use of an agent that overexpresses parp7 in the manufacture of a medicament for treating septic cardiomyopathy

Abstract

This invention provides the use of a reagent overexpressing Parp7 in the preparation of drugs for treating septic cardiomyopathy, belonging to the field of biomedical technology. This invention involves constructing a recombinant adeno-associated virus vector AAV9-F4 / 80- that specifically overexpresses PARP7 on macrophages. Parp7 The drug was intravenously injected into mice, and a septic cardiomyopathy model was established using lipopolysaccharide induction. Experimental results showed that macrophage-specific overexpression of PARP7 significantly reduced serum levels of myocardial injury markers CK-MB and cTnT, improved cardiac function indicators such as ejection fraction and fractional shortening, alleviated myocardial tissue pathological damage, and inhibited macrophage infiltration and inflammatory factors. Ifn-beta , Tnf- α , Il‑6 and Il‑1β The expression of PARP7. This invention reveals the protective role of PARP7 in septic cardiomyopathy, providing a new target and strategy for the treatment of septic cardiomyopathy.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the use of reagents that overexpress Parp7 in the preparation of drugs for treating septic cardiomyopathy. Background Technology

[0002] Septic cardiomyopathy is a reversible myocardial dysfunction caused by sepsis, clinically manifested as ventricular dilation, decreased ejection fraction, and impaired response to volume overload. It is a significant complication leading to death in sepsis patients. Its pathogenesis is complex, involving multiple factors such as dysregulation of the inflammatory response, mitochondrial dysfunction, oxidative stress, and microcirculatory disturbances. Currently, there is a lack of specific treatments for septic cardiomyopathy; clinical treatment mainly focuses on anti-infection therapy, fluid resuscitation, and supportive medication with vasoactive drugs. Therefore, identifying new intervention targets is of significant clinical importance.

[0003] Poly(ADP-ribose) polymerase 7 (Parp7, also known as Tiparp) is a member of the PARP family and is believed to play a role in DNA damage repair, transcriptional regulation, and inflammatory responses. Existing research suggests that Parp7 may act as a negative regulator of inflammation and stress responses.

[0004] For example, prior art (WO2023139536A1) discloses methods for inhibiting the catalytic activity of PARP7 enzymes present in cells. The compound can be used to treat cardiomyopathy. However, there are currently no reports on the protective effect of PARP7 overexpression against myocardial damage and improvement of cardiac function in septic cardiomyopathy, and existing technologies do not provide any technical insights.

[0005] In conclusion, exploring the role of PARP7 in septic cardiomyopathy and developing therapeutic strategies targeting PARP7 are of great significance. Summary of the Invention

[0006] The purpose of this invention is to provide the use of reagents that overexpress Parp7 in the preparation of medicaments for treating septic cardiomyopathy.

[0007] This invention provides the use of reagents that overexpress Parp7 in the preparation of medicaments for treating septic cardiomyopathy.

[0008] Furthermore, the reagent for overexpressing Parp7 is an adeno-associated virus vector that overexpresses Parp7.

[0009] Furthermore, the adeno-associated virus vector is an AAV9 serotype vector.

[0010] Furthermore, the reagent for overexpressing Parp7 contains a macrophage-specific promoter and a nucleotide sequence encoding the Parp7 protein.

[0011] Furthermore, the macrophage-specific promoter is F4 / 80 Gene promoter.

[0012] Furthermore, the nucleotide sequence encoding the Parp7 protein is shown in SEQ ID NO:1.

[0013] Furthermore, the septic cardiomyopathy is lipopolysaccharide-induced septic cardiomyopathy.

[0014] Furthermore, the drug is a drug that reduces myocardial damage, inhibits inflammatory cell infiltration, or reduces the expression of inflammatory factors.

[0015] The present invention also provides an AAV9 -F4 / 80-parp7 Adeno-associated virus vector, the vector containing F4 / 80 A gene promoter and a nucleotide sequence encoding the Parp7 protein; the nucleotide sequence encoding the Parp7 protein is shown in SEQ ID NO:1.

[0016] The present invention also provides a pharmaceutical composition comprising the above-described AAV9. -F4 / 80-parp7 Adeno-associated virus vectors are used as active ingredients, as well as pharmaceutically acceptable carriers or excipients.

[0017] The present invention has achieved the following beneficial effects: (1) This invention reveals the protective effect of PARP7 in septic cardiomyopathy and provides a method for overexpression of PARP7. Parp7 The reagents have been used for a new purpose in the preparation of drugs for treating septic cardiomyopathy.

[0018] (2) By constructing a recombinant AAV9 vector that specifically overexpresses PARP7 in macrophages, this invention achieves targeted regulation of PARP7 expression in macrophages in myocardial tissue, significantly reduces lipopolysaccharide-induced myocardial injury, inhibits inflammatory cell infiltration and inflammatory factor expression, and effectively improves cardiac function.

