Method for performing multiplex real-time PCR

By using oligonucleotide probes with non-complementary tag moieties and quenching molecules, combined with temperature-dependent quenching, the limitations of multiplex detection in existing real-time PCR technologies have been overcome, enabling efficient quantitative detection of multiple targets in a single reaction vessel.

CN122146862APending Publication Date: 2026-06-05F HOFFMANN LA ROCHE & CO AG
View PDF 35 Cites 0 Cited by

Patent Information

Application Number
CN202610246629.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2017-07-25
Filing Date
2017-09-15
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing real-time PCR technology is difficult to efficiently detect multiple targets simultaneously in the same reaction vessel. Limited by the resolvability of fluorescent labels, it cannot meet the needs of multi-locus analysis and multi-gene expression research.

Method used

A novel oligonucleotide probe with a non-complementary tag and a quenching molecule is used to separate the reporter and quencher parts through a nuclease-sensitive cleavage site during PCR amplification, and combined with temperature-dependent quenching, to achieve the detection of multiple nucleic acid targets.

Benefits of technology

This technology enables the simultaneous quantitative detection of multiple target nucleic acids in a single reaction vessel, overcoming the limitations of fluorescent labeling in existing technologies and improving the capability for multiplex assays.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146862A_ABST
    Figure CN122146862A_ABST
Patent Text Reader

Abstract

Methods for higher multiplex real-time PCR using labeled hydrolysis probes to detect and quantify target nucleic acids are described.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of Chinese patent application No. 201780056666.0, filed on September 15, 2017, entitled "Method for Performing Multiplex Real-Time PCR". Technical Field

[0002] This invention relates to methods for polymerase chain reaction (PCR), and particularly to methods for performing multiplex real-time PCR. Background Technology

[0003] Polymerase chain reaction (PCR) has become a ubiquitous tool in biomedical research, disease surveillance, and diagnosis. The amplification of nucleic acid sequences by PCR is described in U.S. Patent Nos. 4,683,195, 4,683,202, and 4,965,188. PCR is now well-known in the field and has been extensively described in the scientific literature. See PCR Applications, ((1999) edited by Innis et al., Academic Press, San Diego); PCR Strategies, ((1995) edited by Innis et al., Academic Press, San Diego); PCR Protocols, ((1990) edited by Innis et al., Academic Press, San Diego); and PCR Technology, ((1989) edited by Erlich, Stockton Press, New York). “Real-time” PCR assays enable the simultaneous amplification, detection, and quantification of the initial amount of the target sequence. The basic TaqMan real-time PCR assay using 5'- to 3' nuclease activity of DNA polymerase is described in Holland et al., (1991) Proc. Natl. Acad. Sci. 88:7276-7280 and U.S. Patent No. 5,210,015. Real-time PCR without nuclease activity (nuclease-free assay) is described in U.S. Application Serial No. 12 / 330,694, filed December 9, 2008. The use of fluorescent probes in real-time PCR is described in U.S. Patent No. 5,538,848.

[0004] Typical real-time PCR protocols using fluorescent probes involve using labeled probes specific to each target sequence. The probes are preferably labeled with one or more fluorescent portions that absorb and emit light at specific wavelengths. Upon hybridization with the target sequence or its amplicons, the probe exhibits a detectable change in fluorescence emission due to probe hybridization or hydrolysis.

[0005] However, the main challenge of real-time assays remains the ability to analyze multiple targets in a single tube. The number of target loci is rapidly increasing in almost every medical and diagnostic field. For example, multiple loci must be analyzed in forensic DNA profiling, pathogen detection, screening for multi-locus genetic diseases, and multi-gene expression studies (to name just a few).

[0006] The capability of multiplexing using most existing methods is limited by the detection instrument. Specifically, using multiple probes in the same reaction requires different fluorescent labels. For simultaneous detection of multiple probes, the instrument must be able to distinguish the light signal emitted by each probe. Most existing technologies on the market do not allow the detection of more than four to seven individual wavelengths in the same reaction vessel. Therefore, using a uniquely labeled probe for each target, no more than four to seven individual targets can be detected in the same vessel. In practice, at least one target is usually a control nucleic acid. Therefore, in practice, no more than three to six experimental targets can be detected in the same tube. The use of fluorescent dyes is also limited by spectral width, with only about six or seven dyes accommodating in the visible spectrum without significant overlap interference. Therefore, unless there is a fundamental change in amplification and detection strategies, the capability of multiplexing will not keep pace with clinical needs.

[0007] Post-PCR melting assays provide the additional capability to multiplex real-time amplification reactions. See U.S. Patent Application Serial No. 11 / 474,071, filed June 23, 2006. In melting assays, the amplified nucleic acid is identified by its unique melting profile. Melting assays involve determining the melting temperature (melting point) of the double-stranded target or labeled probe and the double-stranded structure between the target. As described in U.S. Patent No. 5,871,908, to determine the melting temperature using a fluorescently labeled probe, the double-stranded structure between the target nucleic acid and the probe is gradually heated (or cooled) in a temperature-controlled procedure. The dissociation of the double-stranded structure alters the distance between interacting fluorophores or between a fluorophore and a quencher. Interacting fluorophores can be conjugated to separate probe molecules, as described in U.S. Patent No. 6,174,670. Alternatively, one fluorophore can be conjugated to a probe while another fluorophore can be inserted into the nucleic acid double-stranded structure, as described in U.S. Patent No. 5,871,908. As yet another alternative, a fluorophore can be conjugated to a single probe oligonucleotide. After the double strand is unwound, the fluorescence is quenched because the fluorophore and quencher aggregate together in the now single-stranded probe.

[0008] The melting of nucleic acid double strands is monitored by measuring related fluorescence changes. These fluorescence changes are represented on a graph called a "melting profile." Because different probe-target double strands can be designed to melt (or re-anneal) at different temperatures, each probe will produce a unique melting profile. A properly designed probe will have a melting temperature significantly different from that of other probes in the same assay. Many existing software tools allow for the design of probes for multiplex assays in the same tube, taking these objectives into account. For example, Visual OMP... TM The software (DNA Software, Inc., Ann Arbor, Mich) enables people to determine the melting temperature of nucleic acid duplexes under various reaction conditions.

[0009] U.S. Patent No. 6,472,156 describes a multiplex PCR method using colorimetric detection and subsequent post-amplification melting assay. The number of targets detectable by this method is the product of the number of detectable wavelengths and the number of distinguishable melting curves. Therefore, adding a melting assay to colorimetric detection represents an advancement in the ability to detect multiple targets.

[0010] Post-amplification melting assays are most commonly used for qualitative purposes, i.e., to identify target nucleic acids, see U.S. Patent Nos. 6,174,670, 6,427,156, and 5,871,908. It is known that melting peaks are obtained by calculating the derivative of the melting curve function. Ririe et al. (“Product differentiation by analysis of DNA melting curves during the polymerase chain reaction,” (1997) Anal. Biochem. 245:154-160) observed that calculating the derivative helps to distinguish melting curves generated by a mixture of products. After calculating the derivative, the melting peaks generated by each component of the mixture become easier to distinguish. It is also known that the post-amplification melting signal (i.e., melting peak) is proportionally higher than the amount of nucleic acid in the sample. For example, U.S. Patent No. 6,245,514 teaches a post-amplification melting assay using a double-stranded insertion dye to generate derivative melting peaks, and then using specialized software to calculate the integral of the peak. The integral provides information about the amplification efficiency and the relative amount of amplified nucleic acid.

[0011] In practice, there is a desire to go beyond qualitative assays and to be able to quantify multiple targets in the same sample. See, for example, Sparano et al., “Development of the 21-gene assay and its application in clinical practice and clinical trials,” J. Clin. Oncol. (2008) 26(5):721-728. The ability to quantify target amounts is useful in clinical applications such as determining viral load in patient serum, measuring gene expression levels in response to drug therapy, or identifying the molecular characteristics of tumors to predict their response to therapy.

[0012] In real-time PCR assays, the signal generated by labeled probes can be used to estimate the amount of input target nucleic acid. The larger the input, the earlier the fluorescence signal crosses a predetermined threshold (Ct). Therefore, the relative or absolute amount of target nucleic acid can be determined by comparing samples to each other or to control samples with known amounts of nucleic acid. However, existing methods are limited in their ability to simultaneously quantify multiple targets. Similar to the qualitative detection of multiple targets, the limiting factor is the availability of spectrally resolvable fluorophores. As explained above, existing fluorescent labeling techniques cannot obtain different signals from more than six or seven individually labeled probes in the same tube. Therefore, a completely different experimental approach is needed to allow the amplification and detection of multiple nucleic acid targets during real-time PCR.

[0013] Many methods for detecting target nucleic acids are known. Currently available homogeneous assays for nucleic acid detection include TaqMan. ® Ampliflour ® Dye binding, allele-selective kinetic PCR and Scorpion ®Primer assays. These assays are not easily multiplexed due to the need for different dyes for each target nucleic acid to be detected, and are therefore limited in their potential for improvement. To overcome this limitation, several recent studies have disclosed the application of oligonucleotide probes containing cleavable “tag” moieties that can be easily isolated and detected (see, for example, Chenna et al., U.S. Patent Application Publication No. 2005 / 0053939; Van Den Boom, U.S. Patent No. 8,133,701). More recently, improved methods for multiplex nucleic acid target identification using structure-based oligonucleotide probe cleavage have been described in U.S. Patent Application Publications Nos. 2014 / 0272955, 2015 / 0176075, and 2015 / 0376681. Chun et al. have described other methods in U.S. Patent No. 8,809,239 for detecting target nucleic acid sequences from DNA or a mixture of nucleic acids using a combination of “probe and tag oligonucleotides” (PTOs) and “capture and template oligonucleotides” (CTOs) in a so-called PTO cleavage and extension assay. However, accurate methods for high-throughput multiplex detection of target nucleic acids are still needed. Summary of the Invention

[0014] This invention provides a novel method for nucleic acid sequence detection, particularly for detecting multiple target nucleic acids using real-time PCR. The method utilizes novel oligonucleotide probes with two unique characteristics: a non-complementary tag moiety and a quenching molecule.

