A method for constructing a 5'-end single-cell platform zero-cross contamination CRISPR sequencing library, a primer combination and application thereof

By designing specific CRISPR-RT primers and SPRI magnetic bead sorting technology on a 5' single-cell platform, we can achieve simultaneous reverse transcription and separation of sgRNA and transcriptome, construct independent libraries, solve the problems of cumbersome operation and cross-contamination in Perturb-seq, improve the accuracy of sequencing data and reduce costs.

CN122146848APending Publication Date: 2026-06-05XI AN JIAOTONG UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
XI AN JIAOTONG UNIV
Filing Date
2026-03-05
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

The existing 5' end single-cell Perturb-seq technology involves a cumbersome process for constructing sgRNA sequencing libraries, which is prone to introducing mutations and cross-contamination, affecting data accuracy.

Method used

Specific CRISPR-RT primers were used to simultaneously recognize mRNA and sgRNA during the reverse transcription step. Transcriptome-cDNA and sgRNA-cDNA were separated by SPRI magnetic bead sorting technology, and independent libraries were constructed by one-step PCR.

Benefits of technology

Simplify the operation process, reduce the risk of mutation, avoid cross-contamination, ensure the accuracy and reliability of sequencing data, and reduce experimental costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146848A_ABST
    Figure CN122146848A_ABST
Patent Text Reader

Abstract

The application discloses a zero-cross contamination CRISPR sequencing library construction method suitable for a 5' end single cell platform, a primer combination and application, and belongs to the technical field of biology. The method is aimed at mammalian eukaryotic cells, and CRISPR-RT primers are designed based on sgRNA expression vector scaffold sequences to capture mRNA and sgRNA simultaneously in a reverse transcription step. Then, efficient separation of transcriptome cDNA and sgRNA-cDNA is realized through SPRI magnetic bead sorting, and one-step PCR amplification enrichment is adopted for sgRNA-cDNA, and sgRNA sequencing library is obtained after purification and quality inspection. The method realizes independent construction of transcriptome and sgRNA library, effectively avoids sequencing cross contamination, optimizes the traditional two-step PCR into one-step PCR, greatly reduces time and economic cost, simultaneously reduces the risk of base mutation, improves experimental accuracy, is completely suitable for a conventional 10*Genomics 5' end kit, does not need a special kit, is economical and practical, provides an efficient solution for single cell CRISPR sequencing library construction, and can be widely applied to the fields of functional gene screening, drug target discovery and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a method for constructing CRISPR sequencing libraries with zero cross-contamination adapted to the 5' end single-cell platform, primer set and application. Background Technology

[0002] CRISPR screening is a whole-genome or targeted functional genomics research method based on the CRISPR-Cas system. It involves constructing large-scale sgRNA libraries to systematically knock out, activate, or inhibit target genes or functional genomic elements (such as enhancers) at the cellular or organismal level. Combined with high-throughput sequencing or phenotypic analysis, it identifies key genes and regulatory elements associated with specific biological processes. This technology has been widely applied in research on tumor drug resistance mechanisms, immune cell function analysis, and drug target discovery. Traditional CRISPR screening relies on phenotypic readouts of population cells (such as cell viability and fluorescence intensity). Its resolution is limited by the average signal of mixed cell populations, making it difficult to distinguish functional differences caused by cellular heterogeneity and capture complex changes in transcriptional regulatory networks after perturbation. To overcome this limitation, researchers have developed a technique combining CRISPR screening with single-cell RNA sequencing, namely Perturb-seq. This technique introduces specific genetic perturbations into cells, followed by parallel sequencing of the transcriptome and its carried sgRNA information of individual cells, thereby establishing genotype-phenotype associations at single-cell resolution. Among them, Direct Capture Perturb-seq (DCPSQ), based on a 5' single-cell sequencing platform, has unique advantages in areas such as gene editing efficacy analysis and immune receptor sequence analysis due to its ability to preserve the 5' end information of transcripts, making it one of the most widely used implementation schemes. Existing DCPSQ technologies based on 5' single-cell platforms generally employ a multi-step PCR amplification strategy, i.e., a "two-step PCR" technique, when constructing sgRNA sequencing libraries. Its typical process includes: first, enriching the sgRNA-cDNA in the reverse transcription product using specific primers with partially universal sequences; then, introducing complete sequencing adapters and sample tag sequences using nested PCR. However, this technique has significant technical drawbacks in practical applications. On the one hand, the multi-step PCR process is not only cumbersome, time-consuming, and costly, but multiple amplifications can also introduce base mutations and PCR bias, thereby reducing the accuracy and reliability of sequencing data. On the other hand, existing methods typically employ a mixed processing or late primer sorting strategy when constructing transcriptome and sgRNA libraries. That is, after completing a common pre-amplification step, specific primers are used to enrich transcriptome and sgRNA sequences separately from the mixed library.This "mix first, then separate" approach carries a serious risk of cross-contamination: during library construction, free sgRNA molecules or sgRNA from lysed cells may be incorrectly labeled during the pre-amplification stage, leading to mismatches between cell tags and sgRNA information in the sequencing data (i.e., "cell tag crosstalk"), which directly affects the accuracy of downstream data analysis. In particular, it may lead to misleading conclusions when identifying indirect transcriptional regulatory effects caused by perturbations.

