Saccharomyces cerevisiae engineering strain with high yield of cyclic terpenes, construction method and application

By performing gene editing and promoter optimization in Saccharomyces cerevisiae, a high-yield engineered strain of Saccharomyces cerevisiae producing cycloterpenes was constructed, solving the problems of low natural content and difficulty in chemical synthesis of cycloterpenes, and realizing efficient biosynthesis and stable industrial production.

CN122146488APending Publication Date: 2026-06-05RES INST OF CHEM DEFENSE PLA ACAD OF MILITARY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610266753.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-05
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Cycloterpenes are present in very low amounts in their natural hosts and are difficult to synthesize chemically, making it difficult to obtain them on a large scale.

Method used

By using CRISPR/Cas9 gene editing technology to knock out and overexpress multiple genes in the Saccharomyces cerevisiae JCR27 host, the promoters of key genes were optimized, and a microbial cell factory for the efficient synthesis of cyclic terpenes was constructed.

Benefits of technology

The efficient biosynthesis of cycloterpenes was achieved, with a yield of 905.83±84.61 mg/L in shake flask fermentation and a yield of 16.29±0.12 g/L in fermenter. The morphology was stable, which is conducive to industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146488A_ABST
    Figure CN122146488A_ABST
Patent Text Reader

Abstract

The application relates to the field of biotechnology, and particularly discloses a Saccharomyces cerevisiae engineering strain LSc274 with high yield of sirenol and a construction method and application thereof, aiming to solve the problems of low content of sirenol in a natural host, difficulty in chemical synthesis, and low yield of biosynthesis. ROX1 、 EXG1 、 DPP1 、 TRP1 , the GAL80 gene is knocked out in a Saccharomyces cerevisiae host, and meanwhile, sirenol synthase coding genes, tHMG1, EGR20, TRP1, URA3, LEU2 and HIS3 genes are highly expressed. The yield of the constructed engineering strain reaches 905.83+33.41 mg / L in a flask fermentation, and the yield reaches 16.29+0.12 g / L in a 5 L fermenter, which is the highest yield reported at present, and the engineering strain has the application prospect of large-scale production of sirenol.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to an engineered strain of *Saccharomyces cerevisiae* that produces high levels of cyclic terpenes, its construction method, and its applications. Background Technology

[0002] Parcyclic terpenes are tricyclic sesquiterpenes, first discovered in Streptomyces, and are precursors to the antibiotic pentylpropionate. Parcyclic terpenes are present in extremely low amounts in their natural hosts, making it difficult to obtain sufficient quantities. Furthermore, their complex stereostructures hinder their chemical synthesis. However, advancements in synthetic biology, particularly the construction of microbial cell factories, have enabled the acquisition of these target compounds, presenting a significant opportunity for the large-scale application of parcyclic terpenes. Summary of the Invention

[0003] (a) Technical problems to be solved This invention aims to address the problem of low natural host content and high difficulty in chemical synthesis of cyclic terpenes in existing technologies, which makes it difficult to obtain them on a large scale. It provides a high-yield engineered strain of Saccharomyces cerevisiae for cyclic terpenes, as well as related construction methods and applications, to achieve efficient biosynthesis of cyclic terpenes.

[0004] (II) Technical Solution To address the aforementioned problems, this invention proposes the following technical solution: The core idea of ​​this invention is to use CRISPR / Cas9 gene editing technology to perform multi-gene knockout and overexpression in the Saccharomyces cerevisiae JCR27 host, while optimizing the promoters of key genes, to construct a highly efficient microbial cell factory for synthesizing cyclic terpenes.

