Trichoderma reesei engineering strain with high yield of beta-glucosidase, construction method and application thereof

Abstract

The application discloses an engineered Trichoderma reesei strain with high yield of beta-glucosidase, and a construction method and application thereof. In view of the problems of low beta-glucosidase activity of a natural cellulase system of Trichoderma reesei in the prior art and easy accumulation of cellobiose to cause feedback inhibition, the application takes Trichoderma reesei RUT-C30 as a starting strain, and through three-step progressive operation, firstly, a beta-glucosidase gene expression cassette derived from Aspergillus niger is integrated into a URA5 gene locus; then, an expression cassette containing a URA5 back complement unit and a BGL gene is constructed and integrated into an ACE1 gene site; finally, a transcription activator XYR1 expression cassette is integrated into a PEP1 site. Through the above iterative modification, an engineered strain with stable genetic traits, capable of simultaneously high-level secretion of beta-glucosidase and filter paper enzyme is obtained. It is verified through experiments that the beta-glucosidase activity of the engineered strain can be up to 80.6 IU / mL, which is 268.3 times that of the starting strain.

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation technology, and in particular to an engineered strain of Trichoderma reesei that produces high levels of β-glucosidase, its construction method, and its applications. Background Technology

[0002] Lignocellulose is the most abundant renewable organic resource on Earth, widely derived from agricultural waste (such as rice straw and corn cobs), forestry residues, and energy crops. It is primarily composed of cellulose, hemicellulose, and lignin, interwoven through complex physicochemical processes, forming a robust natural barrier against degradation. Cellulose, a linear glucose polysaccharide linked by β-1,4 glycosidic bonds, is the core substrate for converting lignocellulose into fermentable sugars and high-value-added products. However, the crystallinity, degree of polymerization, and encapsulation by the lignin-hemicellulose matrix of cellulose make efficient and low-cost saccharification a long-standing and significant challenge in the field of biorefining.

[0003] Trichoderma reesei is an important industrial filamentous fungus for cellulase production. In the cellulase system secreted by its natural strains, β-glucosidase (BGL) activity is typically low, leading to cellobiose accumulation. This, in turn, inhibits the activity of exoglucanases and endoglucanases, limiting overall cellulose degradation efficiency. Therefore, increasing BGL yield is key to improving the saccharification capacity of the Trichoderma reesei cellulase system.

[0004] Traditional breeding methods have limited effectiveness in enhancing BGL activity. While gene editing technology can achieve precise modification, most studies focus only on manipulating single genes and mainly rely on overexpressing the endogenous BGL gene of Trichoderma reesei. Its enzymatic properties (such as optimal pH, temperature, and tolerance to product inhibition) still have room for improvement.

[0005] For example, in the prior art, application publication number CN106282217A discloses an expression vector for a β-glucosidase mutant protein, an engineered strain for expression, and an expression method. This method involves constructing a light-inducible expression vector and inducing the expression of the β-glucosidase mutant protein through light irradiation, thereby increasing the expression level of β-glucosidase. However, the β-glucosidase production capacity of the engineered bacteria under this method remains low. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a high-yield β-glucosidase-producing Trichoderma reesei engineered strain, its construction method, and its application.

[0007] The specific technical solution of this invention is as follows:

[0008] In a first aspect, the present invention provides a high-yield β-glucosidase-producing *Trichoderma reesei* engineered strain. The *Trichoderma reesei* engineered strain comprises: a first BGL expression cassette integrated into the URA5 gene locus, a second BGL expression cassette integrated into the ACE1 gene locus, and a transcription activator XYR1 expression cassette integrated into the PEP1 gene locus; wherein:

[0009] The first BGL expression cassette includes the BGL gene derived from Aspergillus niger;

[0010] The second BGL expression cassette includes the BGL gene derived from Aspergillus niger and the endogenous URA5 gene from Trichoderma reesei;

[0011] The transcription activator XYR1 expression cassette includes the endogenous transcription activator XYR1 from Trichoderma reesei.