[0003] For single-cell multi-omics sequencing technology, existing research has proposed several improvement schemes. Patent application (publication number WO2024077439A1) discloses a method for constructing a single-cell transcriptome and chromatin accessibility dual-omics sequencing library. Through optimized design of template conversion oligomers (TSOs), it achieves the capture and coding ligation of messenger RNA 5' end information, while also being compatible with the acquisition of gRNA, BCR, and TCR sequence information. This method uses USTC-V-Seq technology, enabling the simultaneous acquisition of transcriptome 5' end information and chromatin accessibility information in the same single cell, providing a powerful tool for immune cell research. However, the core of this technical solution lies in solving the problem of compatible capture of multi-omics information. Its library construction process still follows the general paradigm of "multi-omics mixed processing - co-coding - late primer sorting." The acquisition of gRNA information requires a complete general process: reverse transcription → template conversion → pre-amplification → indexing PCR → final enrichment with specific primers. This "two-step" or "nested" strategy, which is essentially still a multi-step PCR approach, does not solve the technical problems of cumbersome steps, easy introduction of mutations, and high risk of cross-contamination in the sgRNA library construction process. Chinese patent application (publication number CN119506359A) discloses a novel method for constructing single-cell CRISPR screening libraries. This method expands the single-cell CRISPR screening range from protein-coding genes to non-coding RNA by inserting dual gRNA expression cassettes into the CROP-seq vector backbone, mainly solving the problems of difficult viral vector packaging and low titers. However, none of the above technical solutions involve optimizing the sgRNA library construction process itself, nor do they propose effective solutions to the specificity and cross-contamination issues of sgRNA capture in the 5' end single-cell platform.

[0004] In summary, while existing technologies have made significant progress in single-cell multi-omics sequencing and CRISPR screening applications, a dedicated method remains lacking for the sgRNA sequencing library construction process in Perturb-seq technology. This method simplifies the operational procedures, reduces the risk of mutation introduction, and fundamentally avoids cross-contamination. Particularly in the application scenario of 5' end single-cell sequencing platforms, achieving early physical separation of sgRNA-cDNA from transcriptome cDNA, and then directly obtaining a high-fidelity sgRNA sequencing library via one-step PCR, has become a pressing technical challenge in this field. Summary of the Invention

[0005] The existing 5' end single-cell Perturb-seq sgRNA library construction method, which employs multi-step PCR and a "mix-then-separate" strategy, suffers from technical problems such as cumbersome operation, easy introduction of mutations, high cost, and easy cross-contamination due to cell tag crosstalk, affecting data accuracy. The purpose of this invention is to provide a zero-cross-contamination CRISPR sequencing library construction method, primer combination, and application adapted to the 5' end single-cell platform.

[0006] To achieve the above objectives, the present invention employs the following technical solution: This invention provides a method for constructing CRISPR sequencing libraries with zero cross-contamination adapted to the 5' end single-cell platform, comprising: (1) Design and synthesize CRISPR-RT primers and sgRNA sequencing library preparation primers; (2) Add the CRISPR-RT primers to the reverse transcription system to reverse transcribe single-cell samples and obtain cDNA products; (3) The cDNA product obtained in step (2) was sorted by SPRI magnetic beads to separate transcriptome-cDNA and sgRNA-cDNA; (4) Using the sgRNA sequencing library primers designed in step (1), perform one-step PCR amplification on the sgRNA-cDNA obtained in step (3) to obtain the sgRNA sequencing library. (5) The sgRNA sequencing library obtained in step (4) is purified and quality checked.

[0007] In step (1), the nucleotide sequence of the CRISPR-RT primer is shown in SEQ ID NO: 1.