[0005] The specific technical solution is as follows: A high-yield cyclic terpene-producing *Saccharomyces cerevisiae* strain, LSc274, was developed by introducing expression box 1 (sequence 1) into a *Saccharomyces cerevisiae* host: knockout of the ROX1 gene (encoding the ROX1 transcription factor) and simultaneous overexpression of EGR20 (encoding farnesene pyrophosphate synthase), tHMG1 (encoding HMG-CoA reductase), and pentS gene (encoding cyclic terpene synthase); knockout of the EXG1 gene (encoding glucosidase) and simultaneous overexpression of tHMG1 and pentS genes; and knockout of the DPP1 gene (encoding diacylglycerol pyrophosphatase) into expression box 3 (sequence 3). The expression of tHMG1 and pentS genes was simultaneously overexpressed. The expression box 4 (sequence 4) was then transferred to achieve TRP1 gene knockout (o-aminobenzoic acid ester isomerase) and simultaneous overexpression of tHMG1 and pentS genes. The expression box 5 (sequence 5) was then transferred to replace the promoter of the ERG9 gene (encoding squalene synthase) with the HXT1 promoter (encoding glucose transporter). The expression box 6 (sequence 6) was then transferred to achieve GAL80 gene knockout (encoding galactose negative regulator protein) and overexpression of TRP1, URA3 (encoding orotidine 5-phosphate decarboxylase), LEU2 (encoding isopropyl malate dehydrogenase), and HIS3 (encoding histidine synthase) genes.

[0006] The engineered strain of the cycloterpene is the JCR27 strain derived from the Saccharomyces cerevisiae CEN.PK2-1D strain.

[0007] The expression frames mentioned are all integrated into the chromosome of Saccharomyces cerevisiae for expression.

[0008] The method for constructing the engineered strain of Saccharomyces cerevisiae as described above includes the following steps: 1) Construction of target expression cassettes and recombinant plasmids: Design specific primers, amplify the relevant expression genes, promoters and terminators in each expression cassette by PCR, and construct recombinant expression plasmids p1, p2, p3, p4, p5, p6; 2) Construction of cycloterpene-synthesizing strains: Plasmids p1, p2, p3, p4, p5, and p6 were linearized by enzyme digestion, and the fragments containing the expression cassettes of the target expression were recovered; p1 was transformed into Saccharomyces cerevisiae JCR27, and the target fragment was integrated into the chromosome of the Saccharomyces cerevisiae genome using CRISPR / Cas9 gene editing to obtain LSC1; p2 was transformed into LSC1 in the same way to obtain strain LSC2; p3 was transformed into LSC2 in the same way to obtain strain LSC3; p4 was transformed into LSC3 in the same way to obtain strain LSC4; p5 was transformed into LSC4 in the same way to obtain strain LSC119; p6 was transformed into LSC119 in the same way to obtain strain LSC247, which is the engineered strain expressing cycloterpenes.

[0009] 3) Shake-flask fermentation of the strain: The recombinant strain was inoculated into 5 mL of medium and cultured overnight at 30 ℃ and 220 r / min. Then, it was transferred to 50 mL of medium with an initial OD600 value of 0.1-0.2. 10% volume of the covering agent n-decane was added to achieve in-situ extraction. After fermentation at 30 ℃ and 220 r / min for 72 h, the upper organic phase was taken for product and cyclic terpene detection. 4) Fermentation in a fermenter: A recombinant bacterial strain was inoculated into 5 mL of YPD medium and cultured overnight as a seed culture. This seed culture was then transferred to 200 mL of YPD medium and cultured overnight before being transferred to a fermenter. The fermentation temperature was 30℃. During fermentation, ammonia was introduced to maintain the pH at approximately 5.0. Glucose was fed to the fermenter for the first 24 hours. After 24 hours, a 10% IPM cover was applied, and the feed was switched to sucrose. The ethanol concentration was controlled at 1-5 g / L. Product changes were monitored; fermentation was stopped when product growth ceased.

[0010] This invention discloses the construction of an engineered strain of *Saccharomyces cerevisiae* containing cycloterpenes. The shake flask yield of cycloterpenes in this engineered strain is 905.83±84.61 mg / L, and the fermenter yield is 16.29±0.12 g / L, which is the highest yield reported to date and has development potential.

[0011] (III) Beneficial Effects 1. This invention constructs a high-yield polycyclic terpene-producing Saccharomyces cerevisiae strain LSc247 through the synergistic regulation of multiple gene knockout and overexpression. The yield of polycyclic terpenes in shake flask fermentation reached 905.83±84.61 mg / L, and the yield in fermenter fermentation was even higher at 16.29±0.12 g / L, which is the highest yield reported to date, significantly improving the biosynthetic efficiency of polycyclic terpenes.