[0015] Therefore, in one aspect, the present invention provides a method for amplifying and detecting a target nucleic acid in a sample, comprising the steps of: (a) contacting a sample containing the target nucleic acid in a single reaction vessel with: (i) a pair of oligonucleotide primers, each oligonucleotide primer capable of hybridizing to the opposite strand of a subsequence of the target nucleic acid; (ii) an oligonucleotide probe comprising an annealing portion and a tag portion, wherein the tag portion comprises a nucleotide sequence or nonnucleotide molecule that is not complementary to the target nucleic acid sequence, wherein the annealing portion comprises a nucleotide sequence that is at least partially complementary to the target nucleic acid sequence and hybridizes to a region of the subsequence of the target nucleic acid defined by the pair of oligonucleotide primers, wherein the probe further comprises an interacting dual label comprising a reporter portion located on the tag portion or the annealing portion and a first quencher portion located on the annealing portion, and wherein the reporter portion is separated from the first quencher portion by a nuclease-sensitive cleavage site; and wherein the tag portion reversibly binds to a quenching molecule in a temperature-dependent manner, the quenching... (a) The molecule comprises or is bound to one or more quencher moieties, wherein the quencher moieties are capable of quenching the reporter moieties when the quenching molecule binds to the tag moieties; (b) the target nucleic acid is amplified by PCR using a nucleic acid polymerase having 5' to 3' nuclease activity such that during the extension step of each PCR cycle, the nuclease activity of the polymerase allows the reporter moieties to be cleaved and separated from the first quencher moieties on the annealing portion of the probe; (c) the inhibition signal from the reporter moieties is measured at a first temperature at which the quenching molecule binds to the tag moieties; (d) the temperature is increased to a second temperature at which the quenching molecule does not bind to the tag moieties; (e) the temperature-corrected signal from the reporter moieties is measured at the second temperature; (f) a calculated signal value is obtained by subtracting the inhibition signal detected at the first temperature from the temperature-corrected signal detected at the second temperature; (g) steps (b) to (f) are repeated for multiple PCR cycles; (h) the calculated signal value from multiple PCR cycles is measured to detect the presence of the target nucleic acid.

[0016] In one embodiment, the tag portion contains a modification that prevents it from being extended by a nucleic acid polymerase. In one embodiment, the reporter portion is located on the tag portion of the oligonucleotide probe. In another embodiment, the reporter portion is located on the annealed portion of the oligonucleotide probe and is capable of interacting with a quenching molecule containing a second quencher portion in a temperature-dependent manner. In one embodiment, the tag portion contains a nucleotide sequence that is not complementary to the target nucleic acid sequence, and the quenching molecule is an oligonucleotide containing a nucleotide sequence that is at least partially complementary to the tag portion of the oligonucleotide probe and binds to the tag portion by hybridization. In another embodiment, the tag portion of the oligonucleotide probe or the quenching molecule, or both the tag portion and the quenching molecule, contains one or more nucleotide modifications. In yet another embodiment, the one or more nucleotide modifications are selected from locked nucleic acids (LNAs), peptide nucleic acids (PNAs), bridged nucleic acids (BNAs), 2'-O alkyl-substituted, L-enantiomeric nucleotides, or combinations thereof. In one embodiment, the reporter portion is a fluorescent dye, and the quencher portion quenches a detectable signal from the fluorescent dye.

[0017] On the other hand, the present invention provides a method for detecting two or more target nucleic acid sequences in a sample, comprising the steps of: (a) contacting a sample suspected of containing two or more target nucleic acid sequences in a single reaction vessel with: (i) a first pair of oligonucleotide primers and a second pair of oligonucleotide primers, wherein the first pair of oligonucleotide primers has a nucleotide sequence complementary to each strand of a first target nucleic acid sequence, and the second pair of oligonucleotide primers has a nucleotide sequence complementary to each strand of a second target nucleic acid sequence; (ii) a first oligonucleotide probe comprising a nucleotide sequence at least partially complementary to the first target nucleic acid sequence, and annealing within the first target nucleic acid sequence defined by the first pair of oligonucleotide primers, wherein the first oligonucleotide probe comprises a nucleotide sequence capable of... (iii) A fluorescent portion that generates a detectable signal and a first quencher portion capable of quenching the detectable signal generated by the fluorescent portion, wherein the fluorescent portion is separated from the first quencher portion by a nuclease-sensitive cleavage site; (iii) a second oligonucleotide probe comprising two distinct portions: an annealing portion and a tag portion, the annealing portion comprising a nucleotide sequence at least partially complementary to a second target nucleic acid sequence and annealed within the second target nucleic acid sequence defined by a second pair of oligonucleotide primers, wherein the annealing portion comprises the second quencher portion; and the tag portion is attached to the 5' or 3' end of the annealing portion, or attached to a region of the annealing portion via a linker and comprising a nucleotide sequence not complementary to the two or more target nucleic acid sequences, wherein the tag portion... The first oligonucleotide probe contains a fluorescent portion identical to the fluorescent portion on the first oligonucleotide probe, and its detectable signal is quenched by a second quencher portion on the annealed portion, wherein the fluorescent portion is separated from the second quencher portion by a nuclease-sensitive cleavage site; (iv) a quenching oligonucleotide containing a nucleotide sequence at least partially complementary to the tag portion of the second oligonucleotide probe, and hybridizing with the tag portion to form a double strand, wherein the quenching oligonucleotide contains a third quencher portion, which quenches the detectable signal generated by the fluorescent portion on the tag portion when the quenching oligonucleotide hybridizes with the tag portion; (b) the first oligonucleotide probe is amplified by polymerase chain reaction (PCR) using a nucleic acid polymerase having 5' to 3' nuclease activity. The second target nucleic acid sequence is configured such that during the extension step of each PCR cycle, the 5' to 3' nuclease activity of the nucleic acid polymerase allows the fluorescent portion to be cleaved and separated from the first quenched portion of the first oligonucleotide probe and from the second quenched portion of the annealed portion of the second oligonucleotide probe, wherein during the extension step, the quenched oligonucleotide remains hybridized with the tag portion; (c) the fluorescence signal is measured at a first temperature at which the quenched oligonucleotide hybridizes with the tag portion from the second oligonucleotide probe; (d) the temperature is increased to a second temperature above the first temperature at which the quenched oligonucleotide does not hybridize with the tag portion from the second oligonucleotide probe; (e) the fluorescence signal is measured at the second temperature.(f) Obtain the calculated signal value by subtracting the fluorescence signal detected at the first temperature from the fluorescence signal detected at the second temperature; (g) Repeat steps (b) to (f) in multiple PCR cycles to generate the desired amount of amplification product from the first and second target nucleic acid sequences; (h) Determine the presence of the first target nucleic acid sequence by the fluorescence signals detected from multiple PCR cycles at the first temperature, and determine the presence of the second target nucleic acid sequence by the calculated signal value from the multiple PCR cycles.

[0018] In one embodiment, the tag portion contains a modification that prevents it from being extended by a nucleic acid polymerase. In another embodiment, the tag portion is attached to the 5' end of the annealed portion. In yet another embodiment, the tag portion is attached to the 3' end of the annealed portion. In yet another embodiment, the tag portion is attached to a region of the annealed portion via a linker. In another embodiment, the tag portion or quenching oligonucleotide of the second oligonucleotide probe, or both the tag portion and the quenching oligonucleotide, contains one or more nucleotide modifications. In yet another embodiment, the one or more nucleotide modifications are selected from locked nucleic acids (LNAs), peptide nucleic acids (PNAs), bridged nucleic acids (BNAs), 2'-O alkyl-substituted, L-enantiomeric nucleotides, or combinations thereof.

[0019] In another aspect, the present invention provides a method for detecting two or more target nucleic acid sequences in a sample, comprising the steps of: (a) contacting a sample suspected of containing two or more target nucleic acid sequences in a single reaction vessel with: (i) a first pair of oligonucleotide primers and a second pair of oligonucleotide primers, the first pair of oligonucleotide primers having a sequence complementary to each strand of a first target nucleic acid sequence, and the second pair of oligonucleotide primers having a sequence complementary to each strand of a second target nucleic acid sequence; (ii) a first oligonucleotide probe comprising two distinct portions: a first annealing portion and a first tag portion, the first annealing portion comprising a sequence at least partially complementary to the first target nucleic acid sequence and at a first target defined by the first pair of oligonucleotide primers. The first annealing portion comprises a first quencher portion; and the first tag portion is attached to the 5' or 3' end of the first annealing portion or to a region of the first annealing portion via a linker, and comprises a nucleotide sequence that is not complementary to the two or more target nucleic acid sequences, wherein the first tag portion comprises a fluorescent portion whose detectable signal can be quenched by the first quencher portion on the first annealing portion, wherein the fluorescent portion is separated from the first quencher portion by a nuclease-sensitive cleavage site; (iii) a first quenching oligonucleotide comprising a sequence that is at least partially complementary to the first tag portion of the first oligonucleotide probe and hybridizes with the first tag portion to form a double strand, wherein the first quenching oligonucleotide comprises a second quencher portion. When the first quenching oligonucleotide hybridizes with the first tag portion, the second quenching portion quenches the detectable signal generated by the fluorescent portion on the first tag portion; (iv) a second oligonucleotide probe comprising two distinct portions: a second annealing portion and a second tag portion, the second annealing portion comprising a sequence at least partially complementary to the second target nucleic acid sequence and annealed within the second target nucleic acid sequence defined by a second pair of oligonucleotide primers, wherein the second annealing portion comprises a third quenching portion; and the second tag portion is attached to the 5' or 3' end of the second annealing portion or to a region of the second annealing portion via a linker, and comprises a nucleotide sequence not complementary to the two or more target nucleic acid sequences, and is attached to the first tag portion of the first oligonucleotide probe. The second tag portion has a different nucleic acid sequence or different nucleotide modification compared to the nucleotide sequence of the first oligonucleotide probe, wherein the second tag portion contains a fluorescent portion that is the same as the fluorescent portion on the first oligonucleotide probe, and its detectable signal can be quenched by a third quencher portion on the second annealed portion, wherein the fluorescent portion is separated from the third quencher portion by a nuclease-sensitive cleavage site; (v) a second quenching oligonucleotide containing a sequence that is at least partially complementary to the second tag portion of the second oligonucleotide probe, and hybridizing with the second tag portion to form a double strand, wherein the second quenching oligonucleotide contains a fourth quenching portion that quenches the detectable signal generated by the fluorescent portion on the second tag portion when the second quenching oligonucleotide hybridizes with the second tag portion;Wherein, the duplex between the second quenching oligonucleotide and the second tag portion of the second oligonucleotide probe has a higher melting temperature (Tm) value than the duplex between the first quenching oligonucleotide and the first tag portion of the first oligonucleotide probe; (b) using a nucleic acid polymerase with 5' to 3' nuclease activity, the first and second target nucleic acid sequences are amplified by polymerase chain reaction (PCR) such that during the extension step of each PCR cycle, the 5' to 3' nuclease activity of the nucleic acid polymerase allows: (i) cleaving and separating the fluorescent portion on the first tag portion from the first quenching portion of the first oligonucleotide probe, wherein in the extension step, the first quenching oligonucleotide remains hybridized with the first tag portion; and (ii) cleaving and separating the fluorescent portion on the second tag portion from the third quenching portion of the second oligonucleotide probe, wherein in the extension step, the second quenching oligonucleotide remains hybridized with the second tag portion; (c) increasing the temperature to (b) At a first temperature, the first quenching oligonucleotide does not hybridize with the first tag portion of the first oligonucleotide probe, and the second quenching oligonucleotide maintains hybridization with the second tag portion of the second oligonucleotide probe; (c) Measure the fluorescence signal at the first temperature; (d) Increase the temperature to a second temperature, at which the second quenching oligonucleotide does not hybridize with the second tag portion of the second oligonucleotide probe; (e) Measure the fluorescence signal at the second temperature; (g) Obtain the calculated signal value by subtracting the fluorescence signal detected at the first temperature from the fluorescence signal detected at the second temperature; (h) Repeat steps (b) to (g) in multiple PCR cycles to generate the desired amount of amplified product from the first and second target nucleic acid sequences; (i) Determine the presence of the first target nucleic acid sequence by the fluorescence signal detected from multiple PCR cycles at the first temperature, and determine the presence of the second target nucleic acid sequence by the calculated signal value from multiple PCR cycles.