[0008] Preferably, the sequence structure of the CRISPR-RT primers includes a complementary sequence of the sgRNA scaffold region and a 10×Genomics reverse transcription primer sequence. In step (1), the nucleotide sequences of the sgRNA sequencing library preparation primers are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0009] Preferably, the primers for constructing the sgRNA sequencing library contain the P5 adapter sequence, P7 adapter sequence, index sequence, and reads sequence required for Illumina sequencing, and the index sequence can be replaced according to different sequencing channels.

[0010] In step (3), the SPRI magnetic bead sorting includes: the first sorting adsorbs transcriptome-cDNA onto magnetic beads and dissolves sgRNA-cDNA in the supernatant; the second sorting purifies the sgRNA-cDNA in the supernatant.

[0011] In step (4), the number of cycles for the one-step PCR amplification is 12-16, and the amount of PCR template added is 3-7 ng.

[0012] Preferably, the one-step PCR amplification cycle number is 14 cycles; the PCR template input amount is 5 ng.

[0013] The method is adapted to the 10×Genomics single-cell 5' end sequencing platform and can be performed in parallel with transcriptome library construction, enabling independent capture and sequencing of transcriptome and sgRNA.

[0014] This invention provides a primer combination adapted for zero-cross-contamination CRISPR sequencing library construction on a 5' end single-cell platform, comprising: (1) CRISPR-RT primers, the nucleotide sequence of which is shown in SEQ ID NO: 1; (2) The forward primers for sgRNA sequencing library construction have the following nucleotide sequences as shown in SEQ ID NO: 2; (3) The reverse primer for sgRNA sequencing library construction has the nucleotide sequence shown in SEQ ID NO: 3.

[0015] Preferably, the sgRNA scaffold complementary sequence in the CRISPR-RT primers can be adaptively adjusted according to the scaffold sequence of different sgRNA expression vectors; the index sequence in the sgRNA sequencing library preparation primers can be replaced according to different sequencing requirements.

[0016] This invention provides a kit containing the primer combination adapted for the construction of CRISPR sequencing libraries with zero cross-contamination on the 5' end single-cell platform.

[0017] The method for constructing a CRISPR sequencing library with zero cross-contamination adapted to the 5' end single-cell platform, or the primer combination for constructing a CRISPR sequencing library with zero cross-contamination adapted to the 5' end single-cell platform, or the application of the kit in preparing a single-cell CRISPR screening sequencing library.

[0018] The applications include the construction of sgRNA sequencing libraries in the direct capture Perturb-Seq technology, which are used to correlate sgRNA perturbation information with transcriptome expression profiles at the single-cell level.

[0019] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a method for constructing CRISPR sequencing libraries with zero cross-contamination adapted to the 5' end single-cell platform. By designing specific CRISPR-RT primers, it simultaneously recognizes the poly(A) tail of mRNA and the scaffold region of sgRNA during the reverse transcription step, achieving synchronous reverse transcription of two types of molecules in the same reaction system. Using SPRI magnetic bead sorting technology, transcriptome-cDNA and sgRNA-cDNA are effectively separated, and independent libraries are constructed for sequencing. Compared with existing technologies, this method avoids cross-contamination between transcriptome and sgRNA libraries, ensuring the accuracy and reliability of sequencing data. The sgRNA sequencing library can be obtained through a single-step PCR, thus achieving precise cell-gene-sgRNA correspondence. Compared with existing Perturb-Seq technologies that require multiple rounds of PCR amplification, this invention reduces at least 1-2 rounds of PCR steps, significantly shortening library construction time and substantially reducing experimental costs.

[0020] Furthermore, the one-step PCR method of this invention reduces the risk of base mutation by reducing the number of PCR rounds, ensures the fidelity of sgRNA sequences, and improves the accuracy of the association between single-cell perturbation and transcriptome profile.

[0021] The primer combination provided by this invention for constructing 5' end single-cell CRISPR sequencing libraries has a wide range of applications. The target binding sites in the RT primers and sgRNA sequencing library primers can be designed according to requirements, and the index and read sequences can be changed according to the kit. Users can design different primers to obtain the target sequencing library through their own technical solutions, achieving adaptive adjustment to meet differentiated needs. Three different scaffold variants were tested, and the results showed that all variants could effectively capture sgRNA with high reverse transcription efficiency (qPCR quantitative detection), proving that the primer combination of this invention has good broad-spectrum adaptability. The sgRNA sequencing library construction primers are fully compatible with the 10×Genomics 5' end single-cell sequencing kit. Users do not need to purchase a dedicated 10×Genomics 5' CRISPR kit; they can directly use a conventional 5' end kit in conjunction with the primers of this invention to complete the sgRNA library construction, resulting in low reagent costs. The index sequences in the library construction primers can be replaced according to different sequencing channels and can be differentiated from the index settings of the transcriptome library. Multiple sgRNA libraries were constructed using different index sequences in Dual Index Kit TT, Set A. Sequencing results showed no cross-contamination between the libraries, meeting the requirements of multiplex sequencing.