[0012] 2. This invention integrates all gene modifications into the chromosome of Saccharomyces cerevisiae through homologous recombination, avoiding the use of unstable free plasmids, thus ensuring the stability of the engineered strain's traits during passage and fermentation, which is beneficial for industrial production.

[0013] 3. This invention provides a feasible technical solution for the large-scale production of cyclopene terpenes. The produced cyclopene terpenes can be used as a precursor for the antibiotic pentylpropionate, laying the foundation for the research and development and production of related pharmaceutical products and having broad industrial application prospects. Attached Figure Description

[0014] Figure 1 The diagram shows the structures of the recombinant expression plasmids p1(A), p2(B), p3(C), p4(D), p5(E), and p6(F). Figure 2 A flowchart illustrating the construction process of engineered strains; Figure 3 A statistical chart showing the yield of cyclic terpenes from shake-flask fermentation of engineered strains; Figure 4 This is a statistical graph showing the change in the yield of cycloterpenes fermented by engineered strains in a fermenter over time. Detailed Implementation

[0015] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0016] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0017] The following embodiments further illustrate the present invention so that those skilled in the art can better understand and implement it, but the embodiments are not intended to limit the present invention.

[0018] Example 1: Construction of recombinant expression plasmids p1, p2, p3, p4, p5, and p6 cycloterpene synthase encoding gene pentS The codons of Saccharomyces cerevisiae were optimized and used as templates in the plasmid construction process. The remaining genes, as well as promoters, terminators, and homologous arm sequences, were amplified using the Saccharomyces cerevisiae genome as templates.

[0019] 1) Construction of recombinant expression plasmid p1: Using a high-fidelity enzyme (Phanta), primers 1-F / 1-R, 2-F / 2-R, 3-F / 3-R, 4-F / 4-R, 5-F / 5-R, 6-F / 6-R, 7-F / 7-R, and 8-F / 8-R were used to obtain the left homologous arm of the ROX1 gene, the CYC1 terminator, the cyclic terpene synthase gene, the GAL1-GAL10 promoter, the farnesene pyrophosphate synthase gene, the GAL10-GAL7 terminator-promoter, the HMG-CoA reductase gene, the ADH1 terminator, and the right homologous arm of the ROX1 transcription factor gene. These fragments were then ligated together using OE PCR and cloned into the PRS426 vector to obtain plasmid p1. Figure 1 (A).

[0020] 1-F: acaaaagctctagtagtttaaaagtcatgtagccgcctagcgagcctgggt 1-R: tgggacgctcgaaggctttaatttgcgtagtgctgtctgaacagaataaatgcgttct 2-F: agaacgcatttattctgttcagacagcactacgcaaattaaagccttcgagcgtccca 2-R: acaggccccttttcctttgtcgatatc 3-F: gatatcgacaaaggaaaaggggcctgtttaatgagctgaagaacctaattcttcc 3-R: atgccacaagatgttgattttcatattcc 4-F: tggaatatgaaaatcttgtggcatttatattgaattttcaaaaattcttact 4-R:tatagttttttctccttgacgttaaagt 5-F: actttaacgtcaaggagaaaaaactataatggcttcagaaaaagaattaggagagag 5-R:tttcaagaaggatagtaagctggcaaactatttgcttctcttgtaaactttgttcaag 6-F:cttgaacaagagaagcaaatagtttgccagcttactatccttcttgaaa 6-R:ttttgagggaatattcaactgttttt 7-F: aaaaacagttgaatattccctcaaaaatggttttaaccaataaaacagtcatttc 7-R:acaccttgagcggtccattcgtctattaagatccggtagaggtgtggtcaataagagc 8-F: gctcttattgaccacacctctaccggatcttaatagacgaatggaccgctcaaggtgt 8-R: cgtcgcgccattcgccattcaggctgcgcaactgtttaaacgagaaactaggcta 2) Construction of recombinant expression plasmid p2: Using a high-fidelity enzyme (Phanta), primers 9-F / 9-R, 10-F / 10-R, 11-F / 11-R, 12-F / 12-R, 13-F / 13-R, 14-F / 14-R, and 15-F / 15-R were used to obtain the left homologous arm of the EXG1 gene, the CYC1 terminator, the HMG-CoA reductase encoding gene, the GAL1-GAL10 promoter, the cyclic terpene synthase gene, the PGK1 terminator, and the right homologous arm of the EXG1 gene, respectively. These fragments were ligated together by OE PCR and cloned into the PRS426 vector to obtain plasmid p2. Figure 1 (B).

