Dcaps markers associated with barley seed germination vigor and use thereof

Abstract

The present application relates to the field of molecular biology and genetic breeding technology, and particularly relates to a dCAPS marker related to barley seed germination vigor and application thereof. The molecular marker is based on a SNP at the 5690924097th base of the 2nd chromosome of barley; the SNP base difference is T or G, the site is significantly related to the barley seed germination vigor, and the T type has higher germination vigor. The molecular marker can be used for accurate and efficient detection, molecular marker assisted selection, improvement of the identification efficiency and accuracy of the barley seed germination vigor, and provides a practical tool for the improvement of the barley variety for beer.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic breeding technology, and in particular to the dCAPS marker related to barley seed germination vigor and its application. Background Technology

[0002] barley( Hordeum vulgare L. Barley is the world's fourth largest cereal crop, with a wide range of uses, primarily in food, animal feed, and beer brewing. As a key raw material for beer brewing, the germination vigor of barley seeds directly determines malting efficiency and malt quality, impacting the competitiveness of beer-grade barley. Seed germination is a core step in the beer malting process. Slow germination not only prevents starch from being converted into sugar in a timely manner, thus affecting brewing quality, but also results in uneven germination, increasing malt production losses. A germination rate below 95% leads to a significant reduction in malt extraction. Therefore, ensuring rapid and uniform seed germination is crucial.

[0003] Seed germination vigor is a complex trait regulated by multiple genes, influenced by both genetic and environmental factors. Traditional breeding screening relies on physiological indicators such as germination tests, which is time-consuming, labor-intensive, and difficult to apply efficiently in large-scale populations. A relatively new and convenient approach is marker-assisted breeding (MAB). This method utilizes molecular markers closely associated with the target trait to precisely and quickly screen large populations without requiring repeated measurements of physiological indicators, saving time and effort. MAB has spurred the development of various molecular markers. Among them, dCAPS (derived restriction enzyme amplification polymorphism) molecular markers are a molecular marker design method based on CAPS (restriction enzyme amplification polymorphism) molecular markers. By introducing artificial mismatched bases near SNP sites through primer design, the amplification products can be adapted to multiple restriction endonucleases, simplifying electrophoresis banding results and overcoming the limitation of CAPS molecular markers, which can only be used to recognize SNP mutations at restriction enzyme sites.

[0004] Although dCAPS molecular marker technology theoretically offers advantages such as convenient detection and controllable cost, there are currently no reports of dCAPS markers specifically developed for the germination vigor trait of barley seeds. Existing barley germination-related markers suffer from low correlation, complex detection procedures, or insufficient phenotypic prediction accuracy, making it difficult to meet the needs of efficient screening for the key trait of germination rate in brewing barley. Traditional barley breeding still relies on time-consuming and labor-intensive traditional germination tests, severely restricting the improvement of breeding efficiency. Therefore, developing a dCAPS molecular marker that is closely related to barley seed germination vigor, is easy to detect, and is suitable for large-scale breeding population screening has become an urgent technical problem to be solved in this field. Summary of the Invention

[0005] In view of this, the present invention proposes a dCAPS marker related to barley seed germination activity and its application. This molecular marker, S2H_569092409, can be used to screen barley materials with different germination activities and to cultivate new barley varieties with high germination activity.

[0006] The specific technical solution is as follows: In a first aspect, the present invention provides a molecular marker associated with barley seed germination viability, said molecular marker being a single nucleotide polymorphism (SNP) site located on the barley genome; The SNP site corresponds to position 41 of the genome sequence shown in SEQ ID NO.4; The SNP site is located at position 569092409 on the barley chromosome; and there is a T / G base difference at this physical position.

[0007] Furthermore, the molecular marker is located on barley chromosome 2.

[0008] Furthermore, the full-sequence version of the barley reference genome is Morex_V3.

[0009] Furthermore, the seed germination viability is characterized by the germination rate of barley seeds over 72 hours.

[0010] Furthermore, the primer pair sequences used to amplify the molecular marker are as follows: Upstream primer F: 5'-GATGAGCTTCGTGTCGGCCTTCGGCGAGTGCGTCGAGTAC-3'; Downstream primer R: 5'-ATGAGCCGCATCACCCGGTCCGCCCGGATCCTCCTCACCT-3'; The amplification product is 195 bp, and its sequence is shown in SEQ ID NO.3.