[0019] (3) This invention provides new therapeutic targets and intervention strategies for septic cardiomyopathy, and has clear clinical application potential.

[0020] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0021] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0022] Figure 1 This is a vector map.

[0023] Figure 2 These are the sequencing alignment results.

[0024] Figure 3 Effects of macrophage-specific overexpression of PARP7 on cardiac function and myocardial injury in mice with septic cardiomyopathy: (A): Schematic diagram of the experimental protocol; (BC): Serum levels of myocardial injury markers CK-MB (B) and cTnT (C); (DF): Echocardiographic findings, including representative M-mode ultrasound images (D), ejection fraction (E), and fractional shortening (F); (G): Representative images of myocardial tissue stained with H&E; (HK): Representative images of myocardial tissue stained with immunohistochemical staining and quantitative analysis, showing F4 / 80⁺ (HI) and CD11b⁺ (JK) macrophage infiltration; (LO): Inflammatory factors in myocardial tissue. Ifn-β (L) Tnf-α (M) Il-6 (N) and Il-1β (O) mRNA expression level. Detailed Implementation

[0025] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0026] Example 1, AAV9- F4 / 80 - Parp7 (Tiparp) Preparation of adeno-associated virus vector I. AAV9- F4 / 80 - Parp7 (Tiparp) Preparation of adeno-associated virus vector 1. Vector and target gene information 1.1 Purpose Carrier Information Carrier spectrum as follows Figure 1 As shown.

[0027] 1.2 Target gene sequence information: The target gene of this invention is Parp7 ( Tiparp Its complete encoded nucleotide sequence (SEQ ID No. 1) is as follows:

[0028] 2. Vector enzyme digestion The vector was double-digested with restriction endonucleases KpnI and HindIII to obtain a linearized vector homologous to the ends of the target fragment. The digestion system (total volume 40 µL) was prepared according to Table 1 and reacted at 37℃ for 1–2 hours. After the reaction was complete, the target band was recovered by agarose gel electrophoresis.

[0029] Table 1. Vector Enzyme Digestion System 3. Acquisition of the target fragment 3.1 Primer Design: Parp7 The gene sequence was synthesized as a whole and cloned into a vector. Using this plasmid as a template, the target fragment was amplified by PCR using specific primers.

[0030] 3.2 PCR amplification of the target fragment Prepare the PCR amplification system as shown in Table 2, mix gently, and place in a PCR instrument for reaction. The PCR program is shown in Table 3.

[0031] Table 2 PCR amplification system The nucleotide sequence (SEQ ID No. 2) of primer F (AAV-m-Tiparp-F) is TGATGACTGCCACAGTACGggtaccGCCACCatggaagtggaaaccac; the nucleotide sequence (SEQ ID No. 3) of primer R (AAV-m-Tiparp-R) is CTTGTCATCGTCATCCTTGTAGTCaatggaaacagtgttactgacttc.

[0032] Table 3 PCR Procedure 4. Ligation of the target fragment to the vector Using HB Infusion TM One-step cloning connection system: Prepare the reaction system as shown in Table 4 in an ice-water bath. After reacting the connected reaction solution at 50°C for 30 min, place it on ice for 5 min and immediately convert it.

[0033] Table 4 Reaction System 5. Transformation 1) Take the DH5α competent cells out of the -80℃ freezer and thaw them on ice. The competent cells should be handled gently during the dispensing process to reduce mechanical damage. 2) After the competent cells have thawed, dispense them into 50 μL tubes (20 μL is sufficient for plasmid transformation). After dispensing, add the ligation product in an amount not exceeding 1 / 10 of the competent cell volume (in this embodiment of the invention, 5 μL of ligation product is added), and place on ice for 20-30 min. 3) Heat shock at 42℃ for 90 seconds, and immediately after heat shock, insert into ice for 2-3 minutes for incubation; 4) In the clean bench, add 500 μL of antibiotic-free LB medium and gently invert the container 3-5 times. 5) Incubate at 37℃ and 230 rpm with shaking for 45-60 min; 6) Spread the bacterial solution evenly onto the corresponding resistant solid plate, then invert the plate and incubate it in a 37℃ incubator for 12-16 hours.

[0034] 6. Bacterial culture PCR identification 6.1 Bacterial PCR Identification System Table 5. Bacterial PCR Identification System The nucleotide sequence (SEQ ID No. 4) of primer 1 (F480-F) is CAACTCAGCAGAAAGCTGCT; the nucleotide sequence (SEQ ID No. 5) of primer 2 (2A-mcherry-R) is CTTGGTCACCTTCAGCTT.

[0035] 6.2 Bacterial PCR Identification Procedure Table 6. Procedure for bacterial culture PCR identification 7. Sequencing Two of the selected positive clones were used for sequencing and comparison analysis.

