-V1.

2. The creation method according to claim 1, characterized in that, The T1DL.1V#4S translocation line NAU195 was bred by crossing the durum wheat-trifoliate wheat double diploid NAU1801 with the high-yielding variety Nannong 0686, backcrossing, and comprehensively utilizing GISH / FISH and 1VS specific molecular markers to obtain the wheat-trifoliate wheat T1DL.1V#4S translocation line NAU195 carrying Glu-V1. The 1VS specific molecular marker primers are F: GTTTCAGGGAGGCTGCATTG (SEQ ID NO: 31) and R: CCCGAGCACTCATTAACAACC (SEQ ID NO: 32).

3. A wheat-Triticum aestivum T1DL.1VS translocation system polymerizing Pm67 / Glu-V1, characterized in that, The translocation line is obtained by the method described in any one of claims 1-2, and carries the powdery mildew resistance gene Pm67, the quality gene Glu-V1, and the waxy inhibition gene IW-V1. The three genes are co-segregated on the 1VS chromosome arm, exhibiting a non-waxy ear phenotype, high resistance to powdery mildew, and high-quality strong gluten characteristics.

4. Application of the wheat-fleshed wheat T1DL.1VS translocation line as described in claim 3 in the breeding of wheat for simultaneous improvement of quality and powdery mildew resistance.

5. A method for simultaneously improving wheat quality and powdery mildew resistance using the wheat-Triticum aestivum T1DL.1VS translocation line obtained by the method of any one of claims 1-2, characterized in that, Includes the following steps: (1) Using the wheat-fungi T1DL.1VS translocation line, which aggregates the powdery mildew resistance gene Pm67 and the quality gene Glu-V1, as the donor, it was crossed with a high-yielding wheat variety with a waxy phenotype in the ear glumes; (2) Select superior single plants with no waxy phenotype in the ear glumes during the segregating generation. This no-waxy phenotype indicates that the single plant carries the waxy repression gene IW-V1, which co-segregates with Pm67 / Glu-V1. (3) Use 1VS / 1DS codominant molecular markers to identify single plants without waxy phenotype by PCR and screen single plants carrying homozygous T1DL.1VS translocation chromosome; (4) Through powdery mildew resistance identification, quality analysis and regional variety trials, a new high-quality strong gluten wheat variety resistant to powdery mildew was bred; Among them, the high-yield wheat varieties are Ningmaizi 119 or Nannong 0686; The 1VS / 1DS codominant molecular marker is NAU1VS-1, and its primer sequences are: forward primer GGGTGTATGGATTTGTCTCA (SEQ ID NO: 33), and reverse primer ATACAAGAGATAACATCAGGTACT (SEQ ID NO: 34); NAU1VS-1 amplifies a 769 bp fragment in the 1VS genome and a 556 bp fragment in the 1DS genome.

6. A powdery mildew resistance gene Pm67, characterized in that, The coding region nucleotide sequence of the gene is shown in SEQ ID NO:1, or the amino acid sequence encoded by the gene is shown in SEQ ID NO:

2.

7. A recombinant expression vector, characterized in that, It contains the powdery mildew resistance gene Pm67 as described in claim 6, and the gene is operatively linked to a plant constitutive expression promoter.

8. The application of the powdery mildew resistance gene Pm67 as described in claim 6 or the recombinant expression vector as described in claim 7 in the cultivation of powdery mildew resistant wheat, comprising introducing the gene or vector into powdery mildew-susceptible wheat recipient material to obtain powdery mildew resistant transgenic wheat plants.

9. Primers for co-dominant Indel markers of NAU1VS-1 in Triticum aestivum 1VS and Triticum aestivum 1DS, characterized in that, The forward primer was GGGTGTATGGATTTGTCTCA (SEQ ID NO: 33), and the reverse primer was ATACAAGAGATAACATCAGGTACT (SEQ ID NO: 34); these primers amplified fragments of 769 bp and 556 bp in the 1VS and 1DS genomes, respectively.

10. Any one or more of the following applications of the primers of claim 9: (1) Identification of heterozygous T1DL.1VS translocation system; (2) Identification of homozygous T1DL.1VS translocation line; (3) Screening wheat materials carrying the Pm67 / Glu-V1 gene or breeding high-quality wheat resistant to powdery mildew.