[0012] To address the problems of low β-glucosidase activity and feedback inhibition caused by cellobiose accumulation in the natural cellulase system of *Trichoderma reesei* in existing technologies, this invention provides a high-yield β-glucosidase-producing *Trichoderma reesei* engineered strain. This invention involves integrating a β-glucosidase gene expression cassette derived from *Aspergillus niger* into the URA5 gene locus in the *Trichoderma reesei* basal cells; secondly, based on this transformant, constructing an expression cassette containing the URA5 and BGL genes, and integrating it into the ACE1 gene locus to reinforce the expression of both the URA5 and BGL genes; finally, integrating the transcription activator XYR1 expression cassette into the PEP1 locus. Through these iterative modifications, a genetically stable *Trichoderma reesei* engineered strain, Tr-XYR1-BGL2, capable of simultaneously secreting high levels of β-glucosidase and filter paper enzyme, was obtained.

[0013] Experiments verified that the strain integrating only the first BGL expression cassette had a BGL enzyme activity of 17.2 IU / mL, while the strain integrating both the first and second BGL expression cassettes had an activity of 32.2 IU / mL. The *Trichoderma reesei* engineered strain Tr-XYR1-BGL2, which integrated all three expression cassettes, exhibited the highest β-glucosidase activity of 80.6 IU / mL, 268.3 times that of the starting strain, significantly enhancing BGL enzyme activity. This demonstrates the superiority of the modification strategy of this invention; through the interaction of the three expression cassettes, it can significantly improve the BGL enzyme activity in *Trichoderma reesei* fermentation. Further experimental verification showed that the engineered strain Tr-XYR1-BGL2 can significantly improve the saccharification efficiency of lignocellulose.

[0014] Preferably, the promoter used to regulate the expression of the first BGL expression cassette, the second BGL expression cassette, and the transcription activator XYR1 expression cassette is an endogenous promoter of Trichoderma reesei.

[0015] Further preferred, the promoter used to regulate the first BGL expression box is promoter Pcbh1.

[0016] Further preferred, the promoter used to regulate the second BGL expression box is promoter Pgpd1.

[0017] Further preferably, the promoter used to regulate the expression cassette of the transcription activator XYR1 is promoter Pgpd1.

[0018] Secondly, the present invention provides a method for constructing the above-mentioned Trichoderma reesei engineered strain, which includes the following steps:

[0019] (1) The first BGL expression cassette is integrated into the URA5 locus of the sclerotium using homologous recombination technology; the sclerotium is Trichoderma reesei RUT-C30, and the first BGL expression cassette includes the BGL gene derived from Aspergillus niger;

[0020] (2) The second BGL expression cassette is integrated into the ACE1 gene locus of the strain obtained in step (1) by homologous recombination technology; the second BGL expression cassette includes the BGL gene from Aspergillus niger and the endogenous URA5 gene from Trichoderma reesei.

[0021] (3) The transcription activator XYR1 expression cassette is integrated into the PEP1 gene locus of the strain obtained in step (2) by homologous recombination technology; the transcription activator XYR1 expression cassette includes the endogenous transcription activator XYR1 of Trichoderma reesei.

[0022] Preferably, the first BGL expression cassette is constructed by inserting the BGL gene from Aspergillus niger between the promoter Pcbh1 and terminator Tcbh1 from Trichoderma reesei to construct a BGL expression unit.

[0023] Preferably, the second BGL expression cassette is constructed by inserting the BGL gene from Aspergillus niger and the URA5 gene from Trichoderma reesei between the promoter Pgpd1 and the terminator TtrpC from Trichoderma reesei to construct the BGL and URA5 gene expression unit.

[0024] Preferably, the method for constructing the transcription activator XYR1 expression cassette is as follows: the transcription activator XYR1 gene derived from Trichoderma reesei is inserted between the promoter Pgpd1 and the terminator TtrpC derived from Trichoderma reesei to construct an XYR1 expression unit.

[0025] Secondly, the present invention provides the application of the above-mentioned Trichoderma reesei engineered strain in the production of β-glucosidase, filter paper enzyme production, or straw enzymatic hydrolysis.