[0021] 9-F: caaaagctggagctctagtagtttaaactaatagtacgtaatgtagggagcctgcttc 9-R:tttgggacgctcgaaggctttaatttgcttgacaccacggattggttctccgagggaa 10-F:ttccctcggagaaccaatccgtggtgtcaagcaaattaaagccttcgagcgtcccaaa 10-R: acaggccccttttcctttgtcgatatc 11-F: gatatcgacaaaggaaaaggggcctgtttaggatttaatgcaggtgacggaccccatc 11-R:atggtttttaaccaataaaacagtcatt 12-F: aatgactgttttattggttaaaaccatttatattgaattttcaaaaattcttactt 12-R:tatagttttttctccttgacgttaa 13-F:tttaacgtcaaggagaaaaaactataatgccacaagatgattttcatattcca 13-R:ttaatgagctgaagaacctaattcttc 14-F: gaagaattaggttcttcagctcattaaattgaattgaattgaaatcgatagatca 14-R: aatgtatggttcaagaagtaaccaaccaaacgaacgcagaattttcgagttattaaac 15-F: gtttaataactcgttcgtttttggttggttatacttcttgaaccatacatt 15-R:ccattcgccattcaggctgcgcaactgttgtttaaattgtaacaccagataatccaa 3) Construction of recombinant expression plasmid p3: Using a high-fidelity enzyme (Phanta), primers 16-F / 16-R, 17-F / 17-R, 18-F / 18-R, 19-F / 19-R, 20-F / 20-R, 21-F / 21-R, and 22-F / 22-R were used to obtain the left homologous arm of the DPP1 gene, the CYC1 terminator, the HMG-CoA reductase encoding gene, the GAL1-GAL10 promoter, the cyclic terpene synthase gene, the PGK1 terminator, and the right homologous arm of the DPP1 gene, respectively. These fragments were ligated together using OE PCR and cloned into the PRS426 vector to obtain plasmid p3. Figure 1 (C).

[0022] 16-F:caaaagctggagctctagtagtttaaacttttattgtttcctgttgtttttctctttc 16-R:tttggggacgctcgaaggctttaatttgcgaggatcccggatgaggaattacatccttt 17-F:aaaggatgtaattcctcatccgggatcctcgcaaattaaagccttcgagcgtcccaaa 17-R: acaggccccttttcctttgtcgata 18-F: atatcgacaaaggaaaaggggcctgtttaggatttaatgcaggtgacggaccccatc 18-R:atggttttaaccaataaaacagtcatt 19-F:aatgactgttttattggttaaaaccatttatattgaattttcaaaaattcttact 19-R:Tatagttttttctccttgacgttaaag 20-F:ctttaacgtcaaggagaaaaaactataatgccacaagatgttgattttcatattcc 20-R:ttaatgagctgaagaacctaattct 21-F: gaagaattaggttcttcagctcattaaattgaattgaattgaaatcgatagatcaa 21-R:ttcagatgtcaccctggaggaagcagtcacaacgaacgcagaattttcgagttattaa 22-F: tttaataactcgaaaattctgcgttcgttgtgactgcttcctccagggtgacatctga 22-R:ccattcgccattcaggctgcgcaactgttgtttaaactttgtcgatcggttgtatatt 4) Construction of recombinant expression plasmid p4: Under the action of high-fidelity enzyme (Phanta), primers 23-F / 23-R, 24-F / 24-R, 25-F / 25-R, 26-F / 26-R, 27-F / 27-R, 28-F / 28-R, and 29-F / 29-R were used to obtain... TRP1 Left homologous arm of the gene, CYC1 terminator, HMG-CoA reductase encoding gene, GAL1-GAL10 promoter, cyclic terpene synthase gene, PGK1 terminator. TRP1The right homologous arm of the gene was used to ligate these fragments together using OE PCR, and the resulting fragments were cloned into the PRS426 vector to obtain plasmid p4. Figure 1 (D).