[0020] In one implementation, both the first and second tag portions contain modifications such that neither tag portion can be extended by a nuclease.

[0021] In one embodiment, a first tag portion is attached to the 3' end of the first annealed portion of the first oligonucleotide probe, and a second tag portion is attached to the 3' end of the second annealed portion of the second oligonucleotide probe. In another embodiment, the first tag portion is attached to the 3' end of the first annealed portion of the first oligonucleotide probe, and the second tag portion is attached to the 5' end of the second annealed portion of the second oligonucleotide probe. In yet another embodiment, the first tag portion is attached to the 3' end of the first annealed portion of the first oligonucleotide probe, and the second tag portion is attached to a region of the second annealed portion of the second oligonucleotide probe via a connector.

[0022] In one embodiment, a first tag portion is attached to the 5' end of the first annealed portion of the first oligonucleotide probe, and a second tag portion is attached to the 5' end of the second annealed portion of the second oligonucleotide probe. In another embodiment, the first tag portion is attached to the 5' end of the first annealed portion of the first oligonucleotide probe, and the second tag portion is attached to the 3' end of the second annealed portion of the second oligonucleotide probe. In yet another embodiment, the first tag portion is attached to the 5' end of the first annealed portion of the first oligonucleotide probe, and the second tag portion is attached to a region of the second annealed portion of the second oligonucleotide probe via a connector.

[0023] In one embodiment, a first tag portion is attached to the region of the first annealed portion of the first oligonucleotide probe via a adapter, and a second tag portion is attached to the 5' end of the second annealed portion of the second oligonucleotide probe. In another embodiment, a first tag portion is attached to the region of the first annealed portion of the first oligonucleotide probe via a adapter, and a second tag portion is attached to the 3' end of the second annealed portion of the second oligonucleotide probe. In yet another embodiment, a first tag portion is attached to the region of the first annealed portion of the first oligonucleotide probe via a adapter, and a second tag portion is attached to the region of the second annealed portion of the second oligonucleotide probe via a adapter.

[0024] In one embodiment, any one or any combination of the first tag portion of the first oligonucleotide probe or the first quenching oligonucleotide or the second tag portion of the second oligonucleotide probe or the second quenching oligonucleotide contains one or more nucleotide modifications. In one embodiment, the one or more nucleotide modifications are selected from locked nucleic acids (LNA), peptide nucleic acids (PNA), bridged nucleic acids (BNA), 2'-O alkyl-substituted, L-enantiomeric nucleotides, or combinations thereof. In yet another aspect, the present invention provides a kit for detecting two or more target nucleic acid sequences in a sample, comprising: (a) two or more pairs of oligonucleotide primers having sequences complementary to each strand of the two or more target nucleic acid sequences; (b) at least one oligonucleotide probe comprising two distinct portions: an annealing portion and a tag portion, the annealing portion comprising a sequence at least partially complementary to one of more than one target nucleic acid sequences and annealed within one of the more than one target nucleic acid sequences, wherein the annealing portion comprises a first quenching portion; and the tag portion is attached to the 5' end or 3' end of the first annealing portion or attached to the annealing portion via a adapter. The tag portion comprises a region and includes a nucleotide sequence that is not complementary to more than one target nucleic acid sequence, wherein the tag portion includes a fluorescent portion whose detectable signal can be quenched by a first quencher portion on the annealed portion, wherein the fluorescent portion is separated from the first quencher portion by a nuclease-sensitive cleavage site; (c) at least one quenching oligonucleotide comprising a nucleotide sequence at least partially complementary to the tag portion of the oligonucleotide probe and hybridizing with the tag portion to form a double strand, wherein the quenching oligonucleotide includes a second quencher portion that quenches the detectable signal generated by the fluorescent portion on the tag portion when the quenching oligonucleotide hybridizes with the tag portion. In one embodiment, the tag portion of the oligonucleotide probe or the quenching oligonucleotide or both the tag portion of the oligonucleotide probe and the quenching oligonucleotide contain one or more nucleotide modifications, wherein the one or more nucleotide modifications are selected from locked nucleic acids (LNA), peptide nucleic acids (PNA), bridged nucleic acids (BNA), 2'-O alkyl substitutions, L-enantiomeric nucleotides, or combinations thereof. Attached Figure Description

[0025] Figure 1 This is a schematic description of one embodiment of an oligonucleotide probe used to implement the method of the present invention.

[0026] Figure 2 This is an illustration of the method of the present invention, showing the separation of the tag portion and the subsequent dissociation of the quenched oligonucleotide.

[0027] Figure 3 This is a description of one embodiment of the method of the present invention.

[0028] Figure 4 This shows the signal detection temperature using another embodiment of the method of the present invention.

[0029] Figure 5 Different implementation schemes of oligonucleotide probes for carrying out the methods of the present invention are shown.

[0030] Figure 6 The results of hybridization and dissociation between quenched oligonucleotides and fluorescently labeled complementary oligonucleotides at two temperatures are shown, as described in Example 1.

[0031] Figure 7 Display using standard TaqMan ® Probe G0 and FAM fluorescence readings at 58°C, and in the absence of group M HIV-1 template (HIM) ( Figure 7 A) or there exists 10 cp / rxn ( Figure 7 B), 100 cp / rxn ( Figure 7 C) and 1,000 cp / rxn ( Figure 7 PCR growth curves generated by internal control templates (GIC) of 0, 100, 1,000 or 10,000 cp / rxn in the case of HIM (D).

[0032] Figure 8 The display shows the use of a labeled probe (L24) with a complementary quenching oligonucleotide (Q9) and FAM fluorescence readings at 80°C, and in the absence of GIC ( Figure 8 A) or there exists 100 cp / rxn ( Figure 8 B), 1,000cp / rxn ( Figure 8 C) and 10,000cp / rxn ( Figure 8 PCR growth curves generated by HIM with 0, 10, 100 or 1,000 cp / rxn in the case of GIC (D).

[0033] Figure 9 Displayed as not present in GIC ( Figure 9 A) or there exists 100 cp / rxn ( Figure 9 B), 1,000 cp / rxn ( Figure 9 C) and 10,000 cp / rxn ( Figure 9 In the case of GIC in D), the derivatized growth curves were obtained by subtracting 84% of the fluorescence signal at 58°C from the fluorescence signal at 80°C, and the result was obtained from HIM at 0, 10, 100 or 1,000 cp / rxn.

[0034] Figure 10A and 10B Display using standard TaqMan ®PCR growth curves were generated using a GIC probe (G0) and an HIV probe (L24) labeled with a complementary quenching oligonucleotide (Q9), produced from an internal control template (GIC) or an HIV template (HIV) or both GIC and HIV templates (G+H), where both probes were labeled with FAM ( Figure 10A (top row), HEX ( Figure 10A (bottom row), JA270 dye ( Figure 10B (top row), or Cy5.5 ( Figure 10B (bottom row) mark.

[0035] Figure 11A , 11B The PCR growth curves shown in Example 4 are as described in 11C, where the L24-labeled probe contains L-DNA instead of D-DNA, and the FAM fluorescence readings are at 58°C. Figure 11A FAM fluorescence readings at 80℃ ( Figure 11B ), and 84% of the fluorescence signal at 58℃ was subtracted from the fluorescence signal at 80℃. Figure 11C ).

[0036] Figure 12 The PCR growth curves are shown as described in Example 5, with fluorescence signal detection at 58°C, 75°C, 88°C, or 97°C, in the presence of standard TaqMan. ® The following are measurements of GIC probes (IC-QF), labeled HIV probes (L24) and quenching oligonucleotides (Q9-OMe A / G) in which A and G nucleotides are modified by 2'-OMe substitution, labeled HIV probes (L24-OMe) and quenching oligonucleotides (Q9-OMe A / G) in which all nucleotides are modified by 2'-OMe substitution, and labeled HIV probes (L24-OMe) and quenching oligonucleotides (Q9-OMe) in which all nucleotides are modified by 2'-OMe substitution. Detailed Implementation

[0037] definition As used herein, the term "sample" includes samples or cultures containing nucleic acids (e.g., microbial cultures). The term "sample" is also intended to include biological samples and environmental samples. Samples can include samples of synthetic origin. Biological samples include whole blood, serum, plasma, cord blood, chorionic villus, amniotic fluid, cerebrospinal fluid, cerebrospinal fluid, lavage fluid (e.g., bronchoalveolar, gastric, peritoneal, ductal, ear, arthroscopic lavage fluid), biopsy samples, urine, feces, sputum, saliva, nasal mucus, prostatic fluid, semen, lymph, bile, tears, sweat, breast milk, mammary fluid, embryonic cells, and fetal cells. In a preferred embodiment, the biological sample is blood, and more preferably plasma. As used herein, the term "blood" includes whole blood or any blood fraction, such as serum and plasma as conventionally defined. Blood plasma refers to a whole blood fraction produced by centrifugation of blood treated with an anticoagulant. Blood serum refers to the fluid, watery portion remaining after a blood sample has coagulated. Environmental samples include environmental materials such as surface substances, soil, water, and industrial samples, as well as samples obtained from food and dairy processing facilities, instruments, equipment, appliances, and disposable and non-disposable items. These examples should not be construed as limiting the types of samples that can be used in this invention.