[0026] Compared with the prior art, the present invention has the following technical effects:

[0027] To address the problems of low β-glucosidase activity and easy accumulation of cellobiose leading to feedback inhibition in the natural cellulase system of *Trichoderma reesei* in existing technologies, this invention uses *Trichoderma reesei* RUT-C30 as the starting strain and employs a three-step progressive operation: First, the β-glucosidase gene expression cassette derived from *Aspergillus niger* is integrated into the URA5 gene locus; second, based on this transformant, a vector containing the URA5 and BGL gene expression cassettes is constructed and integrated into the ACE1 gene locus; finally, the transcription activator XYR1 expression cassette is integrated into the PEP1 locus. Through the above iterative modification, a genetically stable *Trichoderma reesei* engineered strain Tr-XYR1-BGL2, capable of simultaneously secreting high levels of β-glucosidase and filter paper enzyme, was obtained. Experimental verification showed that the β-glucosidase activity of this engineered strain can reach up to 80.6 IU / mL, which is 268.3 times that of the starting strain, significantly improving the saccharification efficiency of lignocellulose. Attached Figure Description

[0028] Figure 1 A schematic diagram of the multi-round iterative gene modification strategy of Trichoderma reesei;

[0029] Figure 2 The results of enzyme activity assays for fermentation enzymes produced by engineered strains Tr-06, Tr-07, and Tr-XYR1-BGL2;

[0030] Figure 3 The dynamic curve of β-glucosidase production by fermentation of engineered strain Tr-XYR1-BGL2;

[0031] Figure 4 The dynamic curve of filter paper enzyme production by fermentation of engineered strain Tr-XYR1-BGL2;

[0032] Figure 5 To compare the β-glucosidase activity of the iteratively modified strain with that of the original strain;

[0033] Figure 6 Comparison of filter paper enzyme activity between the iteratively modified strain and the starting strain;

[0034] Figure 7 To compare the enzymatic hydrolysis efficiency of different strains on rice straw. Detailed Implementation

[0035] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0036] In this embodiment, the culture medium used has the following composition:

[0037] Initial screening of solid culture media:

[0038] Tryptone 5 g / L, KH2PO4 4 g / L, (NH4)2SO4 4 g / L, MgSO4·7H2O 0.6 g / L, NaCl 2 g / L, CaCO3 5 g / L, aescin 1 g / L, ferric citrate 1 g / L, agar powder 20 g / L, natural pH.

[0039] The seed culture medium formula is as follows:

[0040] Glucose 20 g / L, yeast extract 9 g / L, (NH4)2SO4 5 g / L, KH2PO4 10 g / L, MgSO4·7H2O 1 g / L, CaCl2 0.5 g / L, trace elements (FeSO4·7H2O 0.005 g / L, ZnSO4·7H2O 0.0014 g / L, MnSO4·H2O 0.0016 g / L, CoCl2·6H2O 0.0037 g / L), natural pH.

[0041] The fermentation medium formula is as follows:

[0042] Microcrystalline cellulose 40 g / L, yeast extract 5 g / L, (NH4)2SO4 1.4 g / L, KH2PO4 g / L, CaCl2 0.3 g / L, MgSO4·7H2O 0.3 g / L, trace elements (FeSO4·7H2O 0.005 g / L, ZnSO4·7H2O 0.0014 g / L, MnSO4·H2O 0.0016 g / L, CoCl2·6H2O 0.0037 g / L), Tween-80 2 drops, pH 5.0.

[0043] In the following examples, the β-glucosidase (BGL) gene used was derived from Aspergillus niger. The BGL gene was codon optimized as shown in SEQ NO.1, and the optimized sequence was synthesized in its entirety for use in subsequent examples.

[0044] In the following examples, the enzyme activity assay method is as follows:

[0045] BGL activity assay: Using p-nitrophenyl-β-D-glucopyranoside (pNPC) as a substrate, the following steps were performed to determine β-glucosidase activity: 1 mL of 5 mM pNPC solution and 100 μL of diluted enzyme solution were added to a 10 mL stoppered test tube, mixed well, and reacted in a 50 ℃ water bath for 30 min. Then, 2 mL of 1 M Na2CO3 solution was added to terminate the reaction, and after thorough mixing, the absorbance was measured at 400 nm.