[0023] 23-F:gggaacaaaagctggagctctagtagtttaaacctctattctgaaaacggaagagga 23-R: tgggacgctcgaaggctttaatttgcccaaaacatcctccttaggttgattac 24-F:gcaaattaaagccttcgagcgtcccaaa 24-R: acaggccccttttcctttgtcgatatc 25-F: gatatcgacaaaggaaaaggggcctgtttaggatttaatgcaggtgacggaccccatc 25-R:atggttttaaccaataaaacagtcatt 26-F: aatgactgttttattggttaaaaccatttatattgaattttcaaaaattcttacttt 26-R:Tatagttttttctccttgacgttaa 27-F: Tatactttaacgtcaaggagaaaaaactataatgccacaagatgttgattttcatatt 27-R:gatctatcgatttcaattcaattcaatttaatgagctgaagaacctaattcttccaag 28-F:attgaattgaattgaaatcgataga 28-R:aacgaacgcagaattttcgagttattaaac 29-F: gtttaataactcgaaaattctgcgttcgttgaaaatgttggtgatgcgcttagatta 29-R:ggctgcgcaactgttgtttaaacgtttaaacctttcaagaattccacatgttaaaat 5) Construction of recombinant expression plasmid p5: Using the high-fidelity enzyme Phanta, the left homologous arm of pERG9, the pHXT1 promoter sequence, and the right homologous arm of pERG9 were obtained using primers 30-F / 30-R, 31-F / 31-R, and 32-F / 32-R, respectively. These fragments were then ligated together using OE PCR and cloned into the Blunt vector to obtain plasmid p5. Figure 1 (E).

[0024] 30-F: gtttaaacgttccgattgcagttggaatgcaaatg 30-R: caggaggggggaattatataaaagaaaaagggcaaagcaaataggatggtaag 31-F: gctttgccctttttcttttatataattcccccctcctgaagcaaa 31-R: ggatgcaatgccaattgtaatagctttcccatgattttacgtatatcaactagttgac 32-F: atgggaaagctattacaattggcattgcatcc 32-R: gtttaaacttgatttcaaaattaaatagcaggtagtac 6) Construction of recombinant expression plasmid p6: Under the action of high-fidelity enzyme (Phanta), primers 33-F / 33-R, 34-F / 34-R, 35-F / 35-R, 36-F / 36-R, 37-F / 37-R, and 38-F / 38-R were used to obtain... GAL80 Left homologous arm of the gene, TRP1 Gene expression cassettes URA3 Gene expression cassettes LEU2 Gene expression cassettes HIS3 Gene expression cassettes GAL80 The right homologous arm of the gene was used to ligate these fragments together using OE PCR, and the resulting plasmid was cloned into the Blunt vector to obtain plasmid p6. Figure 1 (F).

[0025] 33-F: caatttggcacctgcataccccatttc 33-R:cttcctatattatatatagtaatgtcgtttcttgttgtagtccatgacggggagtg 34-F: aacgacattactatatataataatataggaag 34-R:ccgaggcataaaaaaatatagagtgtactagcctgatgcggtattttctccttacgcatct 35-F: cgtaaggagaaaataccgcatcaggctagtacactctatatttttttatgcctcgg 35-R: aaagaataaaaaaaaaatgatgaattgaaatctgtgcggtatttcacaccgcatagat 36-F:ttcaattcatcattttttttttattcttt 36-R:cctgatgcggtattttctccttacgcatct 37-F: agatgcgtaaggagaaaataccgcatcaggaactgtgggaatactcaggtatcgtaa 37-R:attaggaatcatagtttcatgattttctg 38-F: aaaaaggaggatgtaaaggaatacaggtaagcaaattgatactaatggctcaacgtg 38-R:aaaatatgacccccaatatgagaaattaaggct Example 2: Construction of a high-yield engineered strain of *Saccharomyces cerevisiae* producing cycloterpenes The strain construction process is as follows Figure 2 As shown.

[0026] plasmid p1 as an enzyme Mss I was linearized by enzyme digestion, and the fragment containing the expression cassette of the target expression was recovered and introduced into Saccharomyces cerevisiae JCR27. It was cultured on a medium lacking uracil at 28°C for three days. Correct transformants were selected and transferred to YPD medium and shaken at 30°C and 220 rpm for 8 hours. Then, clones that could grow on a medium without uracil but could not grow on a medium containing uracil and 5-FOA were selected, preserved, and named LSC1.