[0038] As used herein, the terms “target” or “target nucleic acid” are intended to refer to any molecule whose presence is to be detected or measured, or whose function, interaction, or properties are to be studied. Therefore, a target includes any molecule that is present with a detectable probe (e.g., an oligonucleotide probe) or assay for it, or that can be produced by someone skilled in the art. For example, a target can be a biomolecule, such as a nucleic acid molecule, polypeptide, lipid, or carbohydrate, capable of binding to or otherwise contacting a detectable probe (e.g., an antibody), wherein the detectable probe further comprises a nucleic acid detectable by the methods of the present invention. As used herein, “detectable probe” means any molecule or reagent capable of hybridizing or annealing to a target biomolecule and allowing for the specific detection of the target biomolecule as described herein. In one aspect of the invention, the target is a nucleic acid, and the detectable probe is an oligonucleotide. The terms “nucleic acid” and “nucleic acid molecule” are used interchangeably throughout this disclosure. The term refers to oligonucleotides, oligomers, polynucleotides, deoxyribonucleotides (DNA), genomic DNA, mitochondrial DNA (mtDNA), complementary DNA (cDNA), bacterial DNA, viral DNA, viral RNA, RNA, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), siRNA, catalytic RNA, clones, plasmids, M13, P1, granules, bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC), amplified nucleic acids, amplicones, PCR products and other types of amplified nucleic acids, RNA / DNA hybrids, and polyamide nucleic acids (PNA), all of which may be in single-stranded or double-stranded form, and unless otherwise limited, will include known analogs of natural nucleotides that can function in a manner similar to naturally occurring nucleotides, and combinations and / or mixtures thereof. Therefore, the term "nucleotide" refers to naturally occurring and modified / non-naturally occurring nucleotides, including tris, dis, and monophosphate nucleotides, as well as monophosphate monomers present within polynucleotides or oligonucleotides. Nucleotides can also be ribose; 2'-deoxy; 2',3'-deoxy, and a large number of other nucleotide mimics well known in the art. Mimics include chain-terminated nucleotides such as 3'-O-methyl, halobase, or sugar substitution; substituted sugar structures, including non-sugar, alkyl ring structures; substituted bases, including inosine; denitrogenated; chi and psi, linker modified; mass-marked modified; phosphodiester modified or substituted, including thiophosphates, methylphosphonates, boranophosphates, amides, esters, ethers; and essentially or completely internucleotide substitutions, including cleavage linkages, such as optically cleavable nitrophenyl moieties.

[0039] The presence or absence of a target can be measured quantitatively or qualitatively. Targets can appear in a variety of different forms, including, for example, simple or complex mixtures, or substantially purified forms. For example, a target can be part of a sample containing other components, or it can be the only or main component of the sample. Thus, a target can be a component of whole cells or tissues, a cell or tissue extract, its fractionated lysate, or a substantially purified molecule. Additionally, targets can have known or unknown sequences or structures.

[0040] The term "amplification reaction" refers to any in vitro method used to amplify copies of a target nucleic acid sequence.

[0041] "Amplification" refers to the step of bringing a solution to conditions sufficient to allow amplification. Components of an amplification reaction may include, but are not limited to, primers, polynucleotide templates, polymerases, nucleotides, dNTPs, etc. The term "amplification" typically refers to an "exponential" increase in the number of target nucleic acids. However, as used herein, "amplification" can also refer to a linear increase in the number of selected target nucleic acid sequences, but this is different from a one-time, single-primer extension step.

[0042] "Polymerase chain reaction" or "PCR" refers to a method used to amplify a specific segment or subsequence of a target double-stranded DNA in geometric progression. PCR is well known to those skilled in the art; see, for example, U.S. Patent Nos. 4,683,195 and 4,683,202; and PCR Protocols: A Guide to Methods and Applications, edited by Innis et al., 1990.

[0043] As used herein, “oligonucleotide” refers to a linear oligomer of natural or modified nucleoside monomers linked by phosphodiester bonds or similar bonds. Oligonucleotides include deoxyribonucleosides, ribonucleosides, their terminal isomers, peptide nucleic acids (PNAs), etc., capable of specifically binding to target nucleic acids. Typically, monomers are linked by phosphodiester bonds or similar bonds to form oligonucleotides, which range in size from a few monomer units (e.g., 3-4) to several tens of monomer units (e.g., 40-60). Whenever an oligonucleotide is represented by a sequence of letters (such as “ATGCCTG”), it should be understood that, unless otherwise specified, the nucleotides are in a 5'-3' sequence from left to right, and “A” refers to deoxyadenosine, “C” to deoxycytidine, “G” to deoxyguanosine, “T” to deoxythymidine, and “U” to ribonucleoside, uridine. Oligonucleotides typically contain four natural deoxynucleotides; however, they may also contain ribonucleosides or non-natural nucleotide analogs. When an enzyme has specific oligonucleotide or polynucleotide substrate requirements for its activity (e.g., single-stranded DNA, RNA / DNA duplex, etc.), the selection of an appropriate composition of the oligonucleotide or polynucleotide substrate is entirely within the knowledge of a person skilled in the art.

[0044] As used herein, "oligonucleotide primer" or simply "primer" refers to a polynucleotide sequence that hybridizes to a sequence on a target nucleic acid template and facilitates the detection of the oligonucleotide probe. In the amplification embodiments of the present invention, the oligonucleotide primer acts as the starting point for nucleic acid synthesis. In non-amplification embodiments, the oligonucleotide primer can be used to establish structures that can be cleaved by cleavage reagents. Primers can have various lengths and are typically less than 50 nucleotides, for example, 12-25 nucleotides in length. The length and sequence of primers used in PCR can be designed based on principles known to those skilled in the art.

[0045] As used herein, the term "oligonucleotide probe" refers to a polynucleotide sequence that is capable of hybridizing or annealing with a target nucleic acid and allows for the specific detection of the target nucleic acid.

[0046] The "reporter moiety" or "reporter molecule" is the molecule that imparts a detectable signal. For example, the detectable phenotype can be colorimetric, fluorescent, or luminescent. The "quencher moiety" or "quencher molecule" is the molecule that quenches the detectable signal derived from the reporter moiety.

[0047] A “mismatched nucleotide” or “mismatch” refers to a nucleotide that is not complementary to the target sequence at one or more positions. Oligonucleotide probes may have at least one mismatch, but may also have 2, 3, 4, 5, 6, or 7 or more mismatched nucleotides.

[0048] As used herein, the term "polymorphism" refers to allelic variants. Polymorphism can include single nucleotide polymorphisms (SNPs) and simple sequence length polymorphisms. Polymorphism can result from substitution of one or more nucleotides at one allele compared to another allele, or from insertions or deletions, duplications, inversions, and other alterations known in the art.

[0049] As used herein, the term "modification" refers to changes in an oligonucleotide probe at the molecular level (e.g., base moiety, sugar moiety, or phosphate backbone). Nucleoside modifications include, but are not limited to: the introduction of cleavage inhibitors or inducers, the introduction of minor groove binding agents, isotope enrichment, isotope depletion, the introduction of deuterium, and halogenation. Nucleoside modifications may also include moieties that increase the stringency of hybridization or increase the melting temperature of the oligonucleotide probe. For example, a nucleotide molecule can be modified with an additional bridge connecting the 2' and 4' carbons to produce locked nucleic acid (LNA) nucleotides, which are resistant to cleavage by nucleases (as described in Imanishi et al., U.S. Patent No. 6,268,490, and Wengel et al., U.S. Patent No. 6,794,499). The tag moiety of an oligonucleotide probe and the composition of a quenching oligonucleotide molecule are limited only by their ability to form a stable duplex. Therefore, these oligonucleotides may comprise DNA, L-DNA, RNA, L-RNA, LNA, L-LNA, PNA (peptide nucleic acid, as described in Nielsen et al., U.S. Patent No. 5,539,082), BNA (bridging nucleic acid, e.g., 2',4'-BNA(NC) [2'-O,4'-C-aminomethylene-bridging nucleic acid], as described in Rahman et al., J. Am. Chem. Soc. 2008; 130(14): 4886-96), L-BNA, etc. (where “L-XXX” refers to the L-enantiomer of the nucleic acid sugar unit), or any other known changes and modifications to the nucleotide bases, sugars, or phosphodiester backbone.

[0050] Other examples of nucleoside modification include various 2'-substitutions, such as halogenated, alkoxy, and allyloxy groups introduced into the sugar moiety of oligonucleotides. Evidence suggests that 2'-substituted-2'-deoxyadenosine polynucleotides resemble double-stranded RNA rather than DNA. Ikehara et al. (Nucleic Acids Res., 1978, 5, 3315) have shown that 2'-fluorinated substituents in polyA, polyI, or polyC, which form duplexes with their complements, are more stable than polyduplexes of ribonucleotides or deoxyribonucleotides, as determined by standard melting assays. Inoue et al. (Nucleic Acids Res., 1987, 15, 6131) described the synthesis of mixed oligonucleotide sequences containing a 2'-OMe (O-methyl) substituent on each nucleic acid nucleotide. Mixed 2'-OMe-substituted oligonucleotides hybridize with their RNA complements with similar strength to RNA-RNA duplexes, significantly stronger than RNA-DNA heteroduplexes of the same sequence. Therefore, examples of 2'-position substitutions of sugars include F, CN, CF3, OCF3, OMe, OCN, O-alkyl, S-alkyl, SMe, SO2Me, ONO2, NO2, NH3, NH2, NH-alkyl, OCH3=CH2, and OCCH.

[0051] The term "specific" or "specific" in relation to the binding of one molecule to another (such as a probe for a target polynucleotide) refers to the recognition, contact, and formation of a stable complex between the two molecules, as well as a significantly reduced recognition, contact, or complex formation between the molecule and other molecules. The term "annealing," as used herein, refers to the formation of a stable complex between two molecules.

[0052] The probe is "capable of annealing" to the nucleic acid sequence if at least one region of the probe shares substantial sequence identity with at least one region of the complement of the nucleic acid sequence. "Substantial sequence identity" is at least about 80%, preferably at least about 85%, more preferably at least about 90%, 95% or 99%, and most preferably 100% sequence identity. For the purpose of determining the sequence identity of DNA and RNA sequences, U and T are generally considered to be the same nucleotide. For example, a probe containing the sequence ATCAGC is capable of hybridizing with a target RNA sequence containing the sequence GCUGAU.