[0036] 7.1 Sequencing results: The following is an example of some sequencing results (SEQ ID NO:6): 7.2 Sequencing Alignment Results Sequencing alignment results as follows Figure 2 As shown, the green area represents the portion that matches the target sequence.

[0037] 8. Plasmid extraction After successful sequencing, the bacterial culture is amplified, and plasmids are extracted and purified. The plasmid extraction protocol should be followed according to the instructions of the extraction kit.

[0038] two . AAV9 -F4 / 80-parp7 Adeno-associated virus packaging and quality testing 1. Adeno-associated virus packaging 1.1 Day 1: AAV-293 cells were passaged into 100 mm Petri dishes for transfection. After the procedure, the dishes were placed in an incubator at 37°C, 5% CO2, and 95% relative humidity.

[0039] 1.2 Day 3: Transfection 1.3 Cell observation: Transfection can be performed once the cell density reaches a confluence of approximately 80-90%.

[0040] 1.4 Liposome transfection: Opti MEM needs to be preheated in a 37°C water bath, Lipofiter TM The transfection reagent must be brought to room temperature before use, and must be shaken well before use.

[0041] The transfection complex components required for transfecting 100 mm petri dishes are shown in Table 7. Table 7 Components of the transfection complex 1.5 Medium change: Replace with fresh complete medium containing 10% fetal bovine serum (FBS) 6 h after transfection.

[0042] 1.6 Cell collection: 72 h after transfection, cells containing AAV particles were gently scraped off with a cell scraper and collected in a 15 mL centrifuge tube. The cells were collected by centrifugation at 150 × g for 3 min, the culture supernatant was removed, the cells were washed once with PBS, and finally the cells were resuspended in 300 μL PBS.

[0043] 1.7 Cell lysis: Prepare a 37°C constant temperature water bath and liquid nitrogen. Repeat the freeze-thaw cycle three times between liquid nitrogen and the 37°C water bath. Remove cell debris and collect the lysate supernatant containing AAV particles.

[0044] 2. Purification of adeno-associated virus 2.1 Totipotency nuclease treatment: Add 0.1 μL of Benzonase enzyme to each 1 mL of crude virus extract, incubate at 37℃ for 1 h to remove cellular genome and residual plasmid DNA from the viral solution. Centrifuge at 600 × g, 4℃ for 10 min, and collect the supernatant.

[0045] 2.2 Column purification 2.3 Add 4 mL of AAV virus sample liquid obtained from column purification to an ultrafiltration tube, centrifuge at 1400 × g for 30 min to obtain approximately 1 mL of AAV. Collect the finally purified virus and store it at -80℃.

[0046] Example 2, AAV9 -F4 / 80-parp7 Protective effect in septic cardiomyopathy I. Experimental Methods 1. Animal experiments Recombinant adeno-associated virus type 9 (AAV9) carrying Parp7 (NM_178892.5) or empty vector cDNA and driven by the macrophage-specific promoter F4 / 80 was injected into mice via tail vein. The total viral dose was 2 × 10⁻⁶. 11 Viral genome. A septic cardiomyopathy model was established four weeks after AAV9 injection via intraperitoneal injection of LPS (10 mg / kg, 6 hours). Subsequently, mice were euthanized under sodium pentobarbital anesthesia, and blood and heart tissue were collected and preserved for subsequent analysis.

[0047] 2. Serum biochemical analysis Serum CK-MB and cTnT levels were measured using specific ELISA kits for creatine kinase isoenzyme MB (CK-MB, E-EL-M0355c) and cardiac troponin T (cTnT, E-EL-M1801c) manufactured by Elabscience Biotechnology Co., Ltd. All procedures were strictly performed according to the kit instructions. Data were analyzed spectrophotometrically using a Multiskan GO microplate reader from Thermo Fisher Scientific.

[0048] 3. Cardiac histology and immunohistochemistry Cardiac tissue was fixed in 4% paraformaldehyde, embedded in paraffin, and prepared into sections of a certain thickness for histological staining and analysis. Hematoxylin-eosin (H&E, G1120, Solarbio) was used to stain the cardiac sections to assess the degree of histopathological damage. All staining procedures were strictly performed according to the reagent instructions. Images of the stained sections were acquired under an optical microscope (ZEISS), and quantitative analysis was performed using ImageJ software.

[0049] To analyze the distribution of inflammatory cells in cardiac tissue, we performed immunohistochemical staining to detect F4 / 80 and CD11b. Tissue sections were incubated overnight at 4°C with anti-F4 / 80 antibody (70076, CST, 1:200) and anti-CD11b antibody (ab133357, Abcam, 1:200), respectively. After washing with PBS, immunoreactivity was detected using HRP-labeled secondary antibody and diaminobenzidine (DAB, DA1010, Solarbio), followed by hematoxylin counterstaining. All images were captured and recorded under an optical microscope (ZEISS).