[0046] FPA assay method: Fold 50 mg Waltman filter paper and place it at the bottom of a 10 mL stoppered test tube. Add 50 μL of diluted enzyme solution and 1.45 mL of 0.05 M pH 4.8 citrate buffer solution. Mix well and incubate at 50 ℃ for 20 min. After the reaction is complete, add 2 mL of DNS reagent, incubate in boiling water for 5 min, cool, and then bring the volume to 10 mL with deionized water. Mix thoroughly and measure the absorbance at 540 nm. For the control group, the procedure is adjusted so that DNS reagent is added first and the enzyme is inactivated by boiling water before adding the enzyme solution to eliminate interference from non-enzymatic reactions.

[0047] Xylanase activity assay method: Same as FPA enzyme activity assay method, except the substrate is replaced with 1.2% xylan solution.

[0048] One enzyme activity unit (U) is defined as the amount of enzyme required to catalyze the production of 1 μmol of the corresponding product per minute under the conditions measured in this experiment. Here, FPA is calculated as glucose, xylanase as xylose, and BGL as p-nitrophenol (pNP).

[0049] The primer information used in the following examples is shown in Table 1.

[0050] Table 1 Primer name Sequence information (5'-3') URA5-5'F ATGACATGATTACGAATTCAGCCGGCACGGATCT URA5-5'R AGGTACGCGTCTGTTGGATTTGGATAGTGTCCTT URA5-3'F TCGACTAGTTTTGAGGCGTTCAATGTCAGAAG URA5-3'R CAAACACTGATAGTTTAAACTTTGACGTCCACACC ACE1-5'F ATGACATGATTACGAATTCAGCCAAGCAGCGAAAA ACE1-5'R TCCTTCTTCTGCGTCACGCGTGTGTTCTTTTCCTT ACE1-3'F TAGGCGCAGCTCGACTAGTCCGAGAAGGAAATGGA ACE1-3'R CGGCCAGTGCCAAGCTTCCTGGGTTCGATTCC PEP1-5'F CTATGACATGATTACGAATTCCTGGTGACTGGCCGTCTGG PEP1-5'R CTCGTGCTGCTTGAATATCGGAGAAGGTTGCTC PEP1-3'F TAGGCGCAGCTCGACTAGTGGCGATGGTGGACTTGTTTATG PEP1-3'R CAAGCTTCTCCCCTGTCAATTCCCTTATTT .

[0051] Example 1: Construction of recombinant Trichoderma reesei strain

[0052] Using *Trichoderma reesei* RUT-C30 as the starting strain, the first round of gene editing was carried out. The details are as follows:

[0053] Using plasmid pCAMBIA1300 as the vector backbone, the BGL gene was inserted between the strong promoter Pcbh1 (GeneBank accession number: AB524354.1) and the terminator Tcbh1 (as shown in SEQ NO.2) from *Trichoderma reesei* using seamless cloning technology to construct the basic BGL expression unit. Using genomic DNA from *Trichoderma reesei* RUT-C30 (purchased from ATCC (number 56765), a publicly available strain) as a template, PCR amplification was performed using primer pairs URA5-5'F / URA5-5'R and URA5-3'F / URA5-3'R, respectively, to obtain upstream and downstream homologous arms of the URA5 gene (uracil phosphoribosyltransferase gene) with a length of approximately 1.5 kb. These two homologous arms were then ligated to both sides of the BGL expression unit using a one-step cloning method to construct a recombinant plasmid targeting the URA5 gene locus. A schematic diagram of the structure of this recombinant plasmid is shown below. Figure 1 As shown.

[0054] The recombinant plasmid was introduced into *Trichoderma reesei* RUT-C30 chassis cells using Agrobacterium-mediated transformation. Transformants were screened on uracil-deficient medium, followed by reverse screening on plates containing 5-FOA (5-fluoroorotic acid). Transformants meeting the phenotypic selection criteria were transferred to primary screening solid medium, and strains with larger chromogenic zones were selected for shake-flask fermentation verification. Finally, recombinant *Trichoderma reesei* was obtained by PCR identification and enzyme activity assay, and named Tr-06.