[0053] As used herein, the term "cleavage reagent" refers to any tool, including but not limited to enzymes, capable of cleaving oligonucleotide probes to produce fragments. For methods in which amplification does not occur, the cleavage reagent may be used solely to cleave, degrade, or otherwise separate a second portion or fragment of the oligonucleotide probe. The cleavage reagent may be an enzyme. The cleavage reagent may be natural, synthetic, unmodified, or modified.

[0054] For methods in which amplification occurs, the cleavage reagent is preferably an enzyme with both synthetic (or polymeric) activity and nuclease activity. Such enzymes are typically nucleic acid amplification enzymes. Examples of nucleic acid amplification enzymes are nucleic acid polymerases, such as those found in *Thermophyton floccosum* (aquatic bacteria). Thermus aquaticus (Taq) DNA polymerase (TaqMan) ® ) or E. coli ( E. coli DNA polymerase I. The enzyme may be naturally occurring, unmodified, or modified.

[0055] Nucleic acid polymerases are enzymes that catalyze the incorporation of nucleotides into nucleic acids. Exemplary nucleic acid polymerases include DNA polymerase, RNA polymerase, terminal transferase, reverse transcriptase, telomerase, etc.

[0056] "Thermostable DNA polymerase" refers to a DNA polymerase that, when subjected to high temperatures for a selected period of time, is stable (i.e., resistant to degradation or denaturation) and retains sufficient catalytic activity. For example, when subjected to high temperatures for the time necessary for double-stranded nucleic acid denaturation, a thermostable DNA polymerase retains sufficient activity to perform the subsequent primer extension reaction. The heating conditions necessary for nucleic acid denaturation are well known in the art and are exemplified in U.S. Patent Nos. 4,683,202 and 4,683,195. Thermostable polymerases, as used herein, are generally suitable for temperature-cyclic reactions such as polymerase chain reaction ("PCR"). Examples of thermostable nucleic acid polymerases include *Thermophyton floccosum* Taq DNA polymerase, *Thermophyton* species Z05 polymerase, and *Thermophyton xanthophores* (…). Thermus flavus Polymerase, Thermophyton floccosum ( Thermotoga maritima Polymerases, such as TMA-25 and TMA-30 polymerases, Tth DNA polymerase, etc.

[0057] A "modified" polymerase is a polymerase in which at least one monomer differs from a reference sequence, such as a natural or wild-type form of the polymerase or another modified form of the polymerase. Exemplary modifications include monomer insertion, deletion, and substitution. Modified polymerases also include chimeric polymerases having identifiable component sequences (e.g., structural or functional domains) derived from two or more parents. The definition of modified polymerases also includes those chemically modified polymerases that incorporate a reference sequence. Examples of modified polymerases include G46E E678G CS5 DNA polymerase, G46EL329A E678G CS5 DNA polymerase, G46E L329A D640G S671F CS5 DNA polymerase, G46E L329AD640G S671F E678G CS5 DNA polymerase, G46E E678G CS6 DNA polymerase, Z05 DNA polymerase, ΔZ05 polymerase, ΔZ05-Gold polymerase, ΔZ05R polymerase, E615G Taq DNA polymerase, E678G TMA-25 polymerase, and E678G TMA-30 polymerase.

[0058] The term "5'-3' nuclease activity" or "5'-3' nuclease activity" refers to the activity of a nucleic acid polymerase, typically associated with nucleic acid chain synthesis, involving the removal of nucleotides from the 5' end of the nucleic acid chain. For example, *E. coli* DNA polymerase I possesses this activity, while the Klenow fragment does not. Some enzymes with 5'-3' nuclease activity are 5'-3' exonucleases. Examples of such 5'-3' exonucleases include those from *Bacillus subtilis* (…). B. subtilis Exonucleases from spleen, phosphodiesterase, λ exonuclease, exonuclease II from yeast, exonuclease V from yeast, and exonuclease V from Neurospora crassa ( Neurospora crassa (Exonucleases)

[0059] The term "propylene glycol" or "propylene glycol spacer" refers to 1,3-propanediol and is synonymous with propane-1,3-diol, 1,3-dihydroxypropane, and trimethylenediol. The term "HEG" or "HEG spacer" refers to hexaethylene glycol, which is synonymous with 3,6,9,12,15-pentaheptadecane-1,17-diol.

[0060] Various aspects of this invention are based on the specific properties of nucleic acid polymerases. Nucleic acid polymerases can possess several activities, including 5' to 3' nuclease activities, whereby the nucleic acid polymerase can cleave mononucleotides or small oligonucleotides from oligonucleotides annealed to their larger complementary polynucleotides. For cleavage to occur effectively, the upstream oligonucleotide must also be annealed to the same larger polynucleotide.

[0061] Target nucleic acids can be detected using 5' to 3' nuclease activity via TaqMan. ® The assay is performed using either the "5'-nuclease assay" or as described in U.S. Patent Nos. 5,210,015; 5,487,972; and 5,804,375; and Holland et al., 1988, Proc. Natl. Acad. Sci. USA 88:7276-7280. In TaqMan... ® In the assay, a labeled detection probe hybridizing within the amplification region is present during the amplification reaction. The probe is modified to prevent it from acting as a primer for DNA synthesis. The amplification is performed using a DNA polymerase with 5' to 3' exonuclease activity. During each synthetic step of the amplification, any probe hybridizing with the target nucleic acid downstream of the extended primer is degraded by the 5' to 3' exonuclease activity of the DNA polymerase. Therefore, the synthesis of a new target strand also leads to probe degradation, and the accumulation of degradation products provides a measure of target sequence synthesis.

[0062] Any method suitable for detecting degradation products can be used in 5' nuclease assays. Typically, the detection probe is labeled with two fluorescent dyes, one of which quenches the fluorescence of the other. The dyes are attached to the probe, typically a reporter or detection dye is attached to the 5' end, and a quenching dye is attached to an internal site, such that quenching occurs when the probe is in a non-hybridized state, and cleavage of the probe by the 5' to 3' exonuclease activity of a DNA polymerase occurs between the two dyes. Amplification results in probe cleavage between the dyes, accompanied by the elimination of quenching and an observable increase in fluorescence from the initially quenched dye. The accumulation of degradation products is monitored by measuring the increase in reaction fluorescence. U.S. Patent Nos. 5,491,063 and 5,571,673 describe alternative methods for detecting probe degradation accompanying amplification.

[0063] The 5' nuclease assay for detecting target nucleic acids can employ any polymerase having 5' to 3' exonuclease activity. Therefore, in some embodiments, the polymerase with 5' nuclease activity is a thermostable and thermally active nucleic acid polymerase. Such thermostable polymerases include, but are not limited to, those from the genus *Thermomyces*. Thermus ), Thermophyton genus ( Thermatoga ) and Thermophyton genus ( Thermosipho Polymerases of various species of *Thermomyces* in natural and recombinant forms, as well as their chimeric forms. For example, polymerases of *Thermomyces* species that can be used in the methods of this invention include *Thermomyces aquaticus* (…). Taq DNA polymerase, thermophilic bacteria ( TthDNA polymerase, *Thermophyton* species Z05 (Z05) DNA polymerase, *Thermophyton* species sps17 (sps17), and *Thermophyton* species Z05 (e.g., described in U.S. Patent Nos. 5,405,774; 5,352,600; 5,079,352; 4,889,818; 5,466,591; 5,618,711; 5,674,738 and 5,795,762). *Thermophyton* polymerases that can be used in the methods of this invention include, for example, *Thermophyton spp.* DNA polymerase and *Thermophyton neo-Apollo* (…). Thermatoga neapolitana DNA polymerase, and an example of a usable Thermophyton spp. polymerase is Thermophyton africanum (African Thermophyton). Thermosipho africanus DNA polymerases. The sequences of DNA polymerases from *Thermophyton floccosum* and *Thermophyton africanus* are disclosed in International Patent Application No. PCT / US91 / 07035, Publication No. WO 92 / 06200. The sequence of *Thermophyton neo-Apollo* can be found in International Patent Publication No. WO 97 / 09451.

[0064] In 5' nuclease assays, amplification detection typically occurs simultaneously with amplification (i.e., "real-time"). In some embodiments, amplification detection is quantitative and real-time. In some embodiments, amplification detection is qualitative (e.g., endpoint detection of the presence or absence of the target nucleic acid). In some embodiments, amplification detection occurs after amplification. In some embodiments, amplification detection is qualitative and occurs after amplification.

[0065] In this invention, real-time PCR amplification and detection of two or more target nucleic acids can be performed in a single reaction vessel (e.g., tube, well), using standard TaqMan. ® Oligonucleotide probes are used to detect the presence of a first target, and one or more novel TaqMan probes are used. ® Oligonucleotide probes are used to detect the presence of a second, third, or more targets, where all probes contain the same fluorescent label. Alternatively, the novel TaqMan... ® Oligonucleotide probes can be used to detect the presence of all target nucleic acids. The novel probe has two distinguishing features.

[0066] The first feature of the novel probe is that it comprises two distinct parts. The first part, called the annealing portion, contains a sequence at least partially complementary to the target nucleic acid sequence, enabling it to hybridize with the target sequence. The annealing portion also contains a quencher portion. In one embodiment, the annealing portion contains a reporter portion, such as a fluorescent dye, which is quenched by the quencher portion and separated from it via a nuclease-sensitive cleavage site. The second part of the oligonucleotide probe is called the tag portion. In one embodiment, the tag portion is attached to the 5' end of the annealing portion. In another embodiment, the tag portion is attached to the 3' end of the annealing portion. In yet another embodiment, the tag portion is attached to any location between the 5' and 3' ends of the annealing portion via a linker. The tag portion may contain a nucleotide sequence that is not complementary to the target nucleic acid sequence and forms a "drum-wing" region that cannot bind to the target nucleic acid (see illustration of a 5' drum-wing probe). Figure 1 The tag portion may also contain non-nucleotides, such as any organic moiety, or repeating units (e.g., (CH2-CH2-O)n, as long as it can be linked to the annealing portion and can interact with quenching molecules (as described in the following section). In one embodiment, the tag portion contains a reporter moiety, such as a fluorescent dye, which can be quenched by the quenching moiety on the annealing portion. The annealing and tag portions of the oligonucleotide probe may optionally be separated by a non-nucleotide "linker". This linker may contain carbon, carbon and oxygen, carbon and nitrogen, or any combination thereof, and may have any length. Furthermore, the linker may contain linear or cyclic portions. The linker may be derived from a single unit or from multiple identical or different units separated by phosphate ester bonds. The purpose of the linker is to create a region located at the junction of the annealing and tag portions of the oligonucleotide probe. The linker may also prevent the tag portion from being extended by nucleases when it is separated from the annealing portion. Alternatively, another modification to the separated tag portion may render it unextendable by nucleases.