[0022] The application provided by this invention is compatible with the standard 10×genomics single-cell 5' end kit, eliminating the need to purchase the 10×genomics 5' CRISPR Kit. Different combinations of sgRNA scaffolds and indexes can be used. Users can design different primers to obtain the target sequencing library using their own technical solutions, achieving adaptive adjustment to meet differentiated needs. This demonstrates that the method of this invention has good adaptability and flexibility, and is not only suitable for functional gene screening in basic research, but can also be extended to fields such as drug target discovery and gene regulatory network analysis. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of an sgRNA expression vector; Figure 2 This is a flowchart of the CRISPR sequencing library construction process; Figure 3 This is a Labchip quality control pattern of the purified sgRNA-cDNA product. Figure 4 These are schematic diagrams of "two-step" and "one-step" PCR, where a represents the two-step method and b represents the one-step method. Figure 5 This is a graph showing the quality control results of a CRISPR sequencing library. Detailed Implementation

[0024] This section will describe the experimental technical solutions of the present invention in detail and completely with reference to the accompanying drawings. Obviously, the described embodiments are merely exemplary embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of the present invention. The following description, in conjunction with the accompanying drawings... Figure 1-5 The technical solution of the present invention will be described in detail below.

[0025] The human osteosarcoma U2OS cell line used in this invention was purchased from the American Type Culture Collection (ATCC), catalog number ATCC HTB-96.

[0026] Example 1: Primer Design and Synthesis This embodiment provides a primer design method for constructing CRISPR sequencing libraries with zero cross-contamination, adapted to the 5' end single-cell platform, specifically based on the attached... Figure 1 The sgRNA expression vector structure shown was designed.

[0027] As attached Figure 1 As shown, the sgRNA expression vector contains the following key structural regions: the U6 promoter, the targeting sequence, the sgRNA scaffold region (CR1, the sgRNA constant region), and the termination signal. The sgRNA scaffold region is relatively conserved across different sgRNA sequences and serves as the targeted binding site for the primers designed in this invention. Based on the above vector structure, this invention designs the following two types of primers: (1) Reverse transcription primers (CRISPR-RT primers) The primer sequence is (5'→3'): AAGCAGTGGTATCAACGCAGAGTACCAAGTTGATAACGGACTAGCC (SEQ ID NO: 1).

[0028] Its structure consists of two parts: the 3' end sequence and the appendix. Figure 1 The sgRNA scaffold regions shown are complementary, enabling specific binding of sgRNA during reverse transcription; the 5' end sequence is a 10× Genomics reverse transcription primer sequence (Non-Poly(dT)VN), used to simultaneously bind the poly(A) tail of mRNA. This design allows for the simultaneous capture of two classes of molecules in the same reverse transcription reaction. The primers were synthesized by Sangon Biotech, purified by HPLC, diluted to 100 μM with TE buffer, aliquoted, and stored at -20°C for later use.

[0029] (2) Primer design for sgRNA sequencing library construction Forward primers: CRISPR library construction primer-F (as shown in SEQ ID NO: 2): 5'-AATGATACGGCGACCACCGAGATCTACACGTAGGAGTCGACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' Reverse primers CRISPR library construction primer-R (as shown in SEQ ID NO: 3): 5'-CAAGCAGAAGACGGCATACGAGATTGATGATTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAAGTTGATAACGGACTAGCC-3' This primer pair contains the P5 / P7 adapter sequence, index sequence, and reads sequence required for Illumina sequencing. The sgRNA-specific sequence (3' end) is consistent with the CRISPR-RT primers, ensuring recognition of the same sgRNA scaffold region. The primers were synthesized by Sangon Biotech, purified by HPLC, diluted to 100 μM with TE buffer, aliquoted, and stored at -20°C for later use.