[0055] Using the starting strain *Trichoderma reesei* RUT-C30 as a control, Tr-06 was inoculated onto PDA plates and cultured for 5 days. The inoculum was then transferred to shake flasks containing seed culture medium (50 mL in a 250 mL shake flask) and cultured at 28 °C and 200 r / min for 48 hours to obtain the seed culture. Subsequently, the seed culture was transferred to fermentation medium at an inoculation rate of 6% (v / v) and cultured under the same conditions for another 144 hours. Samples were then taken to determine the BGL enzyme activity. Results are shown below. Figure 2 .

[0056] Depend on Figure 1 It is evident that the BGL enzyme produced by the Tr-06 strain during fermentation was significantly higher than that produced by the Trichoderma reesei starting strain RUT-C30.

[0057] Example 2: Construction of recombinant Trichoderma reesei strain

[0058] Using the Tr-06 strain constructed in Example 1 as the starting strain, a second round of gene editing was further carried out. The details are as follows:

[0059] The BGL expression unit constructed in this round comprises the following parts: 1) the endogenous constitutive promoter Pgpd1 from *Trichoderma reesei* (GeneBank accession number: XM_006961201.1); 2) the endogenous *Trichoderma reesei* URA5 gene (GeneBank accession number: X55879.1); 3) the BGL gene (as shown in SEQ NO.1); and 4) the TtrpC terminator (as shown in SEQ NO.2). A schematic diagram of the structure of this BGL expression unit is shown below. Figure 1 As shown in the figure, the BGL expression unit was site-specifically integrated into the ACE1 gene locus of strain Tr-06 using homologous recombination technology. Transformants were screened using 5-FOA plates; transformants that successfully reintroduced the URA5 gene failed to grow on 5-FOA-containing media due to restored uracil synthesis. After PCR verification and phenotypic confirmation, a recombinant strain with the BGL expression cassette integrated into the ACE1 locus and restored URA5 gene function was finally obtained and named Tr-07.

[0060] The enzyme was cultured according to the method in Example 1, and samples were taken to determine BGL enzyme activity. Results are shown below. Figure 2 .

[0061] Depend on Figure 1 It is evident that the BGL enzyme produced by the Tr-07 strain during fermentation was significantly higher than that of the Trichoderma reesei starting strain RUT-C30, and also significantly higher than that of the Tr-06 strain.

[0062] Example 3: Construction of recombinant Trichoderma reesei strain

[0063] Using the Tr-07 strain constructed in Example 1 as the starting strain, a third round of gene editing was conducted. This round of modification aimed to enhance key transcriptional regulation of the cellulase system through site-directed mutagenesis. The details are as follows:

[0064] First, the endogenous transcriptional activator XYR1 from Trichoderma reesei (GeneBank accession number: AF479644.1) was amplified and placed between the constitutive strong promoter Pgpd1 and the terminator TtrpC to construct the XYR1 expression cassette. A schematic diagram is shown below. Figure 1 As shown, the XYR1 expression cassette was integrated into the PEP1 gene locus in the genome using homologous recombination technology. Transformants were screened for resistance using hygromycin-containing medium to obtain positive clones with stable integration at this site. After PCR verification and sequencing confirmation, an engineered strain carrying both a double-copy BGL expression cassette and the enhanced transcription activator XYR1 was finally obtained, named Tr-XYR1-BGL2.

[0065] The enzyme was cultured according to the method in Example 1, and samples were taken to determine BGL enzyme activity. Results are shown below. Figure 2 .

[0066] Depend on Figure 1 It can be seen that the BGL enzyme produced by the fermentation of strain Tr-XYR1-BGL2 was significantly higher than that of the starting strain Trichoderma reesei RUT-C30, and significantly higher than that of strains Tr-06 and Tr-07. The BGL enzyme activity of strain Tr-06 was 17.6 IU / mL, that of strain Tr-07 was 33.0 IU / mL, and that of strain Tr-XYR1-BGL2 was 80.6 IU / mL.