[0067] The second feature of the novel probe is that the tag portion binds to a quenching molecule. If the tag portion is a nucleotide sequence, the quenching molecule can be an oligonucleotide that is completely or partially complementary to the nucleotide sequence of the tag portion and hybridizes with the tag portion. The quenching molecule also contains or is bound to a quenching moiety (i.e., a second quenching moiety), which is also capable of quenching the signal from the reporter portion (e.g., a fluorescent dye) on the tag portion. The quenching moiety (second quenching moiety) on or bound to the quenching molecule can be the same as or different from the quenching moiety (first quenching moiety) on the annealing portion. Therefore, prior to PCR amplification, the reporter portion on the tag portion is quenched by the quenching moiety on the probe annealing portion and the quenching moiety on or bound to the quenching molecule (e.g., by a quenching molecule). Figure 1 The quenching oligonucleotides shown in the figure are both quenched.

[0068] The general principle of real-time PCR amplification and target nucleic acid detection using novel probes in 5' nuclease assays is described below. First, a sample suspected of containing the target nucleic acid is provided. Then, the sample is contacted with PCR reagents in a single reaction vessel (e.g., a single test tube or a single well in a multi-well microplate), the PCR reagents containing both oligonucleotide primers capable of producing amplicons of the target nucleic acid and novel oligonucleotide probes. PCR amplification is initiated using a nucleic acid polymerase with 5' to 3' nuclease activity, such that during the extension step of each PCR cycle, the nuclease activity allows the quenching portion of the polymerase to be cleaved and separated from the annealed portion of the probe. The separated tag portion may optionally contain modifications (such as non-nucleotide linkers) that prevent it from being extended by the nucleic acid polymerase.

[0069] Subsequently, the signal from the reporter portion on the isolated tag portion is measured at a first temperature, typically the annealing and / or extension temperature, at which the quenching molecule still binds to the tag portion. The signal from the reporter portion (e.g., a fluorescent dye) on the tag portion is still quenched due to the presence of the quenching agent portion on or bound to the quenching molecule. Then, as a normal step in the PCR cycle, the temperature is gradually increased to the denaturation temperature. As the temperature increases from the extension temperature to the denaturation temperature, the point at which the quenching molecule no longer binds to the tag portion is reached. If the quenching molecule is an oligonucleotide with a sequence complementary to the nucleotide sequence of the tag portion, this dissociation occurs at the melting temperature (T0) of the double-stranded structure formed between the quenching oligonucleotide molecule and the tag portion. m Then, at T equal to or higher than the duplex... m The signal from the reporter portion is measured at a second temperature, which is no longer quenched by the quencher portion bound to or on the quenching oligonucleotide. Even better, the second temperature is higher than T. m Temperature is used to ensure that nearly 100% of the label portion is in single-chain form. However, it is also possible to use temperatures below T. m The signal is measured at a temperature of [temperature value missing]. The calculated signal value is then determined by subtracting the signal detected at the first temperature (where the quenching molecules are still bound to the tag portion) from the signal detected at the second temperature (where the quenching molecules are not bound to the tag portion). (See [reference missing]) Figure 2 and Figure 3 The calculated signal values ​​can be optionally normalized to correct for signals that may be affected by temperature. For example, it is known that fluorescence signals decrease at higher temperatures, and therefore, standards can be used to normalize signal values ​​obtained at different temperatures.

[0070] These signal measurements and calculations are performed over multiple PCR cycles, and the determined cumulative signal values ​​can be used not only to determine the presence or absence of the target nucleic acid, but also to determine the amount of the target nucleic acid by measuring a threshold (Ct value) from a PCR growth curve generated from a plot of the calculated signal values ​​relative to the number of PCR cycles. In one embodiment, signal measurements and calculations are performed at each PCR cycle.

[0071] Multiplex PCR assays using only a single reporter motif (e.g., a fluorescent dye) are possible by designing oligonucleotide probes that exhibit activity across various T... m The tagged portions hybridize with their respective quenched oligonucleotide molecules at a given temperature. For example, by using three oligonucleotide probes, all labeled with the same fluorophore, it is possible to amplify and detect three target nucleic acids in a single reaction. Standard TaqMan ® Oligonucleotide probes can be used to detect a primary target by measuring fluorescence signals at a first temperature (typically the annealing temperature of a PCR cycle). They possess low T... m The first “tagged” probe of the tag-quenching oligonucleotide duplex can be used to quench the T-cell structure. m Temperature or higher than its T m The fluorescence value is measured and calculated at a second temperature, which is higher than the first temperature, to detect the second target. High T m The second "tagged" probe of the tag-quenching oligonucleotide duplex can be used to measure its T m Temperature or higher than its T m The fluorescence value is measured and calculated at a temperature higher than the second temperature to detect the third target. (See also...) Figure 4 In theory, a TaqMan can be used. ® The probe and two differently labeled probes with four to seven different reporter motifs (e.g., fluorescent dyes) can detect 12 to 21 different target nucleic acids in a single reaction, or use a TaqMan probe. ® The probe and three different labeled probes can detect 16 to 28 different target nucleic acids in one reaction.

[0072] Alternatively, novel probes of the present invention can be designed such that the tag portion is a nucleotide sequence linked to a quenching oligonucleotide to form a hairpin (i.e., a stem-loop structure). In this structure, the "stem" portion will consist of a complementary region between the tag portion and the quenching oligonucleotide, while the "loop" portion may contain non-complementary nucleotides or non-nucleotides, such as the aforementioned linker.

[0073] Although the novel probe of the present invention has been described having a reporter portion located on the probe tag portion, the reporter portion may also be positioned on the annealing portion and the first quencher portion placed on the tag portion, provided that the reporter portion can reversibly interact with the second quencher portion on the quenching molecule. In a general sense, the reporter portion is designed and positioned in the probe oligonucleotide in such a way that it is activated by the 5' nuclease (TaqMan). ® During the assay, the probe separates from the first quenching moiety on the annealed portion and is further designed to reversibly interact with the second quenching moiety on the quenching molecule. Some of these various alternative embodiments of the novel probe can be found in... Figure 5 middle.

[0074] To implement the method of the present invention, certain features are required in the design of the tag portion of the probe oligonucleotide and the quenching molecule. In one embodiment, both the tag portion and the quenching molecule comprise a nucleotide sequence. In this case, neither the tag portion nor the quenching oligonucleotide should specifically hybridize to the target nucleic acid sequence, but they should be fully or partially complementary to each other to allow hybridization at the desired temperature. Both may include modifications at their 3' ends to prevent extension by nucleic acid polymerase during PCR amplification. The reporter portion (e.g., a fluorescent dye) on the tag portion and the quencher portion on the quenching oligonucleotide can be located at the 5' end, the 3' end, or anywhere between the 5' and 3' ends, but when the tag portion hybridizes with the quenching oligonucleotide, they must be positioned close to each other so that the quenching portion quenches the detectable signal from the reporter portion.

[0075] For different tag moieties that hybridize with their respective quenching oligonucleotide molecules at various Tm temperatures, modified nucleotides can be introduced at all or some positions on the tag moieties, on the quenching oligonucleotides, or on both the tag moieties and the quenching oligonucleotides, allowing for a shortening of the oligonucleotide length. Examples of nucleotide modifications used to increase the melting temperature include LNA, PNA, G-clamp (9-(aminoethoxy)-phenoxazine-2'-deoxycytidine), propynyldeoxyuridine (pdU), propynyldeoxycytidine (pdC), and various 2' modifications at the sugar group, such as 2'-O-methyl modifications. Another type of modification that can be used to prevent unwanted binding of nucleic acid polymerases to the tag moieties or quenching oligonucleotides may include the use of enantiomerically L-form nucleotides, such as L-DNA, L-RNA, or L-LNA.

[0076] In another embodiment, the tag portion of the oligonucleotide probe and the quenching molecule comprise nonnucleotide molecules that interact reversibly with each other in a temperature-dependent manner. Examples of such nonnucleotide interactions include, but are not limited to, protein-protein interactions, protein-peptide interactions (e.g., aptamers), protein-small molecule interactions, peptide-small molecule interactions, and small molecule-small molecule interactions. In one instance, the well-known interaction between biotin and avidin (or streptoavidin) can be utilized, wherein the interaction is made reversible and temperature-dependent by modifying the biotin moiety (e.g., dethiobiotin) or the avidin moiety (see Nordlund et al., J. Biol. Chem., 2003., 278(4) 2479-2483) or both.

[0077] In yet another embodiment, the interaction between the tag portion and the quenching molecule can involve a sequence-specific interaction between a nucleotide sequence (or multiple nucleotide sequences) and a non-nucleotide molecule. Examples of these types of interactions include, but are not limited to, nucleic acid aptamers, DNA-binding proteins or peptides, and DNA minor groove binders. The design and synthesis of sequence-specific DNA-binding molecules have been described in numerous papers (see, for example, Dervan, Science, 1986, 232, 464-471; White et al., Nature, 1998, 391, 468-471), and these methods can be used to generate temperature-dependent interactions between the tag portion and the quenching molecule. Similarly, the interaction between a double-stranded nucleotide and a soluble quencher can be utilized, such that the quenching portion does not need to be contained within the quenching molecule itself, but can be in a soluble form that interacts with and quenches the reporter portion only when the tag portion binds to the quenching molecule. Embodiments of the invention will be further described in the following examples, which do not limit the scope of the invention as described in the claims.

[0078] Example Example 1: Validation of quenching by quenching oligonucleotides Experiments were conducted to verify that the quenching oligonucleotides containing the quencher moiety could hybridize with the fluorescently labeled tag portion of the oligonucleotide probe and quench the fluorescence signal at temperatures below the melting temperature of the double strand, but not at temperatures above the melting temperature where the double strand has dissociated. Table 1 shows the nucleotide sequences containing the tag portion and the quenching oligonucleotides. Quenching oligonucleotide Q0 does not contain the quencher, while quenching oligonucleotide Q1 contains the BHQ-2 quencher at its 5' end.