[0027] plasmid p2 as an enzyme MssI was linearized by enzyme digestion, and the fragment containing the expression cassette of the target expression was recovered and introduced into LSc1. The culture was carried out on a medium lacking uracil at 28°C for three days. The correct transformants were selected and transferred to YPD medium and shaken at 30°C and 220 rpm for 8 hours. Then, clones that could grow on a medium without uracil but could not grow on a medium containing uracil and 5-FOA were selected, preserved, and designated as LSc2.

[0028] plasmid p3 as an enzyme Mss I was linearized by enzyme digestion, and the fragment containing the expression cassette of the target expression was recovered and introduced into LSc2. The culture was carried out on a medium lacking uracil at 28°C for three days. The correct transformants were selected and transferred to YPD medium. The culture was carried out at 30°C and 220 rpm for 8 hours. Then, clones that could grow on a medium without uracil but could not grow on a medium containing uracil and 5-FOA were selected, preserved, and designated as LSc3.

[0029] plasmid p4 with enzyme Mss I was linearized by enzyme digestion, and the fragment containing the expression cassette of the target expression was recovered and introduced into LSc1. The culture was carried out on a medium lacking uracil at 28°C for three days. The correct transformants were selected and transferred to YPD medium and shaken at 30°C and 220 rpm for 8 hours. Then, clones that could grow on a medium without uracil but could not grow on a medium containing uracil and 5-FOA were selected, preserved, and designated as LSc4.

[0030] plasmid p5 as an enzyme Mss I was linearized by enzyme digestion, and the fragment containing the expression cassette of the target expression was recovered and introduced into the above LSc1. It was cultured on a medium lacking uracil at 28°C for three days. The correct transformants were selected and transferred to YPD medium and shaken at 30°C and 220 rpm for 8 hours. Then, clones that could grow on a medium without uracil but could not grow on a medium containing uracil and 5-FOA were selected, preserved, and named LSc113.

[0031] plasmid p6 as an enzyme Mss I was linearized by enzyme digestion, and the fragment containing the expression cassette of the target expression was recovered and introduced into LSc113. The culture was carried out on a medium lacking uracil, tryptophan, leucine and histidine at 28°C for three days. The correct transformant was selected, preserved and recorded as LSc247, which is the engineered strain expressing cycloterpenes.

[0032] Example 3: Shake-flask fermentation and yield analysis of a *Saccharomyces cerevisiae* strain expressing cycloterpenes. Single clones of engineered bacteria LSc1, LSc2, LSc3, LSc4, LSc119, and LSc247 were picked from the plate and inoculated into 3 ml of YPD medium. The culture was incubated overnight at 30°C to serve as the seed culture. The seed culture medium was diluted and the OD was measured. When the final OD was 0.1, the culture was transferred to 50 ml of fermentation medium. When the OD reached 0.8, 1% galactose and 5 ml of n-decane were added. The culture was labeled and incubated at 30°C and 220 rpm for three days.

[0033] The fermented sample was then removed, and the bacterial culture was poured into a 50 ml centrifuge tube. The tube was centrifuged at 4000 rpm for 7 min, and the upper organic phase was collected into a 10 ml centrifuge tube. The organic phase was diluted with n-hexane according to the expected yield. After dilution, the diluted solution was centrifuged at 13000 rpm at 4 degrees Celsius for 10 min, and then analyzed by GC-MS to calculate the yield. Figure 3 As shown, the yield of cycloterpenes in LSc1 was 36.5 ± 4.27 mg / L. Through modification, the yield of cycloterpenes in LSc247 was increased to 905.83 ± 33.41 mg / L, showing a good yield improvement effect, indicating that the strain modification strategy has good applicability.