[0011] Furthermore, the 36-37bp of the sequence shown in SEQ ID NO.3 is an artificially introduced mismatched base AG.

[0012] In a second aspect, the present invention provides a primer pair for amplifying the above-mentioned molecular marker, the primer pair sequence being as follows: Upstream primer F: 5'-GATGAGCTTCGTGTCGGCCTTCGGCGAGTGCGTCGAGTAC-3'; Downstream primer R: 5'-ATGAGCCGCATCACCCGGTCCGCCCGGATCCTCCTCACCT-3'.

[0013] In a third aspect, the present invention provides a detection kit comprising the aforementioned primer pairs.

[0014] The present invention provides, in a fourth aspect, the use of the above-described molecular marker, or the above-described primer pair, or the above-described detection kit in any of the following: (1) Identification, selection and improvement of barley seed germination vigor; (2) Early prediction of barley seed germination vigor; (3) Marker-assisted breeding of barley; (4) Screening or breeding high-quality barley for brewing.

[0015] The present invention provides a method for screening barley germplasm with different germination vigors in a fifth aspect, comprising the following steps: (1) Extract genomic DNA from barley plants; (2) Using the genomic DNA described in step (1) as a template, perform PCR amplification using the primer pair; (3) Use restriction endonucleases to perform genotyping and analysis of the test samples based on electrophoretic bands; If the base at the SNP site is of type T, the enzyme digestion is successful, and the barley plant to be tested is a material with high seed germination activity; if the base at the SNP site is of type G, the enzyme digestion fails, and the barley plant to be tested is a material with low seed germination activity.

[0016] Furthermore, the PCR amplification reaction system is as follows: 12.5 μL of KOD One PCR Master Mix, 1 μL each of 10 μmol / L Primer, 1 μL of 100 ng / μL template DNA, 9.5 μL of sterile water, and a total reaction volume of 25 μL.

[0017] Furthermore, the PCR reaction procedure is as follows: 98℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 65℃ annealing for 5 s, 68℃ extension for 1 s, 30 cycles; 68℃ extension for 5 min, and storage at 4℃.

[0018] Furthermore, the restriction endonuclease is an Sca I restriction endonuclease.

[0019] Furthermore, the restriction endonuclease cleavage site is located at the 38th bp of the sequence shown in SEQ ID NO.3.

[0020] Furthermore, the restriction endonuclease's digestion recognition sequence is AGT^ACT. Furthermore, the band size of the successfully digested enzyme product is 157 bp; the band size of the unsuccessfully digested enzyme product is 195 bp.

[0021] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention uses multi-omics methods such as genome-wide association analysis, quantitative trait locus localization and weighted gene co-expression network analysis to identify an SNP associated with seed germination vigor from 245 natural populations of barley from around the world: S2H_569092409, with base differences of T or G. The T type has higher germination vigor and its proportion has continued to increase during domestication and breeding, indicating that the gene is subject to positive selection.

[0022] (2) The dCAPS molecular marker of the present invention can accurately, quickly and easily identify the germination viability of barley seeds, which is conducive to accelerating the breeding process of high-quality beer barley, quickly selecting beer barley germplasm with high germination viability, providing practical tools for the improvement of beer barley varieties, and ensuring the quality of raw materials for the beer industry. Attached Figure Description

[0023] Figure 1 (a) in the figure shows the electrophoresis results of the molecular marker enzyme digestion experiment; Figure 1 (b) in the figure is a bar chart of germination rate of different genotypes after 72 hours. Detailed Implementation

[0024] The molecular markers and applications provided by this invention are described in detail below with reference to embodiments, but these should not be construed as limiting the scope of protection of this invention. Any modifications or substitutions made to the methods, steps, or conditions of this invention without departing from the spirit and substance of this invention are within the scope of this invention.

[0025] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0026] The barley material used in this invention can be obtained from the Institute of Crop Sciences, Zhejiang University. All biochemical reagents used in this invention are commercially available.