[0067] Therefore, integration of the BGL expression cassette at different sites may produce interactive effects. For example, the enhanced activity of BGL enzymes by simultaneous integration at different sites on the ACE1 and URA5 gene loci can be significantly higher than that achieved by integration at a single site. To further verify this interaction, this embodiment also integrated the BGL gene into the cbh1 and cbh2 loci. It was found that the effect of BGL gene integration at these single sites was still less than that of dual-site integration at the ACE1 and URA5 gene loci. In addition, after the BGL gene expression cassette is integrated into the URA5 gene locus (Example 1), the function of the URA5 gene needs to be restored.

[0068] To better demonstrate the enhanced BGL enzyme activity of the Tr-XYR1-BGL2 engineered bacteria constructed in this embodiment, the bacteria were cultured for 168 hours according to the method in Example 1, with samples taken every 24 hours to measure the BGL enzyme activity. The results are shown below. Figure 3 , Figure 4 At the end of the culture, samples were taken to measure the activities of BGL enzyme and FPA (filter paper enzyme), and the results are shown in [see figure]. Figure 5 , Figure 6 .

[0069] The results show that... Figure 3 and Figure 4 As shown, the BGL activity of the engineered strain Tr-XYR1-BGL2 peaked at 80.6 IU / mL at 144 hours, and the FPA peaked at 10.9 IU / mL at 168 hours. Figure 5 and Figure 6 As shown, compared with the original strain, the activities of the above three enzymes increased by 268.3 times and 2.5 times, respectively.

[0070] Example 4: Straw enzymatic hydrolysis experiment

[0071] Straw pretreatment: 100.0 g of crushed rice straw was added to a 2% NaOH solution at a solid-liquid ratio of 1:10 (w / v) and soaked overnight at room temperature. Subsequently, it was treated at 121 ℃ for 30 min. After the reaction, the solids were collected, repeatedly washed with deionized water until neutral, and dried in an oven to obtain alkali-pretreated straw. The cellulose, hemicellulose, and lignin contents of the straw before and after pretreatment were determined using standard methods. The results showed that the main components of the pretreated straw were: cellulose 48.1%, hemicellulose 28.7%, and lignin 10.0%.

[0072] Enzymatic hydrolysis experiment: The reaction was carried out in a 250 mL shake flask, with a total reaction volume of 70 mL. Using 2.5 g of the pretreated straw as the substrate, 5 mL of crude fermentation enzyme solution (Tr-XYR1-BGL2 bacterial culture obtained after 168 hours of cultivation according to the method in Example 3) was quantitatively added, along with 1-2 drops of Tween-80 as a surfactant. The volume was adjusted to 70 mL using 50 mM, pH 4.8 sodium citrate buffer, and the flask was sealed to prevent water evaporation. The reaction system was placed in a shaker at 50 ℃ and 120 rpm for 48 hours for enzymatic hydrolysis.

[0073] Enzymatic hydrolysis yield calculation: After enzymatic hydrolysis, samples are taken to determine the reducing sugar content. The enzymatic hydrolysis yield is calculated using the following formula:

[0074] Y=(m1×0.9) / m o ×100%

[0075] in,

[0076] Y represents the enzyme digestion yield, in % .

[0077] m1 is the total amount of reducing sugar in the fermentation supernatant, in grams;

[0078] 0.9 is the conversion factor between glucose and cellulose;

[0079] m o This represents the total amount of hemicellulose and cellulose in the substrate, expressed in grams.

[0080] Parallel enzymatic digestion experiments were conducted using wild-type strains RUT-C30 and Tr-XYR1-BGL2. Figure 7 As shown, the enzymatic hydrolysis yields of each strain on pretreated rice straw were as follows: 44.9% for the starting strain RUT-C30 and the highest value of 93.4% for Tr-XYR1-BGL2, further verifying the effectiveness of the multi-round iterative modification strategy of the present invention.