[0034] Example 4: Fermentation in a fermenter using a Saccharomyces cerevisiae strain expressing cycloterpenes. Recombinant strains were inoculated into 5 mL of YPD medium and cultured overnight at 30°C and 220 rpm as seed culture. The culture was then transferred to 200 mL of CSM medium and cultured overnight at 30°C and 220 rpm. All samples were then transferred to a fermenter. The initial culture medium in the fermenter was 2 L of CSM, and the fermentation temperature was 30°C. During fermentation, the pH was maintained at approximately 5.0 by bubbling ammonia. Glucose was fed during the first 24 hours of fermentation. After 24 hours, 10% IPM was added as a covering agent, and the feed was switched to sucrose. The ethanol concentration was maintained at approximately 5 g / L. Product changes were monitored, and fermentation was stopped when product growth ceased. The highest yield of cycloterpenes was achieved in the fermenter at 97.5 h of fermentation, reaching 16.29 ± 0.12 g / L, which is the highest yield reported to date. Figure 4 As shown.

Claims

1. A highly efficient engineered strain of *Saccharomyces cerevisiae* producing cycloterpenes, characterized in that, By constructing recombinant plasmids p1, p2, p3, p4, p5, and p6, six expression cassettes were introduced into the Saccharomyces cerevisiae host and integrated into the Saccharomyces cerevisiae chromosome for expression. The sequences of the six expression boxes are sequence 1, sequence 2, sequence 3, sequence 4, sequence 5, and sequence 6, respectively. The host strain of *Saccharomyces cerevisiae* was *Saccharomyces cerevisiae* CEN.PK2-1D, specifically strain JCR27. The vector backbone for recombinant plasmids p1, p2, p3, and p4 was PRS426, while the vector backbone for recombinant plasmids p5 and p6 was Blunt. Knockout was achieved using these expression cassettes. ROX1, EXG1, DPP1, TRP1, GAL80 The gene, which is also highly expressed by a galactose-inducible promoter and encodes a cyclic terpene synthase gene, is also present. pentS HMG-CoA reductase encoding gene tHMG1 Farnesene pyrophosphate synthase encoding gene EGR20 , anthranilate isomerase encoding gene TRP1 orotinoside 5-phosphate decarboxylase encoding gene URA3 Isopropyl malate dehydrogenase encoding gene LEU2 and histidine synthase encoding genes HIS3 .

2. The engineered strain of *Saccharomyces cerevisiae* according to claim 1, characterized in that... Expression box 1 implements knockout ROX1 Genes, and overexpression EGR20, tHMG1, pentS Gene.

3. The engineered strain of *Saccharomyces cerevisiae* according to claim 1, characterized in that... Expression box 2 implements knockout EXG1 Genes, and high expression at the same time tHMG1, pentS Gene.

4. The engineered strain of *Saccharomyces cerevisiae* according to claim 1, characterized in that... Expression box 3 implements knockout DPP1 Genes, and high expression at the same time tHMG1, pentS Gene.

5. The engineered strain of *Saccharomyces cerevisiae* according to claim 1, characterized in that... Expression box 4 enables knockout TRP1 Genes, and high expression at the same time tHMG1, pentS Gene.

6. The engineered strain of *Saccharomyces cerevisiae* according to claim 1, characterized in that... Expression box 5 will ERG9 Gene promoter replacement HXT1 Promoter.

7. The engineered strain of *Saccharomyces cerevisiae* according to claim 1, characterized in that... Expression box 6 implements knockout GAL80 Genes, and high expression at the same time TRP1, URA3, LEU2, HIS3 Gene.

8. A method for constructing an engineered strain of *Saccharomyces cerevisiae* as described in claim 1, characterized in that... Includes the following steps: Recombinant plasmids p1, p2, p3, p4, p5, and p6 containing six expression frames were constructed. After linearization by enzyme digestion, each recombinant plasmid was sequentially transformed into strain JCR27 via CRISPR / Cas9 gene editing. The engineered strains were obtained after screening. The engineered strains were then cultured by shake-flask fermentation or fermenter fermentation.

9. The construction method according to claim 8, characterized in that... The shake-flask fermentation conditions were 30℃ and 220 r / min for 72 h, and 10% volume of n-decane was added as a covering agent for in-situ extraction.

10. The construction method according to claim 8, characterized in that... The fermentation conditions in the fermenter were 30℃, pH was controlled at around 5.0, glucose was added within 24 hours, and after 24 hours, 10% IPM was added as a covering agent and sucrose was switched to be added. The ethanol concentration was controlled at 1-5 g / L.