[0050] 4. RNA extraction and real-time quantitative PCR Total RNA was extracted from heart tissue using a rapid RNA purification kit (RN001, ES Science), strictly following the kit's instructions. Subsequently, the purified RNA was reverse transcribed into cDNA using Prime Script RT Master Mix (RR036A, Takara). SYBR Green was used in a real-time quantitative PCR system. TM Quantitative PCR was performed using Premix Ex Taq™ II (RR820A, Takara). Primers used in the experiment (including...) Ifn-β , Tnf-α , Il-6 , Il-1β and internal reference β- actin All were synthesized by Invitrogen. The mRNA expression level of the target gene was normalized using β-actin as an internal reference, and 2... -△△CT The relative expression level is calculated using this method.

[0051] Table 8 Primers for RT-qPCR II. Experimental Results To explore the therapeutic potential of macrophage-derived PARP7 in septic cardiomyopathy, this invention delivers PARP7, controlled by the F4 / 80 promoter, via tail vein injection. Parp7 AAV9 vector of the gene (AAV9-F4 / 80- Parp7 The virus was delivered to mice via either a live vector (AAV9-F4 / 80-vector) or an empty vector. Four weeks after viral injection, mice were treated with normal saline (NS) or lipopolysaccharide (LPS, 10 mg / kg) for 6 hours to induce a septic cardiomyopathy model. Figure 3 A).

[0052] The results showed that LPS treatment significantly increased the serum levels of creatine kinase isoenzyme MB (CK-MB) and cardiac troponin T (cTnT), markers of myocardial injury. Figure 3 B, 3C); while in mice with macrophage-specific overexpression of PARP7, the levels of both of these markers were significantly reduced. Cardiac function assessment results showed that macrophage-specific overexpression of PARP7 significantly improved LPS-induced cardiac dysfunction (B, 3C). Figure 3 D), manifested as a significant increase in ejection fraction (EF) and fractional shortening (FS). Figure 3 E, 3F). H&E staining histopathological evaluation showed that PARP7 overexpression could alleviate LPS-induced myocardial fiber disorganization (E, 3F). Figure 3 G). Immunohistochemical analysis results showed that after injection of AAV9-F4 / 80- Parp7 In mice, LPS-induced inflammatory cell infiltration, especially the infiltration of F4 / 80⁺ and CD11b⁺ macrophages, was significantly reduced. Figure 3 H-3K). Furthermore, quantitative analysis of myocardial inflammatory gene expression showed that macrophage-specific overexpression of PARP7 significantly inhibited LPS-induced inflammation. Ifn-β , Tnf-α , Il-6 and Il-1β The upward adjustment ( Figure 3 L-3O).

[0053] In summary, the above results indicate that macrophage-derived PARP7 has a significant protective effect against LPS-induced myocardial injury and cardiac dysfunction in vivo.

[0054] In summary, this invention provides overexpression Parp7 The invention relates to the use of the reagent in the preparation of drugs for treating septic cardiomyopathy. It demonstrates that macrophage-specific overexpression of PARP7 can significantly reduce myocardial damage and dysfunction in septic cardiomyopathy, providing a new intervention target for the treatment of this disease.

Claims

1. The use of reagents that overexpress Parp7 in the preparation of drugs for treating septic cardiomyopathy.

2. The use according to claim 1, characterized in that, The reagent used to overexpress Parp7 is an adeno-associated virus vector that overexpresses Parp7.

3. The use according to claim 2, characterized in that, The adeno-associated virus vector is an AAV9 serotype vector.

4. The use according to claim 3, characterized in that, The reagent for overexpressing Parp7 contains a macrophage-specific promoter and a nucleotide sequence encoding the Parp7 protein.

5. The use according to claim 4, characterized in that, The macrophage-specific promoter is F4 / 80 Gene promoter.

6. The use according to claim 4, characterized in that, The nucleotide sequence encoding the Parp7 protein is shown in SEQ ID NO:

1.

7. The use according to any one of claims 1 to 6, characterized in that, The septic cardiomyopathy mentioned is lipopolysaccharide-induced septic cardiomyopathy.

8. The use according to any one of claims 1 to 6, characterized in that, The drug is used to reduce myocardial damage, inhibit inflammatory cell infiltration, or reduce the expression of inflammatory factors.

9. An AAV9 -F4 / 80-parp7 Adeno-associated virus vector, characterized in that, The carrier contains F4 / 80 A gene promoter and a nucleotide sequence encoding the Parp7 protein; the nucleotide sequence encoding the Parp7 protein is shown in SEQ ID NO:

1.

10. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the AAV9 of claim 9. -F4 / 80- parp7 Adeno-associated virus vectors are used as active ingredients, as well as pharmaceutically acceptable carriers or excipients.

Images