[0030] It should be noted that although the CRISPR-RT primers used in this example should anneal with most spCas9 perturbation systems, several sgRNA scaffold variants are currently available. Therefore, it is essential to check the compatibility of the CRISPR-RT primers with the target sgRNA expression vector before the experiment. Furthermore, if running multiple lanes on a 10×Genomics Chromium, simply replace the index 5 / 7 sequences in the sgRNA sequencing library primers (any pair from the index kit can be used as a replacement, but care must be taken to avoid duplication with the transcriptome index sequences).

[0031] Example 2: Acquisition, quality control, and purification of sgRNA-cDNA This embodiment refers to the appendix. Figure 2 The library construction process shown includes the acquisition, quality control, and purification of sgRNA-cDNA. (See attached document.) Figure 2As shown, the library construction process of this invention includes the following main steps: ① preparation of single-cell suspension and microfluidic loading; ② reverse transcription (including CRISPR-RT primers); ③ SPRI magnetic bead sorting (separation of transcriptome-cDNA and sgRNA-cDNA); ④ sgRNA-cDNA purification; ⑤ one-step PCR amplification; ⑥ library purification and quality control; ⑦ sequencing. This embodiment focuses on steps ①-④.

[0032] (1) Reverse transcription reaction Following the operating procedures in the 10×Genomics Chromium Single Cell 5' Reagent Kits User Guide (v2 Chemistry Dual Index) (GC000331), prepare a single-cell suspension (U2OS cells), adjust the cell concentration to 700-1200 cells / μL, and ensure cell viability ≥80%.

[0033] When configuring the reverse transcription system, the CRISPR-RT primers (SEQ ID NO: 1) designed in Example 1 and the Poly(dT) primers provided with the kit were added together to the reverse transcription system. The specific reaction system followed the steps in the 10×Genomics Chromium Single Cell 5' Reagent Kits User Guide (v2 Chemistry Dual Index) (GC000331). Before starting the reverse transcription, 0.5 μL of CRISPR-RT primers was added to the reverse transcription system. The above system was run according to the standard kit procedure to complete gel bead-in-emulsion (GEM) generation, reverse transcription, and cDNA amplification. The reverse transcription conditions were: incubation at 53°C for 45 minutes, followed by heat inactivation at 85°C for 5 minutes. The cDNA amplification program was: 98°C for 3 minutes; 98°C for 15 seconds, 63°C for 20 seconds, 72°C for 1 minute, for a total of 12 cycles; 72°C for 5 minutes; and storage at 4°C. After amplification, a mixed cDNA product containing transcriptome cDNA and sgRNA-cDNA was obtained, with a total volume of approximately 100 μL.

[0034] (2) Preliminary SPRI sorting (separation of transcriptome, sgRNA, and cDNA) The above cDNA products were initially sorted using SPRI, and the separation was achieved by utilizing the difference in binding ability of long-chain and short-chain cDNA to magnetic beads. The specific steps are as follows: Remove the SPRI magnetic beads (e.g., Agencourt AMPure XP) from 4°C and allow them to equilibrate at room temperature for 30 minutes. Vortex thoroughly before use. Add 60 μL of SPRI magnetic beads (0.6 × volume ratio) to 100 μL of the mixed cDNA product and gently pipette 10 times to mix thoroughly. Incubate at room temperature for 5 minutes. Place the reaction tube on a magnetic rack and let it stand for 5 minutes until the solution is completely clear. Carefully aspirate the supernatant containing sgRNA-cDNA (approximately 75 μL, remove the rest of the supernatant) and transfer it to a new 1.5 mL centrifuge tube, label it "sgRNA-cDNA crude extract," and store it on ice or at 4°C for later use. Keep the magnetic beads on the magnetic rack and wash them twice with 80% ethanol according to the kit's standard procedure. After air-drying at room temperature, add 40 μL of Elution Buffer to elute the transcriptome cDNA bound to the magnetic beads, obtaining a transcriptome cDNA sample for subsequent transcriptome library construction.

[0035] (3) Enrichment and purification of sgRNA-cDNA The retained 75 μL supernatant was subjected to double-sided size selection (SPRI) to accurately enrich sgRNA-cDNA fragments. The specific procedure is as follows: a. Right-side sorting (removing large segments) Add 30 μL of SPRIselect (1.2X) reagent to 75 μL of the transferred supernatant, then mix 15 times with a pipette (adjust the pipette range to 100 μL); incubate at room temperature for 5 minutes; place on a magnetic rack until the liquid is clear; remove the supernatant; add 200 μL of 80% ethanol to wash the precipitate, wait 30 seconds; remove the ethanol; add another 200 μL of 80% ethanol to wash the precipitate, wait 30 seconds; remove the ethanol; briefly centrifuge and place on a magnetic rack; remove the remaining ethanol and air dry for 2 minutes. Do not exceed 2 minutes to avoid reducing elution efficiency; remove the sample tube from the magnetic rack. Add 50.5 μL of Buffer EB, mix 15 times with a pipette (adjust the pipette range to 35 μL); incubate at room temperature for 2 minutes; place the sample tube on a magnetic rack until the liquid is clear; transfer 50 μL of cDNA amplification product to a new tube; the sample can be stored at 4°C for 72 h or at -20°C for 4 weeks.