[0081] Unless otherwise specified, all raw materials and equipment used in this invention are commonly used in the field. Unless otherwise specified, all plasmid vectors and starting strains used in this invention are conventional vectors and strains in the field, commercially available, and publicly disclosed products. Unless otherwise specified, all methods used in this invention are conventional methods in the field. Unless otherwise specified, the experimental methods and operations in this invention refer to Molecular Cloning: A Laboratory Manual (Fourth Edition), translated by He Fuchu, Chen Wei, Yang Xiaoming, et al.

[0082] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A high-yield β-glucosidase-producing Trichoderma reesei engineered strain, characterized in that: The engineered Trichoderma reesei strain includes: a first BGL expression cassette integrated into the URA5 gene locus, a second BGL expression cassette integrated into the ACE1 gene locus, and a transcription activator XYR1 expression cassette integrated into the PEP1 gene locus; wherein: The first BGL expression cassette includes the BGL gene derived from Aspergillus niger; The second BGL expression cassette includes the BGL gene derived from Aspergillus niger and the endogenous URA5 gene from Trichoderma reesei; The transcription activator XYR1 expression cassette includes the endogenous transcription activator XYR1 from Trichoderma reesei.

2. The engineered strain of *Trichoderma reesei* with high β-glucosidase production as described in claim 1, characterized in that: The promoters used to regulate the expression of the first BGL expression cassette, the second BGL expression cassette, and the transcription activator XYR1 expression cassette are Trichoderma reesei endogenous promoters.

3. The engineered strain of *Trichoderma reesei* with high β-glucosidase production as described in claim 2, characterized in that: The promoter used to regulate the first BGL expression box is promoter Pcbh1.

4. The engineered strain of *Trichoderma reesei* with high β-glucosidase production as described in claim 2, characterized in that: The promoter used to regulate the second BGL expression box is promoter Pgpd1.

5. The engineered strain of *Trichoderma reesei* with high β-glucosidase production as described in claim 2, characterized in that: The promoter used to regulate the expression cassette of the transcription activator XYR1 is promoter Pgpd1.

6. The method for constructing the engineered Trichoderma reesei strain according to any one of claims 1 to 5, characterized in that: Includes the following steps: (1) The first BGL expression cassette is integrated into the URA5 locus of the sclerotium using homologous recombination technology; the sclerotium is Trichoderma reesei RUT-C30, and the first BGL expression cassette includes the BGL gene derived from Aspergillus niger; (2) The second BGL expression cassette is integrated into the ACE1 gene locus of the strain obtained in step (1) by homologous recombination technology; the second BGL expression cassette includes the BGL gene from Aspergillus niger and the endogenous URA5 gene from Trichoderma reesei. (3) The transcription activator XYR1 expression cassette is integrated into the PEP1 gene locus of the strain obtained in step (2) by homologous recombination technology; the transcription activator XYR1 expression cassette includes the endogenous transcription activator XYR1 of Trichoderma reesei.

7. The construction method as described in claim 6, characterized in that: The first BGL expression cassette is constructed by inserting the BGL gene from Aspergillus niger between the promoter Pcbh1 and terminator Tcbh1 from Trichoderma reesei to construct a BGL expression unit.

8. The construction method as described in claim 6, characterized in that: The second BGL expression cassette is constructed by inserting the BGL gene from Aspergillus niger and the URA5 gene from Trichoderma reesei between the promoter Pgpd1 and the terminator TtrpC from Trichoderma reesei to construct the BGL and URA5 gene expression unit.

9. The construction method as described in claim 6, characterized in that: The method for constructing the transcription activator XYR1 expression cassette is as follows: the transcription activator XYR1 gene derived from Trichoderma reesei is inserted between the promoter Pgpd1 and the terminator TtrpC derived from Trichoderma reesei to construct the XYR1 expression unit.

10. The application of the engineered Trichoderma reesei strain as described in any one of claims 1 to 5 or the engineered Trichoderma reesei strain constructed by the construction method as described in any one of claims 6 to 9 in the production of β-glucosidase, filter paper enzyme production or straw enzymatic hydrolysis.

Images