[0079] Table 1

[0080] The 9FAM9 TAG oligonucleotide was incubated without quenching oligonucleotide (QX), or with Q0 or Q1 quenching oligonucleotide at a 1:5 molar ratio. The mixture was then cycled in 50 μL of a reaction consisting of 60 mM Tricine, 120 mM potassium acetate, 5.4% DMSO, 0.027% sodium azide, 3% glycerol, 0.02% Tween 20, 43.9 μM EDTA, 0.2 U / μL UNG, 0.1 μM 19TAGC9FAMC9, 0.5 μM Q0 or Q1, 400 μM dATP, 400 μM 4CTP, 400 μM dGTP, 800 μM dUTP, and 3.3 mM manganese acetate. Cycling conditions similar to those of a typical PCR amplification reaction are shown in Table 2.

[0081] Table 2 .

[0082] The results of the experiment showed Figure 6 Above. When measuring the signal from the FAM dye at 58°C, fluorescence was detected in the absence of the quenching oligonucleotide (QX) or with the use of the quenching oligonucleotide (Q0) without the quenching moiety, but no signal was detected in any cycle in the presence of the Q1 quenching oligonucleotide. Conversely, when measuring fluorescence at 80°C, the signal was detected in all cycles, even in the presence of the Q1 quenching oligonucleotide, confirming that at higher temperatures, the Q1 quenching oligonucleotide no longer hybridizes with TAG, and no quenching was observed.

[0083] Example 2: Real-time PCR using labeled probes and quenched oligonucleotides Real-time PCR studies were performed using samples containing various concentrations of internal control template (GIC) mixed with template sequences (HIM) from group M HIV-1. Standard TaqMan hybridization with GIC sequences was used. ® A hydrolysis probe (G0) and a labeled probe (L24) containing a complementary quenching oligonucleotide (Q9) and an annealed portion hybridizing with the HIM sequence were used to detect amplification products generated from these two templates. Both probes were labeled with FAM, and their sequences and the sequences of the quenching oligonucleotide are shown in Table 3.

[0084] Table 3

[0085] Four concentrations of GIC (0 copies / reaction (cp / rxn), 100 cp / rxn, 1,000 cp / rxn, and 10,000 cp / rxn) were mixed with four concentrations of HIM (0 cp / rxn, 10 cp / rxn, 100 cp / rxn, and 1,000 cp / rxn) to form 16 different concentration combinations. PCR reagents and cycling conditions were as described in Example 1 and Table 2, except that 100 nM of GO and L24 probes and 200 nM of Q9 quenching oligonucleotides were used in the reactions. Starting from the 6th cycle, fluorescence readings from the FAM label were acquired at 58 °C and 80 °C for each cycle (see Table 2).

[0086] The results of these experiments show Figure 7-9 Above. The fluorescence reading at 58℃ is shown as... Figure 7 The growth curve in the image. Figure 7 A shows the growth curves produced in the absence of HIM and with 0, 100, 1,000, or 10,000 cp / rxn GIC. Interestingly, in the presence of 10 cp / rxn ( Figure 7 B), 100 cp / rxn ( Figure 7 C) and 1,000 cp / rxn ( Figure 7 In the case of HIM (D), there was essentially no difference in fluorescence intensity and cycle threshold (Ct) values ​​in the growth curve readings at 58 °C, indicating that only fluorescence from standard TaqMan was detected at this temperature. ® The FAM signal of the G0 probe. This is because the FAM label on the L24-labeled probe is quenched very effectively by the quencher on the Q9 quenching oligonucleotide, and does not interfere with the detection of the GIC target.

[0087] The fluorescence reading at 80℃ is shown as Figure 8 The growth curve in the image. Figure 8 A shows the growth curves produced in the absence of GIC and with HIM at 0, 10, 100, or 1,000 cp / rxn. Fluorescence from the FAM label on the L24 probe can now be detected because it is no longer quenched by both the quencher on the probe's "annealing portion" (due to nuclease hydrolysis) and the quencher on the quenched oligonucleotide (Q9) (due to chain dissociation at this high temperature). Although the fluorescence intensity from the L24 probe is significantly lower than that from the G0 probe, it is still sufficient to calculate the Ct value corresponding to the initial HIM concentration. However, when both HIM and GIC are present, the fluorescence readings at 80°C produce complex curves due to the stronger fluorescence detected from the G0 probe. (See...) Figure 8B, 8C, 8D). Therefore, in order to "detect" the fluorescence signal from the L24-labeled probe, it is necessary to subtract the fluorescence signal from the G0 probe. This involves subtracting the fluorescence reading at 58°C (which is contributed solely by the G0 probe) from the fluorescence reading at 80°C, and deriving a similar result to that in Figure 8 The growth curves observed in A.

[0088] When 100% of the fluorescence reading at 58℃ is subtracted from the fluorescence reading at 80℃, the derived growth curve shows a negative value, indicating overcompensation due to the subtraction. This observation is because the fluorescence intensity of the FAM label at 80℃ is lower than that at 58℃. Therefore, a "normalization" coefficient is considered necessary, and it was then empirically determined that subtracting 84% of the 58℃ signal from the 80℃ signal yielded the best results. The derived growth curve is shown in... Figure 9 Among A, 9B, 9C, and 9D, and all are related to Figure 8 The growth curves of GIC A and GIC B are substantially the same. These results show that the fluorescence signal indicating the presence of GIC can be separated from the fluorescence signal indicating the presence of HIM, and confirm the multiplexing effect of the present invention.

[0089] Example 3: Real-time PCR using probes with different fluorescent dyes A series of experiments were performed as described in Example 2, but the G0 and L24 probes were labeled with FAM dye in the first group, HEX dye in the second group, JA270 dye in the third group, and Cy5.5 dye in the fourth group. In each group, PCR amplification was performed using only the GIC template present at 100 cp / rxn, only the HIV template present at 1000 cp / rxn, or both GIC (100 cp / rxn) and HIV (1000 cp / rxn) templates. The results are shown in Figure 10. In the fluorescence readings at 58°C (Figure 10, column 1), as expected, only the signal generated by the G0 probe used for the GIC template was observed, because the L24 probe still hybridized to the Q9 quenched oligonucleotide. In the fluorescence readings at 80°C (Figure 10, column 2), signals were observed from both the G0 probe (for GIC) and the "unquenched" L24 probe (for HIV). After applying normalization coefficients to each fluorescent dye, the signal at 58°C was subtracted from the signal at 80°C to generate growth curves derived solely from the HIV template (Figure 10, column 3). The signals generated from HEX and JA270 were similar to or higher than those from FAM, while the signal from Cy5.5 was significantly lower than the FAM signal but still detectable.

[0090] Example 4: Real-time PCR using L-DNA-labeled probes and quenched oligonucleotides The same experiments as described in Example 2 were performed, except that the L24-labeled probe used to detect group M HIV-1 (HIM) templates was composed entirely of L-deoxyribonucleotides (instead of "natural" D-deoxyribonucleotides). The results are shown in Figure 11, where the fluorescence signal produced by the L24-labeled probe in its L-enantiomer form was observed to be 4-5 times stronger than that produced by the L24-labeled probe in its D-enantiomer form.

[0091] Example 5: Real-time PCR using labeled probes with 2'-O methyl modification and quenching oligonucleotides Experiments similar to those described in Example 2 were performed, except that labeled probes with nucleotide modifications and quenching oligonucleotides were used. In addition to the “standard” L24 probe used to detect the presence of the HIM template, a labeled probe L24-OME was generated, wherein each nucleotide in the tag portion of the probe (shown as the underlined portion of L24 in Table 3) was modified by having an O-methyl substituent at the 2' position of the ribose portion (2'-OMe). Two modified Q9 quenching oligonucleotides were also generated for hybridization with the tag portion of L24. Each nucleotide of Q9-OME was modified by a 2'-OMe substituent, and only the A and G nucleotides of Q9-OME (A / G) were modified by a 2'-OMe substituent. HIM template detection was performed using three different combinations of the tag portion and quenching oligonucleotides: L24 with Q9-OME (A / G), L24-OME with Q9-OME (A / G), and L24-OME with Q9-OME. The results of this experiment are shown in... Figure 12 middle.

[0092] As expected, at 58°C, only G0 TaqMan could be detected. ® Fluorescence signals of the probes. Fluorescence signals from G0 and from L24 / Q9-OME (A / G) were detected at 75 °C, but no fluorescence signals were detected from the two other tag-quencher oligonucleotide combinations. Fluorescence signals from L24-OME / Q9-OME (A / G) were also detected at 88 °C, and signals from all probes (including the L24-OME / Q9-OME combination) were detected at 97 °C. These results demonstrate that not only can fluorescence readings at three independent temperatures be obtained using labeled probes and quencher molecules, but also that nucleotide modifications such as 2'-OMe can be selectively introduced into the nucleotide sequence of the tag portion or the quencher oligonucleotide, or both, thereby altering the melting temperature of the tag-quencher oligonucleotide duplex without changing their sequence or their length.

[0093] Although the foregoing invention has been described in considerable detail for clarity and understanding, it will be apparent to those skilled in the art, upon reading this disclosure, that various changes in form and detail may be made without departing from the true scope of the invention. For example, the methods described above can be used in various combinations.

[0094] Informal sequence list SEQ ID NO 1: 9FAM9TAG Oligonucleotide sequence CGTCGCCAGTCAGCTCCGGT SEQ ID NO 2: Q0 quenched oligonucleotide sequence (without quencher) CCGGAGCTGACTGGCGACG SEQ ID NO 3: Q1 quenching oligonucleotide sequence (BHQ-1 quencher at the 5' end) CCGGAGCTGACTGGCGACG SEQ ID NO 4: G0 TaqMan probe oligonucleotide sequence (FAM / BHQ / phosphate ester) TGCGCGTCCCGTTTTGATACTTCGTAACGGTGC SEQ ID NO 5: L24-labeled probe oligonucleotide sequence (BHQ / FAM / phosphate ester) TCTCTACGCAGTGGCGCCCGAACAGGGACCACACATTGGCACCGCCGTCT SEQ ID NO 6: Q9 quenching oligonucleotide sequence (quencher at the 3' end) AGACGGCGGTGCCAATGTGTG.