[0036] b. Left-side sorting (removal of small fragments): Vortex resuspend SPRIselect reagent. Add 50 μL of SPRIselect (1.0X) reagent to 50 μL of amplified sample, then mix by pipetting 15 times (adjust pipette range to 60 μL); incubate at room temperature for 5 minutes; place on a magnetic rack until the liquid is clear; remove the supernatant; add 200 μL of 80% ethanol to wash the precipitate, wait 30 seconds; remove the ethanol; add another 200 μL of 80% ethanol to wash the precipitate, wait 30 seconds; remove the ethanol; briefly centrifuge and place on a magnetic rack; remove the remaining ethanol and air dry for 2 minutes. Do not exceed 2 minutes to avoid reducing elution efficiency; remove the sample tube from the magnetic rack. Add 40.5 μL of Buffer EB, mix by pipetting 15 times; incubate at room temperature for 2 minutes; place the sample tube on a magnetic rack until the liquid is clear; transfer 40 μL of cDNA Cleanup product to a new tube and measure the concentration; the sample can be stored at 4°C for 72 hours or at -20°C for 4 weeks.

[0037] (4) Quality inspection before warehouse construction Take 1 μL of cDNA Cleanup product and perform detection using Labchip GX Touch. The detection results are as follows: Figure 3 As shown, a single, clear main peak is visible at 150-200 bp, with no obvious primer peaks (<100 bp) or high molecular weight tails (>500 bp), indicating successful purification of the target sgRNA-cDNA fragment, with purity meeting library construction requirements. The concentration was determined using the Qubit dsDNA HSAssay kit; typically, the cDNA Cleanup product concentration is between 2-5 ng / μL. cDNA Cleanup samples can be stored at 4°C for 72 h or at -20°C for 4 weeks for later use.

[0038] Example 3: One-step PCR construction of CRISPR sequencing libraries A comparison is made to demonstrate the differences in technical pathways between the traditional "two-step PCR" and the "one-step PCR" of this invention: The one-step PCR method of this invention for constructing CRISPR sequencing libraries specifically includes the following steps: (1) PCR reaction system preparation Using the cDNA Cleanup product obtained in Example 2 as a template, one-step PCR amplification was performed using the sgRNA sequencing library primers designed in Example 1. Amplification was performed using TakaRa Ex Taq DNA Polymerase (2×), and the unit reaction system configuration is shown in the table below:

[0039] The amount of template added is calculated based on the concentration of the cDNA Cleanup product. If the concentration is lower than 0.2 ng / μL, a maximum of 20 μL of template should be added, and the volume of water should be reduced accordingly.

[0040] (2) PCR amplification program Place the prepared reaction system in the PCR instrument and run the following program:

[0041] As attached Figure 4 As shown, the technical path differences between the traditional "two-step PCR" (above) and the "one-step PCR" of this invention are compared: Two-step method: requires two rounds of PCR, namely the first round of cDNA amplification and the second round of library enrichment, which takes about 4-5 hours and introduces two base mutation risks; One-step method: directly performs a single round of PCR enrichment on the purified sgRNA-cDNA, which takes about 1 hour and reduces the PCR steps by 70%.

[0042] The annealing temperature can be optimized within the range of 60-65℃ based on the primer Tm value; the number of cycles can be adjusted within the range of 12-16 cycles based on the amount of template used. This example uses 14 cycles to minimize PCR bias while ensuring yield. Too few cycles result in insufficient yield, while too many cycles increase the risk of base mutation.