[0027] SEQ ID NO.3: The sequence GATGAGCTTCGTGTCGGCCTTCGGCGAGTGCGTCGAGTACKCCTTCTTCATCGCCATGGACCTCGTCATGATCAGGCGCGGGGTCAGGCGGGAGAGGGCGCTGCTGCTGAGGGAAGGCGGCGGCGGCGAGGGGAAGGAGGAGGAGGAGGAGGAGGCGAGGTGAGGAGGATCCGGGCGGACCGGGTGATGCGGCTCAT contains an artificially introduced mismatched base AG at positions 36-37.

[0028] SEQ ID NO.4: The molecular marker is located at 41 bp in this sequence, exhibiting a T / G base difference.

[0029] Example 1 (1) Test materials Using 245 barley germplasm resources for brewing as materials, the barley was planted at Zhejiang University's Zijingang Campus, Jingshan Agricultural Experiment Station, and Yuyao Agricultural Experiment Station in 2022-2023. After the seeds were harvested at normal maturity, germination tests were conducted.

[0030] (2) Characteristic determination Fifty seeds were spread evenly on a petri dish containing two layers of filter paper, and 5 mL of deionized water was added. A germination test was conducted in a dark incubator at 22°C. Three replicates were set up for each variety. Germination vigor was characterized here as the germination rate of barley seeds after 72 hours, with the radicle protruding from the seed coat as the criterion for germination. The germination rate after 72 hours was statistically analyzed.

[0031] (3) GWAS analysis and SNP molecular marker determination Combining the above germination phenotype data and the whole genome resequencing data of this population, GWAS analysis was performed using the EMMAX model. The results showed that a SNP marker located on chromosome 2 was significantly associated with the germination phenotype. The SNP was located at base 569092409 on barley chromosome 2. This SNP site had a T / G difference. The genomic sequence fragment where this SNP site is located is shown in SEQ ID NO.4.

[0032] Example 2 (1) Test materials Eight barley samples were used as materials to determine germination vigor and analyze the target region S2H_569092409. Germination vigor was defined as the germination rate of barley seeds after 72 hours of germination, with the radicle protruding from the seed coat as the criterion for germination. The specific results are shown in Table 1, which includes four samples with high germination vigor and four samples with low germination vigor.

[0033] Table 1. Germination and enzyme digestion results of 8 barley germplasm materials Group barley germplasm SNP 72h Germination rate (%) Enzyme digestion status 1 Post 2 TT 96 Cut 2 haruna nijo TT 96 Cut 3 zhong da mai TT 94 Cut 4 Copeland TT 94 Cut 5 Yangsi Wheat No. 1 GG 48 Uncut 6 Zhejiang Agricultural University 12 GG 66 Uncut 7 lakhan GG 72 Uncut 8 Zhejiang University No. 9 GG 80 Uncut (2) Obtaining SNP markers Based on the SNP site information and the barley whole genome sequence information, dCAPS marker primers were developed. The upstream primer F is 5'-GATGAGCTTCGTGTCGGCCTTCGGCGAGTGCGTCGAGTAC-3' (SEQ ID NO.1); the downstream primer R is 5'-ATGAGCCGCATCACCCGGTCCGCCCGGATCCTCCTCACCT-3' (SEQ ID NO.2). The amplified fragment size is 195 bp, and the sequence is shown in SEQ ID NO.3. The SNP is located at position 41 bp of the amplified fragment. The following technique was used to detect the variation at position 569092409 of barley chromosome 2.

[0034] (3) DNA extraction DNA was extracted from fresh leaves during the seedling stage using the CTAB method. The detailed steps are as follows: A) Take about 3-5 g of young barley leaves, add CTAB preheated at 65℃ and grind, then bathe in a 65℃ water bath for 10 min, shaking gently 3-5 times during the process. B) Add an equal volume of chloroform:isoamyl alcohol (24:1) solution and shake well; centrifuge at 12000 rpm for 5 min, and transfer the supernatant into a new centrifuge tube; C) Add 2 / 3 volume of ice-cold isopropanol, shake well, and let stand at -20℃ for 20 min to precipitate DNA; D) Centrifuge at 12000 rpm for 5 min, discard the supernatant; wash once each with 75% and 100% ethanol, air dry, and dissolve in distilled water. Store at -20℃ until use.