Claims

1. A method for detecting two or more target nucleic acid sequences in a sample, comprising the following steps: (a) Contact the sample suspected of containing two or more of the target nucleic acid sequences in a single reaction vessel with the following: (i) A first pair of oligonucleotide primers and a second pair of oligonucleotide primers, wherein the first pair of oligonucleotide primers has a nucleotide sequence complementary to each strand of the first target nucleic acid sequence, and the second pair of oligonucleotide primers has a nucleotide sequence complementary to each strand of the second target nucleic acid sequence. (ii) A first oligonucleotide probe comprising a nucleotide sequence at least partially complementary to a first target nucleic acid sequence and annealed within a region of the first target nucleic acid sequence defined by a first pair of oligonucleotide primers, wherein the first oligonucleotide probe comprises a fluorescent portion capable of generating a detectable signal and a first quencher portion capable of quenching the detectable signal generated by the fluorescent portion, wherein the fluorescent portion is separated from the first quencher portion by a nuclease-sensitive cleavage site. (iii) A second oligonucleotide probe comprising two distinct portions: an annealing portion comprising a nucleotide sequence at least partially complementary to a second target nucleic acid sequence and annealed within a region of the second target nucleic acid sequence defined by a second pair of oligonucleotide primers, wherein the annealing portion comprises a second quencher portion; and a tag portion connected via a linker to a region of the annealing portion comprising a nucleotide sequence not complementary to the two or more target nucleic acid sequences, wherein the tag portion comprises a fluorescent portion identical to the fluorescent portion on the first oligonucleotide probe, and its detectable signal is quenched by the second quencher portion on the annealing portion, wherein the fluorescent portion is separated from the second quencher portion by a nuclease-sensitive cleavage site; (iv) A quenching oligonucleotide comprising a nucleotide sequence at least partially complementary to the tag portion of a second oligonucleotide probe and hybridizing with the tag portion to form a double strand, wherein the quenching oligonucleotide comprises a third quencher portion that quenches a detectable signal generated by a fluorescent portion on the tag portion when the quenching oligonucleotide hybridizes with the tag portion. (b) Using a nucleic acid polymerase with 5' to 3' nuclease activity, the first and second target nucleic acid sequences are amplified by polymerase chain reaction (PCR) such that during the extension step of each PCR cycle, the 5' to 3' nuclease activity of the nucleic acid polymerase allows the fluorescent portion to be cleaved and separated from the first quencher portion on the first oligonucleotide probe, and the fluorescent portion on the tag portion to be cleaved and separated from the second quencher portion on the annealed portion of the second oligonucleotide probe, wherein in the extension step, the quenched oligonucleotide remains hybridized with the tag portion; (c) Measure the fluorescence signal at the first temperature at which the quenched oligonucleotide hybridizes with the tag portion from the second oligonucleotide probe; (d) Raise the temperature to a second temperature higher than the first temperature, at which the quenched oligonucleotide does not hybridize with the tag portion from the second oligonucleotide probe; (e) Measure the fluorescence signal at the second temperature; (f) The calculated signal value is obtained by subtracting the fluorescence signal detected at the first temperature from the fluorescence signal detected at the second temperature; (g) Repeat steps (b) through (f) in multiple PCR cycles to generate the desired amount of amplification product from the first and second target nucleic acid sequences; (h) The presence of the first target nucleic acid sequence is determined by fluorescence signals detected from multiple PCR cycles at the first temperature, and the presence of the second target nucleic acid sequence is determined by calculated signal values ​​from multiple PCR cycles.

2. The method of claim 1, wherein the label portion is attached to the 5' end of the annealed portion.

3. The method of claim 1 or 2, wherein the tag portion comprises a modification such that it cannot be extended by a nucleic acid polymerase.

4. The method of any one of claims 1-3, wherein the quenching oligonucleotide is linked to the tag portion of the second oligonucleotide probe via a stem-loop structure.

5. The method of any one of claims 1-4, wherein the tag portion of the oligonucleotide probe and the quenching oligonucleotide each contain one or more nucleotide modifications selected from 2'-O alkyl-substituted or L-enantiomeric nucleotides.

6. The method of claim 5, wherein the tag portion of the oligonucleotide probe and the portion of the quenching oligonucleotide having a nucleotide sequence complementary to the tag portion are composed of L-enantiomeric nucleotides.

7. A method for detecting two or more target nucleic acid sequences in a sample, comprising the following steps: (a) Contact the sample suspected of containing two or more of the target nucleic acid sequences in a single reaction vessel with the following: (i) A first pair of oligonucleotide primers and a second pair of oligonucleotide primers, wherein the first pair of oligonucleotide primers has a nucleotide sequence complementary to each strand of the first target nucleic acid sequence, and the second pair of oligonucleotide primers has a nucleotide sequence complementary to each strand of the second target nucleic acid sequence. (ii) A first oligonucleotide probe comprising two distinct portions: a first annealing portion comprising a nucleotide sequence at least partially complementary to a first target nucleic acid sequence and annealed within a region of the first target nucleic acid sequence defined by a first pair of oligonucleotide primers, wherein the first annealing portion comprises a first quencher portion and is blocked at the 3' end to prevent extension by a nucleic acid polymerase. The first tag portion is connected via a connector to a region containing an annealed portion of a nucleotide sequence that is not complementary to the two or more target nucleic acid sequences, wherein the first tag portion contains a fluorescent portion whose detectable signal can be quenched by a first quencher portion on the first annealed portion, wherein the fluorescent portion is separated from the first quencher portion by a nuclease-sensitive cleavage site. (iii) A first quenching oligonucleotide comprising a nucleotide sequence at least partially complementary to a first tag portion of a first oligonucleotide probe and hybridizing with the first tag portion to form a double strand, wherein the first quenching oligonucleotide comprises a second quenching portion that, when the first quenching oligonucleotide hybridizes with the first tag portion, quenches a detectable signal generated by a fluorescent portion on the first tag portion. (iv) A second oligonucleotide probe comprising two distinct portions: a second annealing portion comprising a nucleotide sequence at least partially complementary to a second target nucleic acid sequence and annealed within a region of the second target nucleic acid sequence defined by a second pair of oligonucleotide primers, wherein the second annealing portion comprises a third quencher portion and is blocked at the 3' end to prevent extension by a nucleic acid polymerase. The second tag portion is connected via a linker to a region containing an annealed portion of a nucleotide sequence that is not complementary to the two or more target nucleic acid sequences, and has a different nucleic acid sequence or different nucleotide modification compared to the nucleotide sequence of the first tag portion of the first oligonucleotide probe, wherein the second tag portion contains a fluorescent portion that is the same as the fluorescent portion on the first tag portion of the first oligonucleotide probe, and its detectable signal can be quenched by a third quencher portion on the second annealed portion, wherein the fluorescent portion is separated from the third quencher portion by a nuclease-sensitive cleavage site; (v) A second quenching oligonucleotide comprising a nucleotide sequence at least partially complementary to a second tag portion of a second oligonucleotide probe and hybridizing with the second tag portion to form a double strand, wherein the second quenching oligonucleotide comprises a fourth quenching portion that quenches a detectable signal generated by a fluorescent portion on the second tag portion when the second quenching oligonucleotide hybridizes with the second tag portion. The double strand between the second quenching oligonucleotide and the second tag portion of the second oligonucleotide probe has a higher melting temperature (T) than the double strand between the first quenching oligonucleotide and the first tag portion of the first oligonucleotide probe. m ); (b) Using a nucleic acid polymerase with 5' to 3' nuclease activity, amplify the first and second target nucleic acid sequences by polymerase chain reaction (PCR) such that the 5' to 3' nuclease activity of the nucleic acid polymerase allows for the following during the extension step of each PCR cycle: (i) Cutting and separating the fluorescent portion on the first tag portion from the first quencher portion on the first annealed portion of the first oligonucleotide probe, wherein in the extension step, the first quenching oligonucleotide remains hybridized with the first tag portion; and (ii) Cutting and separating the fluorescent portion on the second tag portion from the third quencher portion on the second annealed portion of the second oligonucleotide probe, wherein in the extension step, the second quenching oligonucleotide remains hybridized with the second tag portion; (c) When the temperature is raised to a first temperature, at the first temperature, the first quenching oligonucleotide does not hybridize with the first tag portion from the first oligonucleotide probe, and the second quenching oligonucleotide remains hybridized with the second tag portion from the second oligonucleotide probe; (d) Measure the fluorescence signal at the first temperature; (e) Raise the temperature to a second temperature above the first temperature, at which the second quenching oligonucleotide does not hybridize with the second tag portion from the second oligonucleotide probe; (f) Measure the fluorescence signal at the second temperature; (g) Obtain the calculated signal value by subtracting the fluorescence signal detected at the first temperature from the fluorescence signal detected at the second temperature; (h) Repeat steps (b) through (g) in multiple PCR cycles to generate the desired amount of amplification product from the first and second target nucleic acid sequences; (i) The presence of a first target nucleic acid sequence is determined by fluorescence signals detected from multiple PCR cycles at a first temperature, and the presence of a second target nucleic acid sequence is determined by calculated signal values ​​from multiple PCR cycles.

8. The method of claim 7, wherein the first tag portion is attached to the 5' end of the first annealed portion of the first oligonucleotide probe, and the second tag portion is attached to the 5' end of the second annealed portion of the second oligonucleotide probe.

9. The method of any one of claims 7-8, wherein the first quenching oligonucleotide is linked to the first tag portion of the first oligonucleotide probe via a stem-loop structure.

10. The method of any one of claims 7-9, wherein the second quenching oligonucleotide is linked to the second tag portion of the second oligonucleotide probe via a stem-loop structure.

11. The method of any one of claims 7-10, wherein both the first tag portion and the second tag portion are modified such that neither tag portion can be extended by a nuclease.

12. The method of any one of claims 7-11, wherein the tag portion of the first oligonucleotide probe and the second oligonucleotide probe, as well as the first quenching oligonucleotide and the second quenching oligonucleotide, each contain one or more nucleotide modifications selected from 2'-O alkyl-substituted or L-enantiomeric nucleotides.

13. The method of claim 12, wherein the tag portion of the first oligonucleotide probe and the portion of the first quenching oligonucleotide having a nucleotide sequence complementary to the tag portion of the first oligonucleotide probe are composed of L-enantiomeric nucleotides; and / or The tag portion of the second oligonucleotide probe and the portion of the second quenching oligonucleotide having a nucleotide sequence complementary to the tag portion of the second oligonucleotide probe are composed of L-enantiomer nucleotides.

Citation Information

Patent Citations

  • Methods and compositions for enhancing detection in determinations employing cleavable electrophoretic tag reagents

    US20050053939A1

  • Asymmetric PCR coupled with post-PCR characterization for the identification of nucleic acids

    US20070072211A1

  • Nuclease-Free Real-Time Detection of Nucleic Acids

    US20100143901A1

  • Nucleic acid target identification by strucutre based probe cleavage

    US20140272955A1

  • Multiplexed nucleic acid target identification by strucutre based probe cleavage

    US20150176075A1