[0043] (3) Purification of PCR products The 50 μL PCR product was subjected to SPRI two-sided sorting to remove residual primers and primer dimers. Details are as follows: 1. (Refer to the SPRI magnetic bead sorting range to determine the dilution factor. In this example, a dilution factor of 0.7X is selected to remove large fragments.) Vortex resuspend the SPRIselect reagent. Add 70 μL of SPRIselect (0.7X) reagent to 100 μL of the library preparation product, then mix by pipetting 15 times (adjusting the pipette range to 150 μL); incubate at room temperature for 5 minutes; place on a magnetic rack until the liquid is clear. Retain the supernatant; transfer 150 μL of the supernatant to a new tube; 2. (Refer to the SPRI magnetic bead sorting range to determine the dilution factor. In this example, a 1.0X dilution factor is selected to remove small primer fragments.) Vortex resuspend SPRIselect reagent. Add 30 μL of SPRIselect (1.0X) reagent to each sample, then mix 15 times with a pipette (adjust pipette range to 150 μL); incubate at room temperature for 5 minutes; place on a magnetic rack until the liquid is clear; remove the supernatant; add 300 μL of 80% ethanol to wash the precipitate, wait 30 seconds; remove the ethanol; wash twice in total; briefly centrifuge and place on a magnetic rack; remove the remaining ethanol and air dry for 1 minute; remove the sample tube from the magnetic rack; add 40.5 μL of Buffer EB and mix 15 times with a pipette; incubate at room temperature for 2 minutes; place the sample tube on a magnetic rack until the liquid is clear; transfer 40 μL of gRNA library preparation product to a new tube and measure the concentration; samples can be stored at 4°C for 72 hours or at -20°C for 4 weeks.

[0044] (4) Quality inspection after warehouse establishment The final sgRNA sequencing library was subjected to quality testing: Concentration determination: Take 1 μL of the library and determine the concentration using the Qubit dsDNA HS Assay kit. The library concentration obtained in this example is typically between 5-20 ng / μL.

[0045] Fragment distribution analysis: A 1 μL library was taken and detected using Labchip GX Touch. The detection results are as follows: Figure 5 As shown, a single sharp main peak is observed at 280-350 bp, without any extraneous peaks or tails, indicating that the library fragments are concentrated and free from primer dimer contamination.

[0046] Library molar concentration calculation: The library molar concentration is calculated based on the fragment length and concentration. The calculation formula is: Molar concentration (nM) = (Concentration (ng / μL) × 10 6 () / (fragment length (bp) × 650). The molar concentration of the library obtained in this example is usually >5 nM, which meets the requirements for use on the Illumina sequencing platform.

[0047] The sgRNA library product obtained in this step can be stored at 4°C for 72 hours or at -20°C for 4 weeks for later use. Before sequencing, the library needs to be diluted to an appropriate concentration (usually 2-4 nM).

[0048] Example 4: Transcriptome Library Construction and Sequencing (1) Construction of transcriptome library The transcriptome cDNA bound to the magnetic beads after preliminary SPRI sorting in Example 2.2 was used to construct a library according to the standard procedure in the 10× GenomicsChromium Single Cell 5' Reagent Kits User Guide, which mainly included the following steps: Elution of cDNA from magnetic beads: Add 40 μL of Elution Buffer to magnetic beads containing transcriptome cDNA, mix well by pipetting, incubate at room temperature for 2 minutes, place on a magnetic rack, and aspirate the elution buffer into a new tube. cDNA fragmentation and end repair: The eluted cDNA was fragmented using the fragmentation enzymes provided in the kit. The reaction conditions were 4℃ for 1 minute, 32℃ for 5 minutes, and 65℃ for 30 minutes. Purification of the product after end-repair: Purification was performed using 0.8× SPRI magnetic beads; Adapter ligation: Add Illumina sequencing adapters to initiate the ligation reaction and incubate at 20°C for 15 minutes; Post-ligation purification: Purification was performed using 0.8× SPRI magnetic beads; Sample Index PCR: PCR amplification was performed using the Index primers provided in the kit. The number of cycles was determined based on the amount of cDNA used (8-12 cycles). PCR product purification: Purification was performed using 0.8× SPRI magnetic beads to obtain the final transcriptome sequencing library.

[0049] The quality control standards for transcriptome libraries are similar to those for sgRNA libraries, requiring the main peak of fragment distribution to be between 300-600 bp and the concentration to be >2 nM.

[0050] (2) Sequencing and data analysis The sgRNA sequencing library constructed in Example 3 was mixed with the transcriptome sequencing library constructed in Example 4.1 at an equimolar ratio, and paired-end sequencing was performed using the Illumina NovaSeq X plus sequencing platform. The sequencing strategy was as follows: Read 1 28 cycles (for reading cell barcodes and UMIs), Read 2 90 cycles (for reading transcript sequences or sgRNA sequences), and Index 8 cycles each.