[0035] (4) PCR The PCR amplification reaction system consisted of: 12.5 μL KOD One PCR Master Mix, 1 μL each of 10 μmol / L Primer, 1 μL 100 ng / μL template DNA, 9.5 μL sterile water, and a total reaction volume of 25 μL.

[0036] The PCR reaction was performed on a PCR instrument. The reaction program was as follows: 98℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 65℃ annealing for 5 s, 68℃ extension for 1 s, 30 cycles; 68℃ extension for 5 min, and storage at 4℃.

[0037] (5) Restriction endonuclease digestion Eight samples were digested with Sca I restriction endonuclease. The digestion system consisted of: 0.4 μL Sca I, 2 μL PCR product, 1 μL rCutSmart™ Buffer, and 6.6 μL sterile water. Digestion was carried out in a water bath at 37°C for 2 h.

[0038] The enzyme digestion products were separated by electrophoresis on a 3% agarose gel, and the results are as follows: Figure 1 As shown in (a). SNP genotyping is divided into two groups: the T type (high germination activity) with a 157 bp band and the G type (low germination activity) with only a 195 bp band. A bar chart is created based on the germination phenotypic data, as shown below. Figure 1 As shown in (b), the germination rate of the T-type barley genotype was significantly higher than that of the G-type barley genotype.

[0039] The above results demonstrate that the molecular markers prepared in this invention can be applied to marker-assisted selection of barley seed germination activity, thereby improving the accuracy and efficiency of selection.

Claims

1. A molecular marker associated with barley seed germination activity, characterized in that, The molecular marker is a single nucleotide polymorphism (SNP) site located on the barley genome; The SNP site corresponds to position 41 of the genome sequence shown in SEQ ID NO.4; The SNP site is located at position 569092409 on the barley chromosome; and there is a T / G base difference at this physical position.

2. The molecular marker related to barley seed germination activity as described in claim 1, characterized in that, The molecular marker is located on barley chromosome 2; The full-sequence version of the barley reference genome is Morex_V3.

3. The molecular marker related to barley seed germination activity as described in claim 1, characterized in that, The germination vigor was characterized by the germination rate of barley seeds over 72 hours.

4. The molecular marker related to barley seed germination activity as described in claim 1, characterized in that, The primer pair sequences used to amplify the molecular marker are as follows: Upstream primer F: 5'-GATGAGCTTCGTGTCGGCCTTCGGCGAGTGCGTCGAGTAC-3'; Downstream primer R: 5'-ATGAGCCGCATCACCCGGTCCGCCCGGATCCTCCTCACCT-3'; The amplified product is 195 bp, and its sequence is shown in SEQ ID NO.3, where the 36th-37th bp is an artificially introduced mismatched base AG.

5. A primer pair for amplifying the molecular marker according to any one of claims 1 to 3, characterized in that, The primer pair sequences are as follows: Upstream primer F: 5'-GATGAGCTTCGTGTCGGCCTTCGGCGAGTGCGTCGAGTAC-3'; Downstream primer R: 5'-ATGAGCCGCATCACCCGGTCCGCCCGGATCCTCCTCACCT-3'.

6. A test kit, characterized in that, The kit contains the primer pair as described in claim 5.

7. The use of the molecular marker as described in any one of claims 1 to 4, or the primer pair as described in claim 5, or the detection kit as described in claim 6, in any of the following: (1) Identification, selection and improvement of barley seed germination vigor; (2) Early prediction of barley seed germination vigor; (3) Molecular marker-assisted breeding of barley; (4) Screening or breeding high-quality barley for brewing.

8. A method for screening barley germplasm with different germination activators, characterized in that, Includes the following steps: (1) Extract genomic DNA from barley plants; (2) Using the genomic DNA described in step (1) as a template, perform PCR amplification using the primer pair; (3) Use restriction endonucleases to perform genotyping and analysis of the test samples based on electrophoretic bands; If the base at the SNP site is of type T, then the enzyme digestion is successful, and the barley plant to be tested is a material with high seed germination activity. If the base at the SNP site is of type G, the enzyme digestion will fail, and the barley plant to be tested will be a material with low seed germination activity. The restriction endonuclease includes ScaⅠ.

Images