[0051] Sequencing data were processed using 10× Genomics Cell Ranger software and a customized analysis workflow. The Cell Ranger count pipeline was used to align and quantify transcriptome data, generating a gene expression matrix. A customized script is used to extract sgRNA sequence information from sequencing data, associate it with cell barcodes, and generate a cell-sgRNA allocation matrix. By integrating the gene expression matrix with the cell-sgRNA allocation matrix, perturbation-transcriptome association data at single-cell resolution were obtained.

[0052] Sequencing data analysis showed that the sgRNA library constructed in this invention shares the same cell barcode as the transcriptome library, and the cell-perturbation information matching rate is significantly improved, confirming that the method of this invention achieves accurate association between sgRNA perturbation information and transcriptome expression profile at the single-cell level.

[0053] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of the claims of this invention.

Claims

1. A method for constructing a CRISPR sequencing library with zero cross-contamination adapted to a 5' end single-cell platform, characterized in that, include: (1) Design and synthesize CRISPR-RT primers and sgRNA sequencing library preparation primers; (2) Add the CRISPR-RT primers to the reverse transcription system to reverse transcribe single-cell samples and obtain cDNA products; (3) The cDNA product obtained in step (2) was sorted by SPRI magnetic beads to separate transcriptome-cDNA and sgRNA-cDNA; (4) Using the sgRNA sequencing library primers designed in step (1), perform one-step PCR amplification on the sgRNA-cDNA obtained in step (3) to obtain the sgRNA sequencing library. (5) The sgRNA sequencing library obtained in step (4) is purified and quality checked.

2. The method for constructing a CRISPR sequencing library with zero cross-contamination adapted to a 5' end single-cell platform according to claim 1, characterized in that, In step (1), the nucleotide sequence of the CRISPR-RT primer is shown in SEQ ID NO:

1.

3. The method for constructing a CRISPR sequencing library with zero cross-contamination adapted to a 5' end single-cell platform according to claim 1, characterized in that, In step (1), the nucleotide sequences of the primers for building the sgRNA sequencing library are shown in SEQ ID NO: 2-SEQ ID NO:

3.

4. The method for constructing a CRISPR sequencing library with zero cross-contamination adapted to a 5' end single-cell platform according to claim 1, characterized in that, The primers for constructing the sgRNA sequencing library contain the P5 adapter sequence, P7 adapter sequence, index sequence, and reads sequence required for Illumina sequencing, and the index sequence can be replaced according to different sequencing channels.

5. The method for constructing a CRISPR sequencing library with zero cross-contamination adapted to a 5' end single-cell platform according to claim 1, characterized in that, In step (3), the SPRI magnetic bead sorting includes: the first sorting adsorbs transcriptome-cDNA onto magnetic beads and dissolves sgRNA-cDNA in the supernatant; the second sorting purifies the sgRNA-cDNA in the supernatant.

6. The method for constructing a CRISPR sequencing library with zero cross-contamination adapted to a 5' end single-cell platform according to claim 1, characterized in that, In step (4), the number of cycles for the one-step PCR amplification is 12 to 16, and the amount of PCR template added is 3 ng to 7 ng.

7. The method for constructing a CRISPR sequencing library with zero cross-contamination adapted to a 5' end single-cell platform according to claim 1, characterized in that, The method is adapted to the 10×Genomics single-cell 5' end sequencing platform and can be performed in parallel with transcriptome library construction, enabling independent capture and sequencing of transcriptome and sgRNA.

8. A primer combination adapted for zero-cross-contamination CRISPR sequencing library construction on a 5' end single-cell platform, characterized in that, include: (1) CRISPR-RT primers, the nucleotide sequence of which is shown in SEQ ID NO: 1; (2) The forward primers for sgRNA sequencing library construction have the following nucleotide sequences as shown in SEQ ID NO: 2; (3) The reverse primer for sgRNA sequencing library construction has the nucleotide sequence shown in SEQ ID NO:

3.

9. A reagent kit, characterized in that, It includes the primer combination described in claim 8, adapted for the construction of CRISPR sequencing libraries with zero cross-contamination on the 5' end single-cell platform.

10. The method for constructing a CRISPR sequencing library adapted to a 5' end single-cell platform with zero cross-contamination as described in any one of claims 1-7, or the primer set adapted to construct a CRISPR sequencing library adapted to a 5' end single-cell platform with zero cross-contamination as described in claim 8, or the application of the kit described in claim 9 in the preparation of a single-cell CRISPR screening